Next Article in Journal
Long-Term Study of the Crop Forcing Technique on cv. Tempranillo (Vitis vinifera L.) Vines and Suggested Irrigation Strategies to Improve Water Use Efficiency of Forced Vines
Previous Article in Journal
Multi-Trait Selection Index for Simultaneous Selection of Water Yam (Dioscorea alata L.) Genotypes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

As a Transitional Host, Weed Solanum nigrum L. Increases the Population Base of Root-Knot Nematode Meloidogyne enterolobii for the Next Season

1
Key Laboratory of Integrated Pest Management on Tropical Crops, Ministry of Agriculture and Rural Affairs, Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China
2
Hainan Key Laboratory for Monitoring and Control of Tropical Agricultural Pests, Haikou 571101, China
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(1), 129; https://doi.org/10.3390/agronomy14010129
Submission received: 7 December 2023 / Revised: 21 December 2023 / Accepted: 2 January 2024 / Published: 4 January 2024
(This article belongs to the Section Weed Science and Weed Management)

Abstract

The aim of this study was to determine the status of weed Solanum nigrum L. as a transitional host for Meloidogyne enterolobii and its effect on the population base of the nematodes in the next season. The nematode species infecting S. nigrum L. in a fallow field was identified by morphological identification and molecular diagnosis, and parasitic characteristics of the nematodes in S. nigrum L., including development of the nematode in S. nigrum L., the histopathological response of S. nigrum L. to M. enterolobii, and the host suitability of S. nigrum L., were studied. The M. enterolobii soil population density was evaluated before and after S. nigrum L. planting. Species identification revealed that it was M. enterolobii infection. Developmental observation indicated that juveniles of M. enterolobii developed fast in S. nigrum L., establishing feeding sites by 5 days after inoculation (DAI) and forming obvious egg masses on the root at 25 DAI. Histopathological observation showed the typical susceptible response of S. nigrum L., including giant cells with thick cell walls, uniformly dense cytoplasm, and less vacuolation, mainly inside the vascular cylinder. Host suitability assays suggested that S. nigrum L. is a good host for M. enterolobii with an average reproduction factor (RF) of 48.04 ± 14.71. Population densities assays revealed that S. nigrum L. increased the population density of M. enterolobii for two consecutive years from 0.48 ± 0.25 and 0.53 ± 0.31 J2/cm3 to 1.33 ± 0.16 and 1.56 ± 0.43 J2/cm3 of soil. These results indicated that M. enterolobii could reproduce well by infecting S. nigrum L. during the fallow season, and it increased the population base of M. enterolobii to the next season during vegetable production, which suggested a novel direction for the control of root-knot nematodes by controlling weeds as transitional hosts of M. enterolobii in the fallow season.

1. Introduction

Meloidogyne enterolobii is one of the most threatening pathogenic nematodes. It is distributed globally, mainly in tropical and subtropical regions [1], causing up to 65% yield loss, which is higher than that of other root-knot nematodes species examined to date [1,2]. M. enterolobii was first discovered in Hainan province, China [3]. In recent years, M. enterolobii spread has accelerated, reaching the north of China. It has been one of the most important root-knot nematodes (RKNs) in vegetable cultivation in South China, such as in Hainan Province, Guangdong Province, and Fujian Province [4], and it has been the most dominant population of root-knot nematodes in Hainan [5], causing increasingly serious losses to vegetable production.
Considering the above-mentioned situation, the control of M. enterolobii is urgently required in vegetable production. The use of nematicides to control RKN is still the most commonly used and the most effective method in several techniques, which could reduce damage to crops and nematodes population build-up [6]. However, we found that although nematocides could reduce the damage of the nematodes and the population number of nematodes in the current season, the damage degree to the crops and the nematodes population density in the soil did not decrease significantly in the next season (unpublished). So, there must be some neglected factors in field control, which allow the nematodes population to recover after being reduced by the nematocides.
Transitional (alternative) hosts may be one of the ignored factors in the field control. Summer fallow, the practice of controlling all plant growth during the non-crop season, is a typical planting pattern in vegetable production in the tropics. Weeds flourish because of neglect of management during the fallow season. Summer fallow weeds control is crucial for the following season crop’s production not only because weeds compete for environment resources, but also because they might serve as transitional (alternative) hosts, providing opportunities for pests and pathogens to survive and reproduce [7]. Some species of weeds were reported to be hosts of Meloidogyne arenaria, Meloidogyne incognita, and Meloidogyne javanica [7,8], and some species were reported to be infected by M. enterolobii, but only a few species of weeds, such as Ipomoea nil, Euphorbia heterophylla, and Solanum americanum, etc. were good hosts for M. enterolobii [9,10,11,12,13]. RKNs could rapidly reproduce in good hosts, which contributes to the rapid increase in nematode populations. While the nematodes reproduce poor even could not parasite in poor host and non-host. So, the identification of parasitic characteristics of the nematodes in weed hosts and the host suitability of weeds for the nematodes are essential for determining the precise status of weeds as transitional hosts. In addition, determining the effect of the transitional host weeds on the nematode population in the next season is extremely important for the control of root-knot nematodes in production areas, which could provide early warning information for weeds control in fallow periods, which is an area where there has not been any related research.
In April 2021, a number of S. nigrum L. weeds exhibiting obvious symptoms of leaf yellowing were discovered in a fallow vegetable planting base in Wenchang city, Hainan Province, China. Many galls were observed on the roots of the infected plants, which is the characteristic symptom of Meloidogyne spp. infection. Therefore, the objectives of this study were to identify species of the nematodes that infected S. nigrum L., determine the status of weeds as transitional hosts by understanding their developmental process in S. nigrum L., ascertain the histopathological response of S. nigrum L. to the nematodes, determine the suitability of the nematodes in S. nigrum L., and clarify the effect of the transitional host S. nigrum L. on the population base of the nematodes for the next season.

2. Materials and Methods

2.1. Sampling and Nematode Extraction

Samples of S. nigrum L. roots were collected from a fallow vegetable farm in the fallow season in Wenchang City, Hainan Province (longitude 110°43.53′ E, latitude 19°42.71′ N) in April 2021, and they were stored at 4 °C for further analysis. Female nematodes and egg masses were extracted from the root tissues of S. nigrum L. using a nematode pick. Eggs and J2 of M. enterolobii were extracted using the adapted NaOCl method of Riekert [14]. After that, J2 were inoculated onto tomatoes in steam-pasteurized soil for the related experiments.
Seed samples were collected at the same place. The mature seeds of S. nigrum L. were collected in Kraft paper bags, dried naturally in the sun and stored at 4 °C for follow-up experiments.

2.2. Morphological Observation

Second-stage juveniles (J2) were picked, heat-killed, fixed in FG solution (containing 1 mL glycerol, 10 mL formalin, and 89 mL distilled water), added slowly into glycerol, and then mounted on microscope slides. Measurements were made using a stage micrometer under a Nikon microscope (Tokyo, Japan). Morphometric data were recorded and organized in Microsoft Office Excel (2016) (Microsoft, Redmond, WA, USA). All data are presented as the mean ± standard error. Images of key morphological features were taken using a Nikon ECLIPSE Ni microscope (Tokyo, Japan).
Perineal patterns of female adults were observed according to the method of Xie [15] with slight modifications. Specifically, female adults were selected from S. nigrum L. root-knot tissue under an anatomical microscope, the perineal patterns were sliced by a scalpel, and the perineal patterns were rinsed with fine bristle in 45% lactic acid solution. Then, the perineal patterns were placed on another microscope glass slide consisting of pure glycerine as a floating carrier and covered with a coverslip. Images of the perineal patterns were taken using a Nikon ECLIPSE Ni microscope.

2.3. Molecular Identification

2.3.1. DNA Extraction, PCR Amplification, and Sequencing

DNA was extracted from 12 single females following the method described by Williams et al. [16] and stored in a −80 °C refrigerator until use. The internal transcribed spacer (ITS) of rRNA was amplified using universal primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGDDGTACTAAGG) for root-knot nematodes, as described by Vrain et al. [17]. The rDNA intergenic spacers 2 (IGS2) was amplified using M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCCGCTG/TCAGTTCAGGCAGGATCAACC) described by Long et al. [18]. The distilled water and DNA of Meloidogyne incognita were used as negative controls, respectively. All the PCRs were performed in a 25 μL mixed solution containing template DNA (1.0 μL), 2× Pfu PCR Master Mix (TianGen Biotech Co., Ltd., Beijing, China), forward and reverse primers (10 μmol/L and 1.00 μL, respectively), and ddH2O (9.5 μL). The PCR amplification procedure referred to Vrain et al. [17] and Long et al. [18]. After the amplification reaction, 5 μL of PCR product was electrophoresed through a 1% Tris-acetate-ethylenediaminetetraacetic acid (TAE)-buffered agarose gel. PCR products were excised from the gel and purified using an EasyPure Quick Gel Extraction Kit (TianGen Biotech Co., Ltd.). The recovered product was ligated into the T-Vector pMD19 cloning vector (Takara Bio, Dalian, China) and transformed into DH5α competent cells (TransGen Biotech Co., Ltd., Beijing, China). Three positive clones of each PCR amplified product were selected and sequenced at Shenzhen Huada Gene Technology Co., Ltd. (Shenzhen, China).

2.3.2. Sequence Alignment and Phylogenetic Analysis

The obtained ITS sequences were submitted to the NCBI GenBank database and then compared with those from other nematodes available in the GenBank database using the BLAST homology search program. ITS sequences from Meloidogyne spp. were selected for phylogenetic reconstruction. An ITS sequence of Heterodera glycines was used as an outgroup taxa. DNAMAN 6.0 software (Lynnon Biosoft, San Ramon, CA, USA) was used to align and analysis the sequence divergence.
A phylogenetic tree was generated based on the maximum likelihood (ML) method in MEGA 11.0 software (Molecular Evolutionary Genetics Analysis, New York City, NY, USA) to analyze the phylogenetic relationships and genetic distances of nematodes. The phylogram was bootstrapped 1000 times to assess the degree of support for the phylogenetic analysis.

2.4. Transitional Host Identification

2.4.1. Development Progress and Histopathological Observation

Seeds of S. nigrum L. were germinated in seedling pots (6 cm diameter × 15 cm deep) filled with equal parts (v/v) of steamed field soil. Forty days after sowing, each seedling, with eight or nine leaves, was inoculated with 1000 J2 equally distributed in four equal holes (3.5 to 4.5 cm deep) surrounding the root system. Non-inoculated seedlings served as controls. Plants were grown in a completely randomized design with 15 replications in a climate-controlled chamber (25 °C daytime and night-time; 14 h photoperiod). Three randomly selected seedlings of each time point were carefully removed from pots at 1, 3, 5, 7, 11, 18, 21, and 25 days after inoculation (DAI), and their roots were rinsed with water. Their root systems were stained with acid fuchsin to observe J2 penetration, localization, and subsequent development within the roots, following the method of Liu [19]. The visualization of stained nematodes was carried out by placing the root systems in a petri dish and examining them under an OLYMPUS SZX7 stereomicroscope attached to a OLYMPUS DP72 digital camera (Olympus, Tokyo, Japan). Subsamples of roots were embedded in resin to produce thin sections. Root fragments showing galls or those without symptoms were excised to evaluate the development stage of the nematodes and the response of S. nigrum L. to nematode infection, following the method of Li et al. [20]. The sections were stained using toluidine blue and evaluated under a Nikon ECLIPSE Ni microscope (Tokyo, Japan) at 20 to 40× magnification; images were captured using a Nikon DS-Fi3 digital camera (Tokyo, Japan).

2.4.2. Host Suitability Assay

This assay was conducted at the same time as the above experiment. The seedlings, management methods, and the nematode inoculation method were the same as those used in the above experiment. The S. nigrum L. root systems of the remaining 12 seedlings were collected at 35 DAI. The root system of each seedling was removed from the pot, and the soil was carefully washed away to collect subsequent related data. The fresh root weight (FRW) of 15 seedlings was obtained separately, and the root systems were assessed for the root gall index (GI) and the egg mass index (EMI) on a scale 0 to 5, where 0 = 0 galls or egg masses; 1 = 1 to 2 galls or egg masses; 2 = 3 to 10 galls or egg masses; 3 = 11 to 30 galls or egg masses; 4 = 31 to 100 galls or egg masses; and 5 = more than 100 galls or egg masses [21]. Eggs were extracted from the roots as stated above. Fecundity (eggs per egg mass) was measured by extracting eggs from three egg masses chosen randomly from each seedling (45 egg masses in total). Egg number per seedling was quantified under a light microscope using Peters’ slides. Eggs per gram of fresh root were counted, and the reproduction factor was determined as RF = FP/IP, where FP = the final nematode population and IP = the initial nematode population (IP = 1000). Host suitability was designated as follows: RF ≥ 1 = good host; 0. 1 < RF < 1.0 = poor host; RF ≤ 0. 1 = non host [22].

2.5. Population Density Survey

To test the effect of S. nigrum L. as a transitional host on the population base of the nematodes in the next season, field experiments were performed in the experimental fields of the Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan province, China (longitude 110°21.46′ E, latitude 19°59.20′ E) in the local fallow season of 2022 and 2023 (from late May to early September). The fields were sandy soil and formerly cultivated with Capsicum annuum L. infected by M. enterolobii. Population densities of M. enterolobii were detected using modified Baermann Trays before seeding and at the end of planting (90 days after seeding), respectively. The soil of each block was sampled at five points, and then 200 g of well-mixed sample was used for nematode collection. The strainer (aperture = 2 mm) was used to separate the soil and nematodes in the shallow dish with water. J2 stage nematodes were counted under a microscope. The field was divided into 12 blocks arranged in a randomized complete block design, and each block was 24 m2. A total of one treatment and one control were performed with six replicates. Seeds of S. nigrum L. collected earlier were spread evenly into the fields (guaranteed 4 plants per square meter finally) and covered with a thin layer of soil. Blocks without the seeds were used as untreated controls. About 60 seedlings are planted in each block.
All data were recorded and organized in Microsoft Office Excel (2016). Statistical analysis was carried out using one-way analysis of variance (ANOVA) with Turkey’s comparison means test (p < 0.05) in Originlab (2021; OriginLab Corporation, Northampton, MA, USA). All data are presented as the mean ± standard error.

3. Results

3.1. Disease Symptoms

A number of Solanum nigrum L. plants with symptoms of leaf yellowing and defoliation were discovered in a fallow vegetable farm in Wenchang City, Hainan Province, China (Figure 1A). Many galls were observed on the roots of the infected plants (Figure 1B), which is the characteristic symptom of Meloidogyne spp. infection. Samples were collected and stored at 4 °C before further analysis. The species from the egg masses were reared on tomatoes in steam pasteurized soil. Symptoms similar to those in the field appeared at 35 days after artificial inoculation (Figure 1C).

3.2. Morphological Characters of the Nematodes

The perineal patterns of the female specimens were generally suborbicular or oval shaped (Figure 2A), with moderate to high dorsal arches, but they lacked obvious lateral lines (Figure 2B). Measurements of females (n = 20) included the vulval slit length = 26.72 ± 2.54 (range: 21.07 to 27.28) µm, and the vulval slit to anus distance = 24.19 ± 1.93 (range: 20.17 to 24.39) µm. The J2 stage had long and narrow tails with bluntly rounded tail tips and distinct hyaline tail termini. Measurements of the J2 stage (n = 20) were body length = 390.51 ± 27.64 (range: 334.28 to 438.73) µm, body width = 16.37 ± 1.56 (range: 12.56 to 19.78) µm, stylet = 13.89 ± 1.25 (range: 10.67 to 15.37) µm, dorsal esophageal gland orifice to stylet base = 4.1 ± 0.4 (range: 3.8 to 5.2) µm, tail = 50.88 ± 3.43 (range: 46.31 to 60.70) µm, and hyaline tail length = 12.51 ± 1.65 (range: 8.29 to 14.53) µm.

3.3. Molecular Profiles and Phylogenetic Relationship

Amplification and sequencing of the ITS1-5.8S-ITS2 fragment of the rDNA from the females revealed that the sequence size was 763 bp, the GenBank accession number of which is MZ409523. BLAST searching at the GenBank database revealed that MZ409523 was 100% identical to sequences of M. enterolobii (accession numbers MT406250, OP876759, OR072957, MH756121, etc.). Species identification was also confirmed by PCR amplification of the rDNA intergenic spacers 2 (IGS2) using M. enterolobii-specific primers Me-F/Me-R. A bright brand (~250 bp) was observed only in the lanes with the M. enterolobii-specific primers, whose size was identical to that of previously identified M. enterolobii sequences (Figure 3). No band appeared in the lanes for the negative controls.
Multiple sequence alignment reflected that the sequence of the isolated nematodes was with identities ranging from 99.09% (accession numbers KF418370, JX024149) to 100% (accession numbers MT406250, OP876759, OR072957 and MH756121) to other sequences of M. enterolobii from different hosts, including 99.48% and 99.61% identities with the other two sequences of M. enterolobii from S. nigrum L. (accession numbers MT159695 and MT159696), respectively. The phylogenetic tree (using 39 sequences in total) showed that the isolated nematodes clustered together with all of the other M. enterolobii from different hosts with 99% bootstrap support, while M. enterolobii from different hosts except from ormosia hosiei (accession number MZ617284) clustered in a small clade with 63% bootstrap support, in which the two M. enterolobii from S. nigrum L. (accession numbers MT159695 and MT159696) clustered in an independent clade with 71% bootstrap support (Figure 4). Thus, ITS phylogenetic analysis confirmed that the nematodes belonged to M. enterolobii.

3.4. Transitional Host Identification

3.4.1. Developmental Progress and Histopathological Observations

Several vermiform J2 (Figure 5A) M. enterolobii were observed to have intruded into the subapical meristem of the roots. Thereafter, numerous J2 reached the root tips at 3 DAI (Figure 5B), some of which invaded the vascular cylinder and probably migrated through the vascular cylinder to find feeding sites. Most of the juveniles established feeding sites and began to enlarge after feeding at 5 DAI (Figure 5C). At 7 DAI, the juveniles were greatly enlarged, assuming a ‘sausage’ shape, and they could be termed third-stage juveniles (J3) (Figure 5D). The fourth-stage juveniles (J4) with an ‘eggplant’ shape (Figure 5E), and pear-shaped swollen young females without eggs, were observed at 11 DAI and 18 DAI, respectively (Figure 5F). At 21 DAI, rounded adult females began to lay a large number of eggs (Figure 5G). Obvious egg masses were observed on the root surface at 25 DAI (Figure 5H).
Typical pathological changes in the root tissue appeared as the nematodes grew. Enlargement of the root tip cells and a loose cell arrangement were present from 1 to 3 DAI (Figure 6A,B); meanwhile, tumefacient root tips were formed. Many giant cells with thickened cell walls and granular cytoplasm were discovered inside the vascular cylinder (Figure 6C), but only a few giant cells were discovered in the endodermis adjacent to the vascular cylinder at 5 DAI (Figure 6D). Obvious small galls were formed on the roots at the same time. As the juveniles expanded in size, the cell walls of the giant cells continued to thicken, the number of hyperplastic cells surrounding the juveniles increased sharply, and the cells extended transversely, perpendicular to the vascular cylinder, leading to the appearance of large galls at 11 DAI (Figure 6E). Pear-shaped swollen young females without eggs, resuming feeding behavior, were observed at 18 DAI (Figure 6F). After 21 DAI, adult females gradually ovulated into the intercellular space between the females and severely injured surrounding plant cells, and the root cortex was disrupted (Figure 6G,H). At this stage, very few J2 hatched from eggs in the intercellular space (Figure 6G). At 25 DAI, obvious egg masses were observed on the root surface, which were associated with severe injury to the surrounding cells, including disruption of the root cortex (Figure 6I).

3.4.2. Host Suitability of S. nigrum L. for M. enterolobii

The GI, EMI, RF, fecundity, and eggs per gram of fresh root data for S. nigrum L. are shown in Table 1, in which the average RF was 48.04 ± 14.71, which showed that S. nigrum L. is a good host for M. enterolobii according to the standards proposed by Sasser et al. [22].

3.5. Effect of S. nigrum L. on the Population Densities of M. enterolobii in Soil

In 2022, the population density of M. enterolobii after planting S. nigrum L. was 1.33 ± 0.16 J2 per cm3 of soil, which was significantly higher than that before planting (0.48 ± 0.25) and the measurements of pre-plant and post-plant without S. nigrum L. planting. There is no significant difference between the three treatment without S. nigrum L. planting (Table 2).
The results for 2023 are similar to those for 2022. In 2023, the population density of M. enterolobii after planting S. nigrum L. was 1.56 ± 0.43 J2 per cm3 of soil, which was also significantly higher than that before planting (0.53 ± 0.31) and the measurements of pre-plant and post-plant without S. nigrum L. planting. There is also no significant difference between the three treatments without S. nigrum L. planting (Table 2).

4. Discussion

Host identification includes both infective nematode identification and assessment of host suitability. PCR-based methodologies and phylogeny analysis are common identification methods for Meloidogyne spp. [23,24]. Herein, the morphological characteristics of the nematodes infecting S. nigrum L., especially the perineal pattern of the females, were similar to those of M. enterolobii described by Yang and Eisenback [3]. Molecular diagnosis using M. enterolobii specific primers to amplify rDNA intergenic spacers 2 (IGS2) and rDNA-ITS gene sequences, the constructed phylogenetic tree, and the morphological identification confirmed that the nematodes infecting S. nigrum L. were M. enterolobii.
M. enterolobii has been reported to infect species of more than 29 families worldwide [25,26,27,28,29,30,31], including certain species of weeds [10,11,12,13,14,15,31]. However, not all species of weeds that could be infected are suitable hosts for M. enterolobii development and reproduction. In the study by Pinheiro et al. [11], Ipomoea nil, Ipomoea triloba, Euphorbia heterophylla, Hyptis suaveolens, Portulaca oleracea, and Solanum americanum with RFs of 12.31, 9.58, 12.45, 3.27, 1.27, and 15.33 respectively, were identified as good hosts for M. enterolobii. However, Amaranthus hybridus, Amaranthus viridis, Ageratum conyzoides, and Bidens pilosa were identified as poor hosts. Alternanthera tenella, Acanthospermum australe, Tagetes sp., Sida cordifolia, Digitaria horizontalis, and Eleusine indica even are not hosts for M. enterolobii, although they can be infected by M. enterolobii. In the present study, M. enterolobii showed a high reproductive ability in S. nigrum L., with an RF of 48.04 ± 14.71, which was higher than that in related species, such as Solanum americanum [10], tomatoes [32], and chili pepper [33], although the time of root examination was brought forward to 35 DAI. In addition, M. enterolobii presented a fast development rate in S. nigrum L. The female juveniles of M. enterolobii only took 21 DAI to reach the adult stage, and at 25 DAI, they formed obvious egg masses on the roots of S. nigrum L., which was faster than that on tomato variety VFNT [34], Capsicum spp. [35], and Psidium spp. [36]. Meanwhile, typical susceptible histopathological reactions were observed in S. nigrum L.; for example, giant cells containing multiple nuclei were observed at 5 DAI, which appeared earlier than in other susceptible hosts [36,37]. Therefore, S. nigrum L. could be identified to be a suitable transitional host for M. enterolobii, because of the rapid development and high reproductive capacity of M. enterolobii in S. nigrum L., and the typical susceptible histopathological reaction.
Currently, control of Meloidogyne spp., especially M. enterolobii, mainly focuses on the adoption of agricultural measures, such as crop rotation and planting trap plants, breeding of resistant varieties, development of chemical agents, screening of biological agents, and the use of some physical control methods, such as soil sunlight disinfection and soil fumigation [38]. However, the control of weeds as transitional hosts is a neglected area, especially during the fallow period. Weeds suitable for development and reproduction multiply the nematodes inoculums and ensure the maintenance of high population densities of the nematode in the soil after harvest or in the off season, making it difficult to control nematodes in production areas [39]. S. nigrum L. as a species of weeds grows all around the world, covering both temperate and tropical regions [40], which is distributed throughout the country of China, especially in vegetable plantation. S. nigrum L. flourishes together with other weeds in vegetable planting base during the fallow season because of neglect of management, which provides the opportunity for the nematodes infection and even aggravates the damage to crops in the following season. Tests revealed soil population densities of M. enterolobii grown with S. nigrum L. of 1.33 ± 0.16 and 1.56 ± 0.43 J2 per cm3 in two experiments, which were significantly higher than those in soil lacking S. nigrum L. Long et al. found that the cucumber shoot height and fresh weight were reduced significantly when the initial inculcation density of M. enterolobii reached 0.25 J2 per cm3 of soil, and the plants were dead when inoculated with 8 J2 per cm3 of soil [41]. Therefore, the control of weed S. nigrum L., as a transitional host in the fallow period, is essential to control M. enterolobii in vegetable plantation.

5. Conclusions

In conclusion, we confirmed that the species of root-knot nematode infecting S. nigrum L. was M. enterolobii. S. nigrum L. was verified as a suitable transitional host for M. enterolobii according to the identification of parasitic characteristics of the nematodes in S. nigrum L. and host suitability of S. nigrum L. to the nematodes. S. nigrum L., as a transitional host in the fallow season, increased the population base of M. enterolobii to the next season. A novel direction for the control of root-knot nematodes, i.e., the control of weeds as transitional hosts of M. enterolobii in the fallow season, is proposed. More attention needs to be paid to other species of weeds as transitional hosts in the fallow season in future studies.

Author Contributions

Conceptualization, H.L.; Methodology, Y.P., Y.S. and Y.C.; Software, Y.C. and H.C.; Formal analysis, Y.P.; Investigation, Y.P., Y.S. and T.F.; Writing—original draft, Y.P.; Writing—review & editing, Y.P.; Project administration, Y.P.; Funding acquisition, Y.P. and H.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Hainan Provincial Natural Science Foundation of China (grant number 321QN291) and the Central Public-interest Scientific Institution Basal Research Fund for Chinese Academy of Tropical Agricultural Sciences (grant number 1630042022008).

Data Availability Statement

The data presented in this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Philbrick, A.N.; Adhikari, T.B.; Louws, F.J.; Gorny, A.M. Meloidogyne enterolobii, a Major Threat to Tomato Production: Current Status and Future Prospects for Its Management. Front. Plant Sci. 2020, 11, 606395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Castagnone-Sereno, P. Meloidogyne enterolobii (=M. mayaguensis): Profile of an emerging, highly pathogenic, root-knot nematodes species. Nematology 2012, 14, 133–138. [Google Scholar] [CrossRef] [Scilit]
  3. Yang, B.; Eisenback, J.D. Meloidogyne enterolobii n. sp. (Meloidogynidae), a Root-knot Nematodes Parasitizing Pacara Earpod Tree in China. J. Nematol. 1983, 15, 381–391. [Google Scholar] [PubMed]
  4. Tian, X.X.; Jiang, B.Z.; Cao, Z.M.; Liu, Z.J.; Ling, P.; Xie, S.Q.; Zhu, J. Identification of Capsicum chinense germplasms resistant to Meloidogyne enterolobii and preliminary analysis on resistance mechanism. Chin. J. Trop. Crops 2022, 43, 165–172. [Google Scholar]
  5. Li, Z.R.; Long, H.B.; Sun, Y.F.; Pei, Y.L.; Chen, Y.; Feng, T.Z. Occurrence and distribution of the root-knot nematode species in vegetables in Hainan Province. Plant Prot. 2020, 46, 213–216, 245. [Google Scholar]
  6. Becker, J.O.; Ploeg, A.; Nuñez, J.J. Multi-Year Field Evaluation of Fluorinated Nematicides Against Meloidogyne incognita in Carrots. Plant Dis. 2019, 103, 2392–2396. [Google Scholar] [CrossRef] [Scilit]
  7. Hunt, J.R.; Browne, C.; McBeath, T.M.; Verburg, K.; Craig, S.; Whitbread, A.M. Summer fallow weed control and residue management impacts on winter crop yield through soil water and N accumulation in a winter-dominant, low rainfall region of southern Australia. Crop Pasture Sci. 2013, 64, 922–934. [Google Scholar] [CrossRef] [Scilit]
  8. Kokalis-Burelle, N.; Rosskopf, E.N. Susceptibility of Several Common Subtropical Weeds to Meloidogyne arenaria, M. incognita, and M. javanica. J. Nematol. 2012, 44, 142–147. [Google Scholar]
  9. Chen, J.; Gao, F.; Ma, J.; Yang, D.; Zhang, C.; Tang, W.; Xie, Y.; Sun, H. First report of Meloidogyne enterolobii infecting Solanum nigrum in China. Plant Dis. 2023. [Google Scholar] [CrossRef] [Scilit]
  10. Pinheiro, J.B.; Silva, G.O.; Biscaia, D.; Macedo, A.G.; Correia, N.M. Reaction of weeds, found in vegetable production areas, to root-knot nematodes Meloidogyne incognita and M. enterolobii. Hortic. Bras. 2019, 37, 445–450. [Google Scholar] [CrossRef] [Scilit]
  11. Almeida, E.J.; Alves, G.C.S.; Santos, J.M.; Martins, A.B.G. Assinalamentos de Meloidogyne enterolobii em goiabeira e em plantas invasoras no estado de São Paulo, Brasil. Nematol. Bras. 2011, 35, 50–52. [Google Scholar]
  12. Carneiro, R.G.; Mônaco, A.P.A.; Moritz, M.P.; Nakamura, K.C.; Scherer, A. Identificação de Meloidogyne mayaguensis em goiabeira e em plantas invasoras, em solo argiloso, no Estado do Paraná. Nematol. Bras. 2006, 30, 293–298. [Google Scholar]
  13. Souza, R.M.; Nogueira, M.S.; Lima, I.M.; Melarato, M.; Dolinski, C. Manejo do nematóide das galhas da goiabeira em São João da Barra (RJ) e relato de novos hospedeiros. Nematol. Bras. 2006, 30, 165–169. [Google Scholar]
  14. Riekert, H. A modified sodium hypochlorite technique for the extraction of root-knot nematode eggs and larvae from maize root samples. Afr. Plant Prot. 1995, 1, 41–43. [Google Scholar]
  15. Xie, H. Taxonomy of Plant Nematodes, 1st ed.; Anhui Science and Technology Press: Hefei, China, 2000; pp. 21–29. [Google Scholar]
  16. Williams, B.D.; Schrank, B.; Huynh, C.; Shownkeen, R.; Waterson, R.H. A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence-tagged sites. Genetics 1992, 131, 609–624. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Vrain, T.; Wakarchuk, D.; Laplantelevesque, A.; Hamilton, R.H. Intraspecific rDNA restriction fragment length polymorphisms in the Xiphinema americanum group. Fundam. Appl. Nematol. 1992, 15, 563–573. [Google Scholar]
  18. Long, H.; Liu, H.; Xu, J.H. Development of a PCR diagnostic for the root-knot nematodes Meloidogyne enterolobii. Acta Phytopathol. Sin. 2006, 36, 109–115. [Google Scholar]
  19. Liu, W.Z. Plant Nematology Research Techniques, 1st ed.; Liaoning Science and Technology Publishing House: Shenyang, China, 1995; pp. 71–72. [Google Scholar]
  20. Li, X.; Zhao, W.; Zhou, X.; Feng, J.; Gao, Y.; Yao, X.; Liu, Y.; Liu, J.; Yang, R.; Zhao, F.; et al. The Use of Toluidine Blue Staining Combined with Paraffin Sectioning and the Optimization of Freeze-thaw Counting Methods for Analysing Root-Knot Nematodes in Tomato. Hortic. Environ. Biotechnol. 2017, 58, 620–626. [Google Scholar] [CrossRef] [Scilit]
  21. Taylor, A.L.; Sasser, J.N. Biology, Identification, and Control of Root-Knot Nematodes (Meloidogyne Species); North Carolina State University Graphics: Raleigh, NC, USA, 1978; p. 111. [Google Scholar]
  22. Sasser, J.N.; Carter, C.C.; Hartman, K.M. Standardization of Host Suitability Studies and Reporting of Resistance to Root-Knot Nematodes; North Carolina State University: Raleigh, NC, USA, 1984. [Google Scholar]
  23. Moens, M.; Perry, R.N.; Starr, J.L. Meloidogyne species—A Diverse Group of Novel and Important Plant Parasites. In Root-Knot Nematodes, 1st ed.; Perry, R.N., Moens, M., Starr, J., Eds.; CAB International: Oxfordshire, UK, 2009; pp. 1–13. [Google Scholar]
  24. Hu, M.X.; Zhuo, K.; Liao, J.L. Multiplex PCR for the simultaneous identification and detection of Meloidogyne incognita, M. enterolobii, and M. javanica using DNA extracted directly from individual galls. Phytopathology 2011, 101, 1270–1277. [Google Scholar] [CrossRef] [Scilit]
  25. Brito, J.A.; Kaur, R.; Cetintas, R.; Stanley, J.D.; Mendes, M.L.; Powers, T.O.; Dickson, D.W. Meloidogyne spp. infecting ornamental plants in Florida. Nematropica 2010, 40, 87–103. [Google Scholar]
  26. Freitas, V.M.; Silva, J.G.P.; Gomes, C.B.; Castro, J.M.C.; Correa, V.R.; Carneiro, R.M.D.G. Host status of selected cultivated fruit crops to Meloidogyne enterolobii. Eur. J. Plant Pathol. 2017, 148, 307–319. [Google Scholar] [CrossRef] [Scilit]
  27. Long, H.B.; Bai, C.; Peng, J.; Zeng, F.Y. First Report of the Root-Knot Nematodes Meloidogyne enterolobii Infecting Jujube in China. Plant Dis. 2014, 98, 1451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Long, H.B.; Sun, Y.F.; Bai, C.; Guo, J.R.; Zeng, F.Y. Identification of the Root Knot Nematodes Meloidogyne enterolobii in Hainan Province. Chin. J. Tropic. Agric. 2015, 36, 371–376. [Google Scholar]
  29. Rodriguez, M.G.; Sanchez, L.; Rowe, J. Host status of agriculturally important plant families to the root-knot nematodes Meloidogyne mayaguensis in Cuba. Nematropica 2003, 33, 125–130. [Google Scholar]
  30. Zhang, P.; Shao, H.D.; You, C.P.; Feng, Y.; Xie, Z.W. Characterization of root-knot nematodes infecting mulberry in Southern China. J. Nematol. 2020, 52, 1–8. [Google Scholar] [CrossRef] [Scilit]
  31. Kaspary, T.E.; Júnior, I.T.S.; Ramos, R.F.; Bellé, C. Host status of morning-glory (Ipomoea spp.) to Meloidogyne species. J. Nematol. 2021, 53, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. da Silva, A.J.; de Oliveira, G.H.; Pastoriza, R.J.; Maranhão, E.H.; Pedrosa, E.M.; Maranhão, S.R.; Boiteux, L.S.; Pinheiro, J.B.; de Carvalho Filho, J.L.S. Search for sources of resistance to Meloidogyne enterolobii in commercial and wild tomatoes. Hortic. Bras. 2019, 37, 188–198. [Google Scholar] [CrossRef] [Scilit]
  33. Marques, M.L.S.; Chadud, J.V.G.; Oliveira, M.F.; Nascimento, A.R.; Rocha, M.R. Identification of Chili Pepper Genotypes (Capsicum spp.) Resistant to Meloidogyne enterolobii. J. Agric. Sci. 2019, 11, 165–175. [Google Scholar] [CrossRef] [Scilit]
  34. Gao, Z.W.; Xue, M.J.; Zhou, S.F.; Li, H.; Wu, W.T.; Wang, Y. Pathogenicity of Meloidogyne enterolobii on the resistant tomato variety VFNT. Acta Phytopathol. Sin. 2022, 52, 191–202. [Google Scholar]
  35. Marques, M.L.S.; Oliveira, M.F.; Pereira, P.S.; Rocha, M.R. Penetration and development of Meloidogyne enterolobii in resistant and susceptible Capsicum spp. Eur. J. Hortic. Sci. 2020, 85, 86–91. [Google Scholar] [CrossRef] [Scilit]
  36. Freitas, V.M.; Correa, V.R.; Motta, F.C.; Sousa, M.G.; Gomes, A.C.M.M.; Carneiro, M.D.G.; Silva, D.B.; Mattos, J.K.; Nicole, M.; Carneiro, R.M.D.G. Resistant accessions of wild Psidium spp. to Meloidogyne enterolobii and histological characterization of resistance. Plant Pathol. 2014, 63, 738–746. [Google Scholar] [CrossRef] [Scilit]
  37. Das, S.; DeMason, D.A.; Ehlers, J.D.; Close, T.J.; Roberts, P.A. Histological characterization of root-knot nematodes resistance in cowpea and its relation to reactive oxygen species modulation. J. Exp. Bot. 2008, 59, 1305–1313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Jin, N.; Chen, Y.P.; Liu, Q.; Jian, H. Research progresses in occurrence, diagnoses, pathogenic mechanisms and integrated management of vegetable root-knot nematodes in China. J. Plant Prot. 2022, 49, 424–443. [Google Scholar]
  39. Mônaco, A.P.A.; Carneiro, R.G.; Kranz, W.M.; Gomes, J.C.; Scherer, A.; Santiago, D.C. Reação de espécies de plantas daninhas a Meloidogyne incognita raças 1 e 3, a M. javanica e a M. paranaensis. Nematol. Bras. 2009, 33, 235–242. [Google Scholar]
  40. Razalia, F.N.; Sinniaha, S.K.; Hussinb, H.; Abidina, N.Z.; Shuib, A.S. Tumor suppression effect of Solanum nigrum polysaccharide fractionon Breast cancer via immunomodulation. Int. J. Biol. Macromol. 2016, 92, 185–193. [Google Scholar] [CrossRef] [Scilit]
  41. Long, H.B.; Sun, Y.F.; Zeng, F.Y.; Bai, C. Effect of Initial population density of Meloidogyne enterolobii on Cucumber Growth in Greenhouse. Chin. J. Tropic. Agric. 2015, 35, 61–64. [Google Scholar]
Figure 1. Disease symptoms. (A) Leaf symptoms of diseased plants. (B) Root symptoms of diseased plants. (C) Artificial inoculation symptoms of the plants.
Figure 1. Disease symptoms. (A) Leaf symptoms of diseased plants. (B) Root symptoms of diseased plants. (C) Artificial inoculation symptoms of the plants.
Agronomy 14 00129 g001
Figure 2. Morphological characteristics of the female. (A) Light microscope image of the female. (B) Light microscope image of the perineal patterns of the female.
Figure 2. Morphological characteristics of the female. (A) Light microscope image of the female. (B) Light microscope image of the perineal patterns of the female.
Agronomy 14 00129 g002
Figure 3. PCR in 12 females with intergenic spacer (IGS) specific primers. Lanes 1 to 12: M. enterolobii isolates; Lane 13: M. incognita control; Lane 14: Water control; M: DL2000 DNA Marker.
Figure 3. PCR in 12 females with intergenic spacer (IGS) specific primers. Lanes 1 to 12: M. enterolobii isolates; Lane 13: M. incognita control; Lane 14: Water control; M: DL2000 DNA Marker.
Agronomy 14 00129 g003
Figure 4. Phylogenetic analysis of nematodes based on the sequences of the internal transcribed spacer (ITS) using MEGA 11.0. The number of bootstrap replications was set to 1000, and the other parameters were the default values. Distance scale = 0.05. Bootstrap value indicates the reliability of the branch. The newly obtained sequence is marked with a black dot before the accession number.
Figure 4. Phylogenetic analysis of nematodes based on the sequences of the internal transcribed spacer (ITS) using MEGA 11.0. The number of bootstrap replications was set to 1000, and the other parameters were the default values. Distance scale = 0.05. Bootstrap value indicates the reliability of the branch. The newly obtained sequence is marked with a black dot before the accession number.
Agronomy 14 00129 g004
Figure 5. M. enterolobii development stages in the root of the S. nigrum L. (A) J2 at 1 days after inoculation (DAI). (B) J2 at 3 DAI. (C) J2 after feeding at 5 DAI. (D) J3 at 7 DAI. (E) J4 at 11 DAI. (F) Young female at 18 DAI. (G) Adult female with eggs at 21 DAI. (H) Egg mass formed at 25 DAI. Sections were visualized after staining with acid fuchsin.
Figure 5. M. enterolobii development stages in the root of the S. nigrum L. (A) J2 at 1 days after inoculation (DAI). (B) J2 at 3 DAI. (C) J2 after feeding at 5 DAI. (D) J3 at 7 DAI. (E) J4 at 11 DAI. (F) Young female at 18 DAI. (G) Adult female with eggs at 21 DAI. (H) Egg mass formed at 25 DAI. Sections were visualized after staining with acid fuchsin.
Agronomy 14 00129 g005
Figure 6. Root sections of S. nigrum L. roots infested with M. enterolobii at different days after inoculation (DAI). (A) 1 DAI. (B) 3 DAI. (C,D) 5 DAI. (E) 11 DAI. (F) 18 DAI. (G) 21 DAI. (H) 21 DAI. (I) 25 DAI. J, juvenile. GC, giant cell. NC, normal cell. HC, hyperplastic cell. YF, young female. AF, adult female. J2, second-stage juvenile in intercellular space. EM, egg mass. Sections were visualized after staining with toluidine blue.
Figure 6. Root sections of S. nigrum L. roots infested with M. enterolobii at different days after inoculation (DAI). (A) 1 DAI. (B) 3 DAI. (C,D) 5 DAI. (E) 11 DAI. (F) 18 DAI. (G) 21 DAI. (H) 21 DAI. (I) 25 DAI. J, juvenile. GC, giant cell. NC, normal cell. HC, hyperplastic cell. YF, young female. AF, adult female. J2, second-stage juvenile in intercellular space. EM, egg mass. Sections were visualized after staining with toluidine blue.
Agronomy 14 00129 g006
Table 1. Response of S. nigrum L. to inoculation with M. enterolobii.
Table 1. Response of S. nigrum L. to inoculation with M. enterolobii.
CharacterRangeMean
Eggs/g a22,637.64–37,802.1428,235.92 ± 6585.66
GI b4.00–5.004.70 ± 0.48
EMI c4.00–5.004.30 ± 0.48
Fecundity352.00–454.00409.00 ± 35.00
RF dz31.76–69.2148.04 ± 14.71 (good host)
a Eggs/g = eggs per gram of fresh root. b GI and c EMI = gall index and egg mass index: 0 = 0 galls or egg masses, 1 = 1 to 2 galls or egg masses, 2 = 3 to 10 galls or egg masses, 3 = 11 to 30 galls or egg masses, 4 = 31 to 100 galls or egg masses, 5 = over 101 galls or egg masses [21]. d RF = reproduction factor, final population/initial population. z Host suitability according to Sasser et al. [22]: RF ≥ 1 = good host; 0. 1 < RF < 1.0 = poor host; RF ≤ 0.1 = non host.
Table 2. Effect of S. nigrum L. on the population densities of M. enterolobii in soil.
Table 2. Effect of S. nigrum L. on the population densities of M. enterolobii in soil.
YearTreatmentPopulation Density (J2/cm3) z
Pre-PlantPost-Plant
2022Planting S. nigrum L.0.48 ± 0.25 b1.33 ± 0.16 a
Unplanting S. nigrum L.0.43 ± 0.11 b0.49 ± 0.30 b
2023Planting S. nigrum L.0.53 ± 0.31 b1.56 ± 0.43 a
Unplanting S. nigrum L.0.44 ± 0.25 b0.58 ± 0.16 b
z Means followed by the same letter in columns are not significantly different by least significant difference test at p = 0.05. Tests for the significance of differences were carried out independently in different years.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pei, Y.; Sun, Y.; Chen, Y.; Feng, T.; Che, H.; Long, H. As a Transitional Host, Weed Solanum nigrum L. Increases the Population Base of Root-Knot Nematode Meloidogyne enterolobii for the Next Season. Agronomy 2024, 14, 129. https://doi.org/10.3390/agronomy14010129

AMA Style

Pei Y, Sun Y, Chen Y, Feng T, Che H, Long H. As a Transitional Host, Weed Solanum nigrum L. Increases the Population Base of Root-Knot Nematode Meloidogyne enterolobii for the Next Season. Agronomy. 2024; 14(1):129. https://doi.org/10.3390/agronomy14010129

Chicago/Turabian Style

Pei, Yueling, Yanfang Sun, Yuan Chen, Tuizi Feng, Haiyan Che, and Haibo Long. 2024. "As a Transitional Host, Weed Solanum nigrum L. Increases the Population Base of Root-Knot Nematode Meloidogyne enterolobii for the Next Season" Agronomy 14, no. 1: 129. https://doi.org/10.3390/agronomy14010129

APA Style

Pei, Y., Sun, Y., Chen, Y., Feng, T., Che, H., & Long, H. (2024). As a Transitional Host, Weed Solanum nigrum L. Increases the Population Base of Root-Knot Nematode Meloidogyne enterolobii for the Next Season. Agronomy, 14(1), 129. https://doi.org/10.3390/agronomy14010129

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop