Next Article in Journal
Numerical Simulation of Soil Water–Salt Dynamics and Agricultural Production in Reclaiming Coastal Areas Using Subsurface Pipe Drainage
Previous Article in Journal
Improving the Sustainability of Rice Cultivation in Central Thailand with Biofertilizers and Laser Land Leveling
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 13
Issue 2
10.3390/agronomy13020589
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Pyramiding Rice Blast Resistance Gene Pi2 and Fragrance Gene badh2

by
Yakun Wang
1,
Shengjia Tang
1,
Naihui Guo
2,
Ruihu An
1,
Zongliang Ren
1,
Shikai Hu
1,
Xiangjin Wei
1,
Guiai Jiao
1,
Lihong Xie
1,
Ling Wang
1,
Ying Chen
1,
Fengli Zhao
1,
Shaoqing Tang
1,*,
Peisong Hu
1,3 and
Zhonghua Sheng
1
1
State Key Laboratory of Rice Biology, China National Center for Rice Improvement, China National Rice Research Institute, Hangzhou 310006, China
2
Rice Research Institute, Shengyang Agricultural University, Shenyang 110065, China
3
Zhejiang Lab, Hangzhou 310006, China
*
Author to whom correspondence should be addressed.
Agronomy 2023, 13(2), 589; https://doi.org/10.3390/agronomy13020589
Submission received: 11 December 2022 / Revised: 8 February 2023 / Accepted: 9 February 2023 / Published: 18 February 2023
(This article belongs to the Section Crop Breeding and Genetics)
Browse Figures
Versions Notes

Abstract

:
Rice is a major food crop across the globe, but the frequent occurrence of rice blast in recent years has seriously affected the yield of rice. In addition, fragrance rice is becoming increasingly popular among consumers. In this study, the fragrant rice variety Wenxiang-1 was used as the donor of the fragrance gene badh2, and the rice variety R1179 was used as the donor of rice blast resistance gene Pi2. Plants that were homozygous for both Pi2 and badh2 were selected using marker-assisted selection (MAS) applied to the Wenxiang-1/R1179 F2 segregation population with the functional markers Pi2-1 and Badh2-1 as well as whole-genome-SNP-genotyping technology. Finally, “elite” rice varieties R365 and R403 that had both high levels of rice blast resistance (level 3 and 4) and fragrance (0.650 and 0.511 mg/kg) were bred. Genetic composition analysis indicated that 40.67% of the whole genome of R365 was inherited from Wenxiang-1, while 59.33% was inherited from R1179. Similarly, 46.26% of the whole genome of R403 was inherited from Wenxiang-1, while 53.74% was inherited from R1179. These new hybrid lines with R365 and R403 as the male parents also exhibit high yield per hectare, especially C815S/R365 and Yu03S/R403 F1, with yields per hectare of 9.93 ± 0.15 and 9.6 ± 0.17 tons. These plants also possess high levels of rice blast resistance (level 3 and 4) and fragrance (0.563 and 0.618 mg/kg).

1. Introduction

Rice (Oryza sativa L.) is the primary food crop for more than half of the world’s population, and the demand for rice continues to increase, especially among developing countries in Africa and Asia [1]. However, rice production is very sensitive to various types of biotic and abiotic stress [2]. Rice blast is a major biotic stressor caused by the fungal pathogen Magnaporthe oryzae that typically causes 10–30% yield loss when it occurs epidemically [3,4]. The improvement of host resistance is an effective and economical way to control blast.
Molecular marker-assisted selection breeding (MAS) directly identifies genotypes at the DNA level and screens target genes through molecular markers closely linked to the genotypes of target traits and has been widely used for the genetic improvement of crops. Kongyu 131 is an elite japonica rice variety from Heilongjiang Province, China. However, the yield of Kongyu 131 is low. In the study carried out by Feng (2017), a minute chromosome fragment carrying the favorable Gn1a allele from the donor parent was introgressed into the genome of Kongyu 131, which resulted in a larger panicle and subsequent yield increase in the new Kongyu 131 variety [5]. In the research conducted by Angeles (2020), the quantitative resistance gene pi21 from Sensho was introgressed to an indica breeding line IR63307-4B-13-2, a pyramiding line IRBB4/5/13/21, and a tropical japonica line Kinandang Patong by marker-assisted backcrossing, and a new rice variety resistant to rice blast was bred. Additionally, Thanasilungura (2020) improved blast resistance and salt resistance by marker-assisted backcross (MAB) while maintaining the original agronomic traits [6,7]. To date, over 100 rice blast resistance genes have been identified, of which 39 have been cloned (Pit c; Pi37; Pish; Pi35; Pi64; Pib; bsr-d1; pi21; Pi63; Pi2; Pi9; Piz-t; Pigm; Pid2; Pid3; Pi25; Pid3- A4; Pi50; Pi36; Pi33; Pi5; Pii; Pi56; bsr-k1; Pia; Pi-CO39; Pi54; Pi54rh; Pi54of; Pik; Pi-1; Pikh; Pikm; Pikp; Pike; Piks; Pb1; Pi-ta; and Ptr) [8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45]. Many markers closely linked to these genes have been developed as well, including some functional markers actually located inside the genes themselves [1]. These markers can be used for MAS concerning the improvement of rice blast resistance, thereby saving time and improving the efficiency of the breeding process.
Rice with fragrance has greater consumer appeal, and the retail price of fragrant rice is higher than that of conventional rice varieties [46]. The principal compound responsible for fragrance is 2-acetyl-1-pyrroline (2AP) [47,48]. Map-based gene cloning has shown that the synthesis and accumulation of (2-acetyl-1-pyrrolin, 2AP) 2AP in rice grains is associated with the gene badh2, which encodes a betaine-aldehyde dehydrogenase, and contains 15 exons and 14 introns [49,50]. Several studies have suggested that the presence of 2AP is attributable to badh2, a recessive allele of BADH2 that carries fragment deletions, including a 7 bp deletion on the 2nd exon, an 8 bp deletion on the 7th exon, and an 803 bp deletion between exons 4 and 5 [49,51,52,53].
Fragrance is a complex trait for selection because of the recessive nature of the gene and the difficulty of assessing the fragrance of a large number of plants. Due to the instability in the expression of the fragrance gene badh2 and the complexity of fragrance determination, marker-assisted selection (MAS) has become a useful tool for the screening of fragrance genes. For example, the 8 bp deletion on the 7th exon and the 7 bp deletion on the 2nd exon have been used to develop functional markers of fragrance rice varieties for MAS and have improved the accuracy of the selection of fragrant rice [51].
The Pi2 gene is a broad-spectrum rice blast resistance gene that has been widely used in Chinese rice production. The functional marker for Pi2, Pi2-1, was developed by our research team [1], and we have also developed the functional marker Badh2-1 for badh2 [54]. In this study, we crossbred R1179—a rice restorer line containing Pi2—with Wenxiang-1, a fragrant rice variety containing badh2. We then used the functional markers Pi2-1 of Pi2 and Badh2-1 of badh2 for MAS of rice blast resistance and fragrance in the progeny segregation population, in addition to considering other agronomic traits. As a result of this process, we obtained new rice varieties with both good quality and high levels of rice blast resistance.

2. Materials and Methods

2.1. Experimental Materials

Wenxiang-1 is a conventional fragrant rice variety famous in Yunnan province, China, and the 2AP content of this grain is 0.867 mg/kg. The quality of this rice is considered to be “excellent”, but the plant is also considered to be too tall and to grow too slowly. More importantly, this type of rice is susceptible to rice blast. Genotyping detection has indicated that the fragrance in Wenxiang-1 is caused by a non-functional badh2. Another type of rice, R1179, is a restorer line that was bred by space flight mutation and has rice blast resistance and excellent rice quality. However, this variety’s yield is not high, and the plants’ stems are too slender and soft. Studies have shown that R1179 contains functional Pi2, the broad spectrum resistance gene of rice blast [55]. In this study, we used the F2 segregation population of Wenxiang-1×R1179 for MAS in order to select excellent rice varieties containing both Pi2 and badh2.
All the materials, including the Wenxiang-1, R1179, Wenxiang-1×R1179 F1, and Wenxiang-1×R1179 F2 populations, as well as the new hybrid rice combinations, were planted in the test field at the China National Rice Research Institute in Hangzhou. Each new hybrid rice combination included at least 300 plants, which were set in a random block arrangement with 3 replications. The planting grid was 20 × 24 cm. Fengliangyou-4, a rice variety that is widely used in Chinese rice production, was employed as the control variety.

2.2. Phenotype Identification of Fragrance and the Amylose Content of Parents and Selected New Rice Varieties

The 2AP content of grains from the parents and the selected elite rice varieties was determined using GC-MS according to a previous report [56]. A total of 1 g of whole-meal rice flour was extracted for 3 h at 80 °C in a 1:1 (v/v) solution of anhydrous ethanol and methylene chloride, with 0.5 mg/L of 2,4,6-trimethylpyridine used as an internal standard. After 30 min at room temperature, an aliquot of the supernatant was injected (Agilent, Santa Clara, CA, USA). The carrier was helium gas (99.999% purity) at a pressure of 34.5 kpa, and the injector and GC-MS interface temperatures were both 170 °C. The initial temperature of the HP-5MS capillary column (30 m × 0.25 mm, 0.25 µm id; J&W, Folsom, CA, USA) was 50 °C. After 2 min, the temperature was increased to 280 °C at a rate of 10 °C/min. The eluent was then introduced directly into the mass spectrometer, which was operated in electron impact (EI) mode with an ionization voltage of 70 eV and an ion source temperature of 230 °C. The assessment of grain amylose content was performed according to the method reported by Jin et al. (2010) with minor modifications [57].

2.3. Phenotype Identification of Rice Blast Resistance

To assess the rice blast resistance of Wenxiang-1, R1179, and the newly bred elite rice varieties, 15 different blast pathogen isolates collected from Zhejiang province, Jiangxi province, and Hunan province, China, were mixed and tested with respect to their pathogenicity by using the spray method and punch inoculation during the 4–6th stage of panicle differentiation of the young rice. [58]. Each test was performed in triplicate and the degree of disease of each plant was evaluated 10 d after inoculation. Disease reaction was classified on a scale of 0 to 9 as described by Wang et al. (2017), where 0 to 4 is resistance and 5 to 9 is susceptibility. The rice variety Lijiangxintuanheigu was used as the susceptible control [19].

2.4. Genotype Classification and Genetic Composition Analysis among Segregation Population Individuals and Selected Elite Rice Varieties

To determine the genotypes of our newly bred rice varieties, we first extracted DNA from plants at the seedling stage according to the procedure described in previous report [59]. The total volume of the PCR reaction was 10 μL, which contained 1 μL of 10 × PCR buffer, 0.1 mM dNTPs, 0.1 μM of primer pairs, 0.1 U Taq DNA polymerase, and 25 ng template DNA. The PCR conditions included an initial denaturation at 95 °C for 3 min; followed by 35 cycles of 30 s at 95 °C, 40 s at 55 °C, and 40 s at 72 °C; and then a final extension step at 72 °C for 8 min. All PCR products less than 300 bp were separated using 12% non-denaturation polyacrylamide gels. Finally, the amplified DNA fragments were silver-stained for visualization and the genotype of each plant was identified [60].
We used whole-genomic SNP chip genotyping technology to analyze the genetic composition of the newly bred rice varieties. Specifically, 8 k markers arranged on the chip were used to identify the origin of the chromosome fragments of the selected rice varieties.

2.5. MAS of Rice Varieties with Both Fragrance and High-Level Rice Blast Resistance

In order to pyramid both fragrance gene badh2 and rice blast resistance gene Pi2 in the same plant, we used Wenxiang-1 with badh2 and R1179 with Pi2 as the respective donor parents. Wenxiang-1 was crossed with R1179 to obtain F1 seeds, and the F2 segregation population was constructed by inbreeding the F1 plants. To obtain plants homozygous for both Pi2 and badh2 from the Wenxiang-1/R1179 F2 population, we used both functional molecular markers Badh2-1 and Pi2-1 to screen for fragrance gene badh2 and rice blast resistance gene Pi2, respectively, and we also used the whole-genomic SNP chip genotyping technology with 8 K markers for background genome selection.
In addition, comprehensive agronomic traits, such as the number of effective panicles, grain number per panicle, seed-setting rate, 1000-grain weight, and grain size, were also assessed. In F2 and subsequent generations, MAS was used to select elite plants with both rice blast resistance gene Pi2 and fragrance gene badh2, and the pedigree method was used to select other desirable agronomic traits. Finally, we successfully bred new rice varieties that pyramided both rice blast resistance gene Pi2 and fragrance gene badh2.

2.6. Evaluation of the New Hybrid Rice Lines

The newly bred rice lines were crossed with Thermo-Sensitive Genic Male Sterile rice lines, namely, C815S, Guangzhan63S, Y58S, Shen08S, and Yu03S, which were all widely used in Chinese rice production. These new F1 hybrid rice combinations were planted in the natural paddy field at the China National Rice Research Institute with three replicates in a random block arrangement. Once the plants were mature, we assessed their quality traits of fragrance and rice blast resistance.

3. Results

3.1. Agronomic Traits of the Two Parents

The growth duration of the Wenxiang-1 rice was 129 d, with a plant height of 120.3 cm, 11 effective panicles with 205 spikelets per panicle, a seed-setting rate of 75.3%, and a 1000-grain weight of 29.1 g. Rice quality examination analysis showed that the grain length of Wenxiang-1 was 11.26 mm, the grain width was 3.03 mm, the length/width ratio was 3.72, and the amylose content was 24.1%. Functional marker analysis of badh2 indicated that there was an 8-base deletion in exon 7, and the 2-AP content of the grain was 0.867 mg/kg (Table 1 and Table 2, Figure 1 and Figure 2).
The entire growth duration of the second parent, R1179, was 121.3 days, with a plant height of 114 cm, 12 effective panicles with 207.33 spikelets per panicle, a seed-setting rate was 88.4%, and a 1000-grain weight of 25.31g. Rice quality examination analysis showed that the grain length of R1179 was 10.03 mm, the grain width was 2.81 mm, the length/width ratio was 3.56, and the amylose content was 16.54% (Table 1 and Table 3). Functional marker analysis of badh2 indicated that there were no base deletions in the whole coding sequence, and the grain contained no 2-AP (Figure 1 and Figure 2).

3.2. MAS of Newly Bred Rice Restore Lines Using Functional Markers Pi2-1 and Badh2-1

We crossed Wenxiang-1 with R1179 to obtain the F1 seeds and, subsequently, we bred the F2 segregation population. In the F2 population, the functional marker Pi2-1 and the whole-genomic SNP chip genotyping technology with 8 k markers were used to select plants with homozygous Pi2. These selected plants were also screened for homozygous badh2 using the functional marker Badh2-1, and 108 plants homozygous for both Pi2 and badh2 were selected in total. After consideration of other agronomic traits (including growth duration, plant height, number of effective panicles, grain number per panicle, seed-setting rate, and 1000-grain weight), 36 plants with the most desirable agronomic traits and that were homozygous for both Pi2 and badh2 were selected (Table 2; Figure 2A,B). In the subsequent segregation populations, the genotypes of Pi2-1 and Badh2-1 together with the required agronomic traits were considered as the basis for pedigree selection. Finally, we obtained two new fragrant rice varieties, R365 and R403, which were resistant to blast and displayed excellent the necessary agronomic traits (Figure 1, Figure 3 and Figure 4C,D; Table 1). The agronomic characteristics and rice quality traits of R365 and R403 are shown in Table 4.

3.3. Rice Blast Resistance Identification and Fragrance Examination

The new varieties R365 and R403 were tested with respect to rice blast resistance and fragrance using the parents, Wenxiang-1 and R1179, as controls. The results indicated that the rice blast resistances of R365 and R403 were level 3 and level 4, respectively, with 2AP content of 0.650 and 0.511 mg/kg. The parents Wenxiang-1 and R1179 had rice blast resistances of levels 7 and 3, respectively (Table 1 and Table 3; Figure 4).

3.4. Genotype Identification and Genetic Composition Analysis

The genotypes of Pi2-1 in R365 and R403 were found to be the same as the parent R1179, while the genotypes of Badh2-1 in R365 and R403 were the same as the parent Wenxiang-1 (Figure 2C,D). The results showed that both R365 and R403 contained the rice blast resistance gene Pi2 and the fragrance gene badh2. Additionally, whole-genomic SNP chip genotyping technology was used to select and determine the genetic composition of the new lines R365 and R403. These results indicated that 40.67% of the whole genome of R365 was inherited from the parent Wenxiang-1 and that 59.33% was inherited from the parent R1179. Similarly, 46.26% of the whole genome of R403 was inherited from Wenxiang-1 and 53.74% was inherited from R1179. Genetic mapping results showed that the chromosome fragments containing Pi2 of R365 and R403 were both inherited from R1179 and that the chromosome fragments containing badh2 of R365 and R403 were both inherited from Wenxiang-1 (Table 4, Figure 5).

3.5. The Agronomic Performance of Hybrid Rice Using R365 and R403 as the Male Parents

Using R365 and R403 as male parents, we crossed these new varieties with C815S, Guangzhan63S, Y58S, Shen08S, and Yu03S, which are all widely used in Chinese rice production. The yield of each new hybrid rice combination was monitored, and the results showed that the new hybrid rice combinations C815S/R365 and Yu03S/R403 F1 had yields per hectare of 9.93 ± 0.15 and 9.6 ± 0.17 tons, respectively, which are both significantly higher than the control Fengliangyou-4 (Table 5). Further analysis indicated that the seed-setting rates of C815S/R365 and Yu03S/R403 F1 were also significantly higher than the control (Table 5). However, the 1000-grain weights of C815S/R365 and Yu03S/R403 F1 were significantly lower than the control (Table 5).

4. Discussion

In rice breeding programs, high yield and “good quality” are the most important targets, and MAS can be used to effectively pyramid agronomic traits with recessive genes that are difficult to detect. However, biological and nonbiological stressors caused by rising temperatures seriously threaten rice production [61,62]. The most prominent of these biological stressors, rice blast, has a perennially serious impact on rice production [19], so rice breeders have sought to improve rice blast resistance. However, the phenotypic identification of rice blast resistance is difficult and unstable from year to year and location to location. Thus, until now, the most widely used rice varieties in China have only had low-level rice blast resistance, which poses a large potential threat to the Chinese and even global food supply [59].
The fragrance of rice is also a highly desired quality that is difficult to identify using only human senses, especially in large-scale work [51]. However, the large-scale detection of rice fragrance using laboratory instruments is prohibitively costly. Unquestionably, marker-assisted selection, especially using functional molecular markers located inside the genes, is a very efficient method for selection, especially with respect to those phenotypes with unstable expression and that involve complicated identification such as fragrance. In this study, we successfully used the functional molecular markers Pi2-1 and Badh2-1 and whole-genomic SNP chip genotyping technology to select rice blast resistance and fragrance, and the selection efficiency was very high. A total of 108 F2 individuals in the segregation population homozygous for both Pi2 and badh2 genes were selected quickly and accurately, thereby enabling the combined selection of other agronomic traits, such as desirable plant morphology, yield, and rapid maturation.
In general, rice varieties with desirable qualities and a strong aroma have poor yields; there may be a negative association between rice yield and quality [52]. Moreover, fragrant rice varieties mostly exhibit low-level rice blast resistance (our data, not shown here). Zhang (2008) analyzed the genetic diversity of rice aroma germplasm resources and detected rice blast resistance genes using functional markers, and their results showed that only a small proportion of rice germplasm resources contain rice blast resistance genes [63]. Along the same lines, Chen (2017) summarized the characteristics of fragrant rice bred in Guangxi province and found that most of the fragrant rice germplasm resources did not exhibit rice blast resistance [64]. In our study, the rice blast resistance gene Pi2 and fragrance gene badh2 were simultaneously transferred with high efficiency and accuracy into the same background using foreground functional molecular marker selection, while maintaining the most desirable agronomic characteristics. This permitted the breeding of the “elite” rice varieties R365 and R403 that have both high levels of rice blast resistance and fragrance.
Whole-genomic, high-throughput markers and molecular markers of functional genes can be used for the foreground and background selection of agronomic traits that are difficult to detect but highly important to rice production. Additionally, genetic composition analysis based on genomics and high-throughput markers can efficiently identify many germplasm resources, especially for hybrid rice [65,66]. There has been much work on elucidating the principle of heterosis in rice, but little progress has been made. Whole-genomic, high-throughput markers can be used to distinguish elite germplasm resources and to construct genotyping models, which may be helpful for predicting heterosis among different germplasm resources [67]; however, whole-genomic, high-throughput markers can also be used for the background selection of superior alleles for rice blast resistance genes, bacterial leaf blight resistance genes, and the fragrance gene [68]. In our study, we used whole-genomic, high-throughput marker analysis to select and analyze the genetic composition of new rice varieties R365 and R403 and clearly identify their genetic backgrounds. Furthermore, whole-genomic, high-throughput marker analysis was also used to confirm the presence of the rice blast resistance gene Pi2 and fragrance gene badh2 in these rice varieties, enabling quick and efficient foreground selection.

Author Contributions

Conceptualization, Z.S. and S.T. (Shengjia Tang); methodology, S.H.; validation, P.H.; formal analysis, X.W. and G.J.; investigation, N.G., Z.R. and R.A.; resources, P.H. and S.T. (Shengjia Tang); data curation, L.X. and L.W.; writing—original draft preparation, Y.W. and S.T. (Shengjia Tang); writing—review and editing, Y.C. and F.Z.; supervision, Z.S. and S.T. (Shaoqing Tang); project administration, P.H.; funding acquisition, Z.S. and S.T. (Shaoqing Tang). All authors have read and agreed to the published version of the manuscript.

Funding

This research was financially supported by the China National Key Research and Development Program (2017YFD0100300, 2016YFD0101801), the National S&T Major Project (2016ZX08001006), the China Natural Science Foundation (No. 31871597), Zhejiang Science and Technology Projects (Grant No. LGN18C130006), and intelligent technology and platform development for rice breeding (2021PE0AC05).

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Sheng, Z.; Li, Q.; Li, W.; Chen, X.; Wei, L.; Xie, G.; Jiao, G.; Shao, J.; Wang, S. Identification of a three-base deletion in the Pi2 locus, and development of functional marker for marker-assisted resistance selection. Euphytica 2017, 213, 202. [Google Scholar] [CrossRef]
  2. Khush, G.; Jena, K. Current status and future prospects for research on blast resistance in rice (Oryza sativa L.). In Advances in Genetics, Genomics and Control of Rice Blast Disease; Wang, G.L., Valent, B., Eds.; Springer: New York, NY, USA, 2009; pp. 1–10. [Google Scholar]
  3. Talbot, N.J. On the Trail of a Cereal Killer: Exploring the Biology of Magnaporthe grisea. Annu. Rev. Microbiol. 2003, 57, 177–202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Skamnioti, P.; Gurr, S. Against the Grain: Safe Guarding Rice from Rice Blast Disease. Trends Biotechnol. 2009, 27, 141–150. [Google Scholar] [CrossRef] [Green Version]
  5. Feng, X.; Wang, C.; Nan, J.; Zhang, X.; Wang, R.; Jiang, G.; Yuan, Q.; Lin, S. Updating the elite rice variety Kongyu 131 by improving the Gn1a Locus. Rice 2017, 10, 35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Angeles-Shim, R.B.; Reyes, V.P.; del Valle, M.M.; Lapis, R.S.; Shim, J.; Sunohara, H.; Jena, K.K.; Ashikari, M.; Doi, K. Marker-Assisted Introgression of Quantitative Resistance Gene Pi21 Confers Broad Spectrum Resistance to Rice Blast. Rice Sci. 2020, 27, 113–123. [Google Scholar] [CrossRef]
  7. Thanasilungura, K.; Kranto, S.; Monkham, T.; Chankaew, S.; Sanitchon, J. Improvement of a RD6 Rice Variety for Blast Resistance and Salt Tolerance through Marker-Assisted Backcrossing. Agronomy 2020, 10, 1118. [Google Scholar] [CrossRef]
  8. Hayashi, K.; Yoshida, H. Refunctionalization of the Ancient Rice Blast Disease Resistance Gene Pit by the Recruitment of a Retrotransposon as a Promoter. Plant J. 2009, 57, 413–425. [Google Scholar] [CrossRef]
  9. Lin, F.; Chen, S.; Que, Z.Q.; Wang, L.; Liu, X.Q.; Pan, Q.H. The Blast Resistance Gene Pi37 Encodes a Nucleotide Binding Site-Leucine-Rich Repeat Protein and Is a Member of a Resistance Gene Cluster on Rice Chromosome 1. Genetics 2007, 177, 1871–1880. [Google Scholar] [CrossRef] [Green Version]
  10. Takahashi, A.; Hayashi, N.; Miyao, A.; Hirochika, H. Unique Features of the Rice Blast Resistance Pish Locus Revealed by Large Scale Retrotransposon-Tagging. BMC Plant Biol. 2010, 10, 175. [Google Scholar] [CrossRef] [Green Version]
  11. Fukuoka, S.; Yamamoto, S.-I.; Mizobuchi, R.; Yamanouchi, U.; Ono, K.; Kitazawa, N.; Yasuda, N.; Fujita, Y.; Nguyen, T.T.T.; Koizumi, S.; et al. Multiple functional polymorphisms in a single disease resistance gene in rice enhance durable resistance to blast. Sci. Rep. 2014, 4, 4550. [Google Scholar] [CrossRef] [Green Version]
  12. Ma, J.; Lei, C.L.; Xu, X.T.; Hao, K.; Wang, J.L.; Cheng, Z.J.; Ma, X.D.; Zhou, K.N.; Zhang, X.; Guo, X.P.; et al. Pi64, Encoding a Novel CC-NBS-LRR Protein, Confers Resistance to Leaf and Neck Blast in Rice. Mol. Plant Microbe Interact. 2015, 28, 558–568. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Wang, Z.-X.; Yano, M.; Yamanouchi, U.; Iwamoto, M.; Monna, L.; Hayasaka, H.; Katayose, Y.; Sasaki, T. The Pib Gene for Rice Blast Resistance Belongs to the Nucleotide Binding and Leucine-Rich Repeat Class of Plant Disease Resistance Genes. Plant J. 1999, 19, 55–64. [Google Scholar] [CrossRef]
  14. Li, W.T.; Zhu, Z.W.; Chern, M.S.; Yin, J.J.; Yang, C.; Ran, L.; Cheng, M.P.; He, M.; Wang, K.; Wang, J.; et al. A Natural Allele of a Transcription Factor in Rice Confers Broad-Spectrum Blast Resistance. Cell 2017, 170, 114–126.e15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Fukuoka, S.; Saka, N.; Koga, H.; Ono, K.; Shimizu, T.; Ebana, K.; Hayashi, N.; Takahashi, A.; Hirochika, H.; Okuno, K.; et al. Loss of Function of a Proline-Containing Protein Confers Durable Disease Resistance in Rice. Science 2009, 325, 998–1001. [Google Scholar] [CrossRef] [PubMed]
  16. Xu, X.; Hayashi, N.; Wang, C.-T.; Fukuoka, S.; Kawasaki, S.; Takatsuji, H.; Jiang, C.-J. Rice Blast Resistance Gene Pikahei-1(t), a Member of a Resistance Gene Cluster on Chromosome 4, Encodes a Nucleotide-Binding Site and Leucine-Rich Repeat Protein. Mol. Breed. 2014, 34, 691–700. [Google Scholar] [CrossRef]
  17. Zhou, B.; Qu, S.H.; Liu, G.F.; Dolan, M.; Sakai, H.; Lu, G.D.; Bellizzi, M.; Wang, G.-L. The Eight Amino-Acid Differences within Three Leucine-Rich Repeats between Pi2 and Piz-t Resistance Proteins Determine the Resistance Specificity to Magnaporthe grisea. Mol. Plant Microbe Interact. 2006, 19, 1216–1228. [Google Scholar] [CrossRef] [Green Version]
  18. Qu, S.H.; Liu, G.F.; Zhou, B.; Bellizzi, M.; Zeng, L.R.; Dai, L.Y.; Han, B.; Wang, G.-L. The Broad-Spectrum Blast Resistance Gene Pi9 Encodes a Nucleotide-Binding Site—Leucine-Rich Repeat Protein and Is a Member of a Multigene Family in Rice. Genetics 2006, 172, 1901–1914. [Google Scholar] [CrossRef] [Green Version]
  19. Deng, Y.W.; Zhai, K.R.; Xie, Z.; Yang, D.Y.; Zhu, X.D.; Liu, J.Z.; Wang, X.; Qin, P.; Yang, Y.Z.; Zhang, G.M.; et al. Epigenetic regulation of antagonistic receptors confers rice blast resistance with yield balance. Science 2017, 355, 962–965. [Google Scholar] [CrossRef]
  20. Chen, X.W.; Shang, J.J.; Chen, D.X.; Lei, C.L.; Zou, Y.; Zhai, W.X.; Liu, G.Z.; Xu, J.C.; Ling, Z.Z.; Cao, G.; et al. A B-Lectin Receptor Kinase Gene Conferring Rice Blast Resistance. Plant J. 2006, 46, 794–804. [Google Scholar] [CrossRef]
  21. Shang, J.J.; Tao, Y.; Chen, X.W.; Zou, Y.; Lei, C.L.; Wang, J.; Li, X.B.; Zhao, X.F.; Zhang, M.J.; Lu, Z.K.; et al. Identification of a New Rice Blast Resistance Gene; Pid3, by Genomewide Comparison of Paired Nucleo-Tide-Binding Site-Leucine-Rich Repeat Genes and Their Pseudogene Alleles between the Two Sequenced Rice Genomes. Genetics 2009, 182, 1303–1311. [Google Scholar] [CrossRef] [Green Version]
  22. Chen, J.; Shi, Y.F.; Liu, W.Z.; Chai, R.Y.; Fu, Y.P.; Zhuang, J.Y.; Wu, J.L. A Pid3 Allele from Rice Cultivar Gumei2 Confers Resistance to Magnaporthe oryzae. J. Genet. Genom. 2011, 38, 209–216. [Google Scholar] [CrossRef] [PubMed]
  23. Lü, Q.M.; Xu, X.; Shang, J.J.; Jiang, G.H.; Pang, Z.Q.; Zhou, Z.Z.; Wang, J.; Liu, Y.; Li, T.; Li, X.B.; et al. Functional Analysis of Pid3-A4, an Ortholog of Rice Blast Resistance Gene Pid3 Revealed by Allele Mining in Common Wild Rice. Phytopathology 2013, 103, 594–599. [Google Scholar]
  24. Zhu, X.Y.; Chen, S.; Yang, J.Y.; Zhou, S.C.; Zeng, L.X.; Han, J.L.; Su, J.; Wang, L.; Pan, Q.H. The Identification of Pi50(t), a New Member of the Rice Blast Resistance Pi2/Pi9 Multigene Family. Theor. Appl. Genet. 2012, 124, 1295–1304. [Google Scholar] [CrossRef] [PubMed]
  25. Liu, X.Q.; Lin, F.; Wang, L.; Pan, Q.H. The in silico mapbased cloning of Pi36, a rice coiled-coil-nucleotide-binding site-leucine-rich repeat gene that confers race-specific resistance to the blast fungus. Genetics 2007, 176, 2541–2549. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Berruyer, R.; Adreit, H.; Milazzo, J.; Gaillard, S.; Berger, A.; Dioh, W.; Lebrun, M.-H.; Tharreau, D. Identification and fine mapping of Pi33, the rice resistance gene corresponding to the Magnaporthe grisea avirulence gene ACE1. Theor. Appl. Genet. 2003, 107, 1139–1147. [Google Scholar] [CrossRef] [PubMed]
  27. Lee, S.K.; Song, M.Y.; Seo, Y.S.; Kim, H.K.; Ko, S.; Cao, P.J.; Suh, J.P.; Yi, G.; Roh, J.H.; Lee, S.; et al. Rice Pi5-mediated resistance to Magnaporthe oryzae requires the presence of two coiled-coil-nucleotide-binding-leucine-rich repeat genes. Genetics 2009, 181, 1627–1638. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Takagi, H.; Uemura, A.; Yaegashi, H.; Tamiru, M.; Abe, A.; Mitsuo, C.; Utsushi, H.; Natsume, S.; Kanzaki, H.; Matsumura, H.; et al. MutMap-Gap: Whole-genome resequencing of mutant F2 progeny bulk combined with de novo assembly of gap regions identifies the rice blast resistance gene Pii. New Phytol. 2013, 200, 276–283. [Google Scholar] [CrossRef]
  29. Liu, Y.; Liu, B.; Zhu, X.Y.; Yang, J.Y.; Bordeos, A.; Wang, G.; Leach, J.E.; Leung, H. Fine-mapping and molecular marker development for Pi56(t), a NBS-LRR gene conferring broad-spectrum resistance to Magnaporthe oryzae in rice. Theor. Appl. Genet. 2013, 126, 985–998. [Google Scholar] [CrossRef]
  30. Zhou, X.G.; Liao, H.C.; Chern, M.; Yin, J.J.; Chen, Y.F.; Wang, J.P.; Zhu, X.B.; Chen, Z.X.; Yuan, C.; Zhao, W.; et al. Loss of function of a rice TPR-domain RNA-binding protein confers broad-spectrum disease resistance. Proc. Natl. Acad. Sci. USA 2018, 115, 3174–3179. [Google Scholar] [CrossRef] [Green Version]
  31. Okuyama, Y.; Kanzaki, H.; Abe, A.; Yoshida, K.; Tamiru, M.; Saitoh, H.; Fujibe, T.; Matsumura, H.; Shenton, M.; Galam, D.C.; et al. A multifaceted genomics approach allows the isolation of the rice Piablast resistance gene consisting of two adjacent NBS-LRR protein genes. Plant J. 2011, 66, 467–479. [Google Scholar] [CrossRef]
  32. Chauhan, R.S.; Farman, M.L.; Zhang, H.B.; Leong, S.A. Genetic and physical mapping of a rice blast resistance locus; Pi-CO39(t), that corresponds to the avirulence gene AVR1-CO39 of Magnaporthe grisea. Mol. Genet. Genom. 2002, 267, 603–612. [Google Scholar] [CrossRef] [PubMed]
  33. Sharma, T.R.; Madhav, M.S.; Singh, B.K.; Shanker, P.; Jana, T.K.; Dalal, V.; Pandit, A.; Singh, A.; Gaikwad, K.; Upreti, H.C.; et al. High-resolution mapping; cloning and molecular characterization of the Pi-kh gene of rice; which confers resistance to Magnaporthe grisea. Mol. Genet. Genom. 2005, 274, 569–578. [Google Scholar] [CrossRef] [PubMed]
  34. Das, A.; Soubam, D.; Singh, P.K.; Thakur, S.; Singh, N.K.; Sharma, T.R. A novel blast resistance gene, Pi54rh cloned from wild species of rice, Oryza rhizomatis confers broad spectrum resistance to Magnaporthe oryzae. Funct. Integr. Genom. 2012, 12, 215–228. [Google Scholar] [CrossRef] [PubMed]
  35. Devanna, N.B.; Vijayan, J.; Sharma, T.R. The Blast Resistance Gene Pi54of Cloned from Oryza officinalis Interacts with Avr-Pi54 through Its Novel Non-LRR Domains. PLoS ONE 2014, 9, e104840. [Google Scholar] [CrossRef] [Green Version]
  36. Zhai, C.; Lin, F.; Dong, Z.; He, X.; Yuan, B.; Zeng, X.; Wang, L.; Pan, Q. The isolation and characterization of Pik, a rice blast resistance gene which emerged after rice domestication. New Phytol. 2011, 189, 321–334. [Google Scholar] [CrossRef]
  37. Hua, L.X.; Wu, J.Z.; Chen, C.X.; Wu, W.H.; He, X.Y.; Lin, F.; Wang, L.; Ashikawa, I.; Matsumoto, T.; Wang, L.; et al. The isolation of Pi1, an allele at the Pik locus which confers broad spectrum resistance to rice blast. Theor. Appl. Genet. 2012, 125, 1047–1055. [Google Scholar] [CrossRef]
  38. Zhai, C.; Zhang, Y.; Yao, N.; Lin, F.; Liu, Z.; Dong, Z.Q.; Wang, L.; Pan, Q.H. Function and Interaction of the Coupled Genes Responsible for Pik-h Encoded Rice Blast Resistance. PLoS ONE 2014, 9, e98067. [Google Scholar] [CrossRef]
  39. Ashikawa, I.; Hayashi, N.; Yamane, H.; Kanamori, H.; Wu, J.Z.; Matsumoto, T.; Ono, K.; Yano, M. Two Adjacent Nucleo-Tide-Binding Site-Leucine-Rich Repeat Class Genes Are Required to Confer Pikm-Specific Rice Blast Resistance. Genetics 2008, 180, 2267–2276. [Google Scholar] [CrossRef] [Green Version]
  40. Yuan, B.; Zhai, C.; Wang, W.J.; Zeng, X.S.; Xu, X.K.; Hu, H.Q.; Lin, F.; Wang, L.; Pan, Q.H. The Pik-p Resistance to Magnaporthe oryzae in Rice Is Mediated by a Pair of Closely Linked CC-NBS-LRR Genes. Theor. Appl. Genet. 2011, 122, 1017–1028. [Google Scholar] [CrossRef]
  41. Chen, J.; Peng, P.; Tian, J.S.; He, Y.G.; Zhang, L.P.; Liu, Z.X.; Yin, D.D.; Zhang, Z.H. Pike, a rice blast resistance allele consisting of two adjacent NBS-LRR genes, was identified as a novel allele at the Pik locus. Mol. Breed. 2015, 35, 117. [Google Scholar] [CrossRef]
  42. Fjellstrom, R.G.; Conaway-Bormans, C.A.; McClung, A.M.; Marchetti, M.A.; Shank, A.R.; Park, W.D. Development of DNA Markers Suitable for Marker Assisted Selection of Three Pi Genes Conferring Resistance to Multiple Pyricularia grisea Pathotypes. Crop Sci. 2004, 44, 1790–1798. [Google Scholar] [CrossRef] [Green Version]
  43. Hayashi, N.; Inoue, H.; Kato, T.; Funao, T.; Shirota, M.; Shimizu, T.; Kanamori, H.; Yamane, H.; Hayano-Saito, Y.; Matsumoto, T.; et al. Durable panicle blast-resistance gene Pb1 encodes an atypical CC-NBS-LRR protein and was generated by acquiring a promoter through local genome duplication. Plant J. 2010, 64, 498–510. [Google Scholar] [CrossRef] [PubMed]
  44. Bryan, G.T.; Wu, K.-S.; Farrall, L.; Jia, Y.; Hershey, H.P.; McAdams, S.A.; Faulk, K.N.; Donaldson, G.K.; Tarchini, R.; Valent, B. A Single Amino Acid Difference Distinguishes Resistant and Susceptible Alleles of the Rice Blast Resistance Gene Pi-ta. Plant Cell 2000, 12, 2033–2046. [Google Scholar] [CrossRef] [PubMed]
  45. Zhao, H.J.; Wang, X.Y.; Jia, Y.L.; Minkenberg, B.; Wheatley, M.; Fan, J.B.; Jia, M.H.; Famoso, A.; Edwards, J.D.; Wamishe, Y.; et al. The rice blast resistance gene Ptr encodes an atypical protein required for broad-spectrum disease resistance. Nat. Commun. 2018, 9, 2039. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Qiu, Z.; Zhang, Y. Why fragrance rice produced in Thailand can be sold worldwide? World Agric China 2003, 2, 33–36, (Chinese, In English abstract). [Google Scholar]
  47. Widjaja, R.; Craske, J.D.; Wootton, M. Comparative Studies on Volatile Components of Non-Fragrant and Fragrant Rices. J. Sci. Food Agric. 1996, 70, 151–161. [Google Scholar] [CrossRef]
  48. Jezussek, M.; Juliano, B.O.; Schieberle, P. Comparison of Key Aroma Compounds in Cooked Brown Rice Varieties Based on Aroma Extract Dilution Analyses. J. Agric. Food Chem. 2002, 50, 1101–1105. [Google Scholar] [CrossRef]
  49. Bradbury, L.M.T.; Fitzgerald, T.L.; Henry, R.J.; Jin, Q.; Waters, D.L.E. The gene for fragrance in rice. Plant Biotechnol. J. 2005, 3, 363–370. [Google Scholar] [CrossRef]
  50. Fitzgerald, M.A.; Hamilton, N.R.S.; Calingacion, M.N.; Verhoeven, H.A.; Butardo, V.M. Is there a second fragrance gene in rice? Plant Biotechnol. J. 2008, 6, 416–423. [Google Scholar] [CrossRef]
  51. Shi, W.; Yang, Y.; Chen, S.; Xu, M. Discovery of a new fragrance allele and the development of functional markers for the breeding of fragrant rice varieties. Mol. Breed. 2008, 22, 185–192. [Google Scholar] [CrossRef]
  52. Kovach, M.J.; Calingacion, M.N.; Fitzgerald, M.A.; McCouch, S.R. The origin and evolution of fragrance in rice (Oryza sativa L.). Proc. Natl. Acad. Sci. USA 2009, 106, 14444–14449. [Google Scholar] [CrossRef] [Green Version]
  53. Shao, G.N.; Tang, A.; Tang, S.Q.; Luo, J.; Jiao, G.A.; Wu, J.L.; Hu, P.S. A new deletion mutation of fragrant gene and the development of three molecular markers for fragrance in rice. Plant Breed. 2011, 130, 172–176. [Google Scholar] [CrossRef]
  54. Shao, G.; Tang, S.; Chen, M.; Wei, X.; He, J.; Luo, J.; Jiao, G.; Hu, Y.; Xie, L.; Hu, P. Haplotype variation at Badh2, the gene determining fragrance in rice. Genomics 2013, 101, 157–162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Zhou, J.; Xiao, W.; Wang, W.; Feng, A.; Zhu, X.; Chen, S.; Chen, Z. Analysis of a major rice blast resistance gene in the rice restorer line Hanghui 1179. Euphytica 2017, 213, 143. [Google Scholar] [CrossRef]
  56. Ying, X.; Xu, X.; Chen, M.; Ouyang, Y.; Zhu, Z.; Min, J. Determination of 2-acetyl-1-pyrroline in aroma rice using gas chromatography-mass spectrometry. Chin. J. Chromatogr. 2010, 28, 782–785. [Google Scholar] [CrossRef] [PubMed]
  57. Jin, L.; Lu, Y.; Shao, Y.; Zhang, G.; Xiao, P.; Shen, S.; Corke, H.; Bao, J. Molecular marker assisted selection for improvement of the eating, cooking and sensory quality of rice (Oryza sativa L.). J. Cereal Sci. 2010, 51, 159–164. [Google Scholar] [CrossRef]
  58. Ramkumar, G.; Srinivasarao, K.; Madhan, M.; Sudarshan, I.; Sivaranjani, A.; Gopalakrishna, K.; Neeraja, C.; Balachandran, S.; Sundaram, R.; Prasad, M.; et al. Development and validation of functional marker targeting an InDel in the major rice blast disease resistance gene Pi54 (Pikh). Mol Breed. 2011, 27, 129–135. [Google Scholar] [CrossRef]
  59. Jiang, J.; Yang, D.; Ali, J.; Mou, T. Molecular marker-assisted pyramiding of broad-spectrum disease resistance genes, Pi2 and Xa23, into GZ63-4S, an elite thermo-sensitive genic male-sterile line in rice. Mol. Breed. 2015, 35, 83–94. [Google Scholar] [CrossRef]
  60. Xu, J.; Wang, B.; Wu, Y.; Du, P.; Wang, J.; Wang, M.; Yi, C.; Gu, M.; Liang, G. Fine mapping and candidate gene analysis of ptgms2-1, the photoperiod-thermo-sensitive genic male sterile gene in rice (Oryza sativa L.). Theor. Appl. Genet. 2010, 122, 365–372. [Google Scholar] [CrossRef] [PubMed]
  61. Luo, Y.; Ma, T.; Zhang, A.; Ong, K.H.; Luo, Z.; Li, Z.; Yang, J.; Yin, Z. Marker-assisted breeding of Chinese elite rice cultivar 9311 for disease resistance to rice blast and bacterial blight and tolerance to submergence. Mol. Breed. 2017, 37, 106. [Google Scholar] [CrossRef]
  62. Luo, Y.; Yin, Z. Marker-assisted breeding of Thai fragrance rice for semi-dwarf phenotype, submergence tolerance and disease resistance to rice blast and bacterial blight. Mol. Breed. 2013, 32, 709–721. [Google Scholar] [CrossRef]
  63. Zhang, T.; Zheng, J.; Xu, J.; Jiang, K.; Wu, X.; Wang, X. Genetic diversity of aromatic rice varieties based on markers of functional genes and SSR. Sci. Agric. Sin. 2008, 41, 625–635, (Chinese, In English abstract). [Google Scholar]
  64. Chen, C.; Li, H.; Liu, L.; Chen, Y.; Luo, Q. Breeding status and development strategy of fragrant rice in Guangxi province. China Rice 2017, 23, 117–120, (Chinese, In English abstract). [Google Scholar]
  65. Mi, J.; Yang, D.; Chen, Y.; Jiang, J.; Mou, H.; Huang, J.; Ouyang, Y.; Mou, T. Accelerated molecular breeding of a novel P/TGMS line with broad-spectrum resistance to rice blast and bacterial blight in two-line hybrid rice. Rice 2018, 11, 11. [Google Scholar] [CrossRef] [PubMed]
  66. Chen, H.; He, H.; Zhou, F.; Yu, H.; Deng, X.W. Development of genomics-based genotyping platforms and their applications in rice breeding. Curr. Opin. Plant Biol. 2013, 16, 247–254. [Google Scholar] [CrossRef]
  67. Yu, H.; Xie, W.; Li, J. A whole-genome SNP array (RICE6K) for genomic breeding in rice. Plant Biotechnol. J. 2014, 12, 28–37. [Google Scholar] [CrossRef] [PubMed]
  68. Collard, B.; Mackill, D.J. Marker-assisted selection: An approach for precision plant breeding in the twenty-first century. Philos. Trans. R. Soc. B Biol. Sci. 2008, 363, 557–572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Agronomy 13 00589 g001 550
Figure 1. The plants and panicle phenotypes of the donor parents and the selected excellent varieties R365 and R403. (A), the phenotype of R1179, which is the donor parent of Pi2. (B), the phenotype of Wenxiang-1, which is the donor parent of badh2. (C), the phenotype of R365. (D), the phenotype of R403. (E–H) were the panicles corresponding to (A–D), respectively.
Figure 1. The plants and panicle phenotypes of the donor parents and the selected excellent varieties R365 and R403. (A), the phenotype of R1179, which is the donor parent of Pi2. (B), the phenotype of Wenxiang-1, which is the donor parent of badh2. (C), the phenotype of R365. (D), the phenotype of R403. (E–H) were the panicles corresponding to (A–D), respectively.
Agronomy 13 00589 g001
Agronomy 13 00589 g002 550
Figure 2. The genotypes of rice blast resistance and fragrance among parents and selected elite rice varieties. (A), the rice blast resistance marker Pi2-1 was used to identify the rice blast resistance genotypes of Wenxiang 1/R1179 F2 population. 1—Wenxiang-1; 2—R1179; 3–24—the individuals in the F2 segregation population. (B), the fragrance gene marker Badh2-1 was used to identify the fragrance genotypes of Wenxiang 1/R1179 F2 isolated population. 1—Wenxiang-1; 2—R1179; 3–24—the individuals in the F2 segregation population. (C), the blast resistance marker Pi2-1 was used to identify the blast resistance genotypes of selected rice varieties. 1—Wenxiang-1; 2—R1179; 3—R365; 4—R403. (D), the marker Badh2-1 was used to identify the fragrance genotypes of selected rice varieties. 1—Wenxiang-1; 2—R1179; 3—R365; 4—R403.
Figure 2. The genotypes of rice blast resistance and fragrance among parents and selected elite rice varieties. (A), the rice blast resistance marker Pi2-1 was used to identify the rice blast resistance genotypes of Wenxiang 1/R1179 F2 population. 1—Wenxiang-1; 2—R1179; 3–24—the individuals in the F2 segregation population. (B), the fragrance gene marker Badh2-1 was used to identify the fragrance genotypes of Wenxiang 1/R1179 F2 isolated population. 1—Wenxiang-1; 2—R1179; 3–24—the individuals in the F2 segregation population. (C), the blast resistance marker Pi2-1 was used to identify the blast resistance genotypes of selected rice varieties. 1—Wenxiang-1; 2—R1179; 3—R365; 4—R403. (D), the marker Badh2-1 was used to identify the fragrance genotypes of selected rice varieties. 1—Wenxiang-1; 2—R1179; 3—R365; 4—R403.
Agronomy 13 00589 g002
Agronomy 13 00589 g003 550
Figure 3. The flowchart for the development of excellent rice varieties polymerizing high level of rice blast resistance and fragrance.
Figure 3. The flowchart for the development of excellent rice varieties polymerizing high level of rice blast resistance and fragrance.
Agronomy 13 00589 g003
Agronomy 13 00589 g004 550
Figure 4. The phenotypes of rice blast resistance of parents and selected elite rice varieties. (A,B), the performance concerning rice blast resistance of parent Wenxiang-1 and R1179. (C,D), the rice blast resistance performance of selected rice variety R365 and R403. The black frame represents the infection area of rice blast.
Figure 4. The phenotypes of rice blast resistance of parents and selected elite rice varieties. (A,B), the performance concerning rice blast resistance of parent Wenxiang-1 and R1179. (C,D), the rice blast resistance performance of selected rice variety R365 and R403. The black frame represents the infection area of rice blast.
Agronomy 13 00589 g004
Agronomy 13 00589 g005 550
Figure 5. The genetic composition analysis of the selected elite rice varieties. (A), the genetic composition of R365. (B), the genetic composition of 403.
Figure 5. The genetic composition analysis of the selected elite rice varieties. (A), the genetic composition of R365. (B), the genetic composition of 403.
Agronomy 13 00589 g005
Table
Table 1. Molecular markers used in this study.
Table 1. Molecular markers used in this study.
MarkerGene of InterestChr.Primer (5′-3′)Type of MarkerReference
Pi2-1Pi26F: 5′ TTGGATTGGAGCATTATTCG 3′
R: 5′ GCATGTGCTAGACTCTTGGGT 3′		IndelSheng et al., 2017 [1]
Badh2-1badh28F: 5′ GTTGCATTTACTGGGAGT 3′
F: 5′ GAAAAGGACAACATTGAGAA 3′		IndelShao et al., 2013 [54]
Table
Table 2. The genotypic and phenotypic performances of parents and selected elite rice varieties.
Table 2. The genotypic and phenotypic performances of parents and selected elite rice varieties.
VarietyPi2 Genotypebadh2 GenotypeRice Blast ResistancePhenotype2-AP Content
mg/kg
R1179+-3 (R)/
Wenxiang-1-+7 (S)0.867
R365++3 (R)0.563
R403++4 (R)0.618
Table
Table 3. The agronomic trait performance and 2-AP content detection of parents and selected rice varieties.
Table 3. The agronomic trait performance and 2-AP content detection of parents and selected rice varieties.
VarietyPlant Height/cmNumber of Effective PaniclesPanicle Length/cmGrain Number Per PanicleSeed-Setting Rate/%1000-Grain Weight/gGrain
Length/Width		Yield Per Plant/gAmylose Content (%)2-AP
Content (mg/kg)
R1179114.00 ± 2.1512.00 ± 1.1227.30 ± 1.21247.33 ± 16.4188.48 ± 3.5125.31 ± 0.513.5741.22 ± 3.5116.54 ± 1.3/
Wenxiang-1122.30 ± 1.8611.00 ± 1.3325.48 ± 2.13156.67 ± 12.1175.07 ± 5.6229.11 ± 0.453.7730.94 ± 4.1224.1 ± 2.10.867
R365125.80 ± 1.7317.00 ± 0.9526.36 ± 1.82240.33 ± 20.3290.08 ± 6.1325.04 ± 0.533.8042.13 ± 3.8913.65 ± 1.50.563
R403129.50 ± 2.4313.00 ± 1.7629.94 ± 1.43259.31 ± 21.4287.67 ± 4.2225.53 ± 0.473.5445.08 ± 4.2115.5 ± 1.60.618
Table
Table 4. Genetic composition analysis of the selected elite rice varieties.
Table 4. Genetic composition analysis of the selected elite rice varieties.
VarietyThe Number of Homozygous Loci Derived from Donor Parent Wenxiang-1The Percentage of Homozygous Loci Derived from Donor Parent Wenxiang-1The Number of Homozygous Loci Derived from Donor Parent R1179The Percentage of Homozygous Loci Derived from Donor Parent R1179The Number of Heterozygous Loci
R365249340.67%398859.33%1531
R403371446.26%434253.74%345
Table
Table 5. The agronomic trait performance and 2-AP content detection of new hybrid rice combinations with newly selected rice varieties as the male parents.
Table 5. The agronomic trait performance and 2-AP content detection of new hybrid rice combinations with newly selected rice varieties as the male parents.
Growth DurationNumber of Effective PaniclesNumber of Grains Per PanicleSeed-Setting RateYield Per Hectare ton/ha1000-Grain Weight (g)Grain Length/WidthAmylose Content (%)2-AP Content (mg/kg)Rice Blast Resistance
C815S/R365135.33 ± 2.5210.67 ± 0.58179.67 ± 3.2183.4 ± 1.86 **9.93 ± 0.15 *24.93 ± 0.15 **3.43 ± 0.1517.33 ± 0.450.219 ± 0.0044 (MR)
Y58S/R365131 ± 28.33 ± 1.15171.67 ± 3.5183.56 ± 1.629.5 ± 0.2626.4 ± 0.363.6 ± 0.124.67 ± 0.860.234 ± 0.0124 (MR)
Shen08S/R365130 ± 16.67 ± 0.58173 ± 782.2 ± 0.959.37 ± 0.3524.13 ± 0.313.43 ± 0.0624.23 ± 0.40.365 ± 0.0144 (MR)
Guangzhan63S/R403135.33 ± 0.589.67 ± 1.15195 ± 2.6579 ± 29.17 ± 0.1226.23 ± 0.153.5 ± 0.218.3 ± 0.360.414 ± 0.0383 (R)
Yu03S/R403138.33 ± 3.0512 ± 1182.67 ± 3.5179.37 ± 0.74 *9.6 ± 0.17 *25.1 ± 0.12 **3.57 ± 0.2517.67 ± 0.210.237 ± 0.0683 (R)
Fengliangyou-4133.67 ± 1.1511.67 ± 0.58184.33 ± 7.0978.37 ± 0.939.17 ± 0.2127.57 ± 0.213.3 ± 0.116.77 ± 0.35/5 (MS)
* p < 0.05; ** p < 0.01.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Y.; Tang, S.; Guo, N.; An, R.; Ren, Z.; Hu, S.; Wei, X.; Jiao, G.; Xie, L.; Wang, L.; et al. Pyramiding Rice Blast Resistance Gene Pi2 and Fragrance Gene badh2. Agronomy 2023, 13, 589. https://doi.org/10.3390/agronomy13020589

AMA Style

Wang Y, Tang S, Guo N, An R, Ren Z, Hu S, Wei X, Jiao G, Xie L, Wang L, et al. Pyramiding Rice Blast Resistance Gene Pi2 and Fragrance Gene badh2. Agronomy. 2023; 13(2):589. https://doi.org/10.3390/agronomy13020589

Chicago/Turabian Style

Wang, Yakun, Shengjia Tang, Naihui Guo, Ruihu An, Zongliang Ren, Shikai Hu, Xiangjin Wei, Guiai Jiao, Lihong Xie, Ling Wang, and et al. 2023. "Pyramiding Rice Blast Resistance Gene Pi2 and Fragrance Gene badh2" Agronomy 13, no. 2: 589. https://doi.org/10.3390/agronomy13020589

APA Style

Wang, Y., Tang, S., Guo, N., An, R., Ren, Z., Hu, S., Wei, X., Jiao, G., Xie, L., Wang, L., Chen, Y., Zhao, F., Tang, S., Hu, P., & Sheng, Z. (2023). Pyramiding Rice Blast Resistance Gene Pi2 and Fragrance Gene badh2. Agronomy, 13(2), 589. https://doi.org/10.3390/agronomy13020589

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop