Next Article in Journal
Conservation Agriculture Boosts Soil Health, Wheat Yield, and Nitrogen Use Efficiency After Two Decades of Practice in Semi-Arid Tunisia
Previous Article in Journal
Evolution of Rice Cultivar Performance Across China: A Multi-Dimensional Study on Yield and Agronomic Characteristics over Three Decades
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 14
Issue 12
10.3390/agronomy14122781
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Functional Analysis of Two Carboxylesterase Genes Involved in Beta-Cypermethrin and Phoxim Resistance in Plutella xylostella (L.)

by
Ran Li
1,
Liang Liang
1,
Yujia Zhao
1,
Junyi Zhang
2,
Zhiyuan Hao
3,
Haibo Zhao
1,* and
Pei Liang
2,*
1
Beijing Institute of Metrology, Beijing 100021, China
2
Department of Entomology, China Agricultural University, Beijing 100193, China
3
Frontiers Science Center for Synthetic Biology, School of Pharmaceutical Science and Technology, Faculty of Medicine, Tianjin University, Tianjin 300072, China
*
Authors to whom correspondence should be addressed.
Agronomy 2024, 14(12), 2781; https://doi.org/10.3390/agronomy14122781
Submission received: 14 September 2024 / Revised: 1 November 2024 / Accepted: 7 November 2024 / Published: 23 November 2024
(This article belongs to the Special Issue Insecticide Resistance: The Genetic Basis and Underlying Mechanisms in Pests)
Browse Figures
Versions Notes

Abstract

:
Enhanced expression of carboxylesterase (CarE) genes is an important mechanism of insecticide resistance in pests. However, their roles in multi-insecticide resistance have rarely been reported. Herein, two CarE genes (PxαE6 and PxαE9) were identified; their relative expression levels in three multi-insecticide-resistant populations of P. xylostella (HN, GD-2017 and GD-2019) were 2.69- to 15.32-fold higher than those in the sensitive population, and they were considerably overexpressed at the larval stage and in the midgut of the 4th instar. PxαE6 and PxαE9 knockdown increased the susceptibility of GD-2019 larvae to phoxim or/and beta-cypermethrin. The recombinant PxαE6 and PxαE9 expressed in Escherichia coli exhibited high hydrolysis activity towards α-NA. GC–MS and LC–MS/MS assays revealed that PxαE9 could metabolize beta-cypermethrin and phoxim with efficiency determinations of 51.6% and 21.1%, respectively, while PxαE6 could metabolize phoxim with an efficiency of 12.0%. Homology modelling, molecular docking and molecular-dynamics simulation analyses demonstrated that beta-cypermethrin or/and phoxim could fit well into the active pocket and stably bind to PxαE6 or PxαE9. These results show that PxαE6 and PxαE9 overexpression were involved in resistance to beta-cypermethrin or/and phoxim in multi-insecticide-resistant P. xylostella populations, a finding which sheds light on the molecular mechanisms of multi-insecticide resistance in insect pests.

1. Introduction

The diamondback moth, Plutella xylostella (L.), is one of the most destructive insect pests, one which causes severe economic losses owing to its strong environmental adaptability, short generation cycle and high reproductive rate [1]. Chemical control remains the predominant method for controlling diamondback moth; however, extensive and unreasonable application of insecticides has led to P. xylostella’s evolving resistance to multiple insecticides [2,3]. Our previous study reported that field populations of P. xylostella exhibited resistance to up to nine insecticides via different action modes [4,5]. However, research regarding the molecular mechanisms behind multi-insecticide resistance remains scarce. Decreased target sensitivity and increased detoxification ability constitute two key mechanisms of pesticide resistance [6,7,8]. Mutations in the carboxylesterase (CarE) genes render insects insensitive to insecticides, resulting in cross-resistance. In addition, the varied nature of detoxifying enzymes and the extensive range of their substrates lead to multi-resistance relative to the different modes of action [9].
CarEs represent a major class of metabolic enzymes that can hydrolyse several agrochemicals, including pyrethroids [10], organophosphates, carbamates [11], neonicotinoids [12], oxadiazine [13] and biogenic pesticides [14]. Studies regarding the molecular mechanisms underlying resistance to multiple insecticides in P. xylostella have implicated the role of the overexpression of several CarE genes in this resistance. In addition, the enzyme activity of CarEs exhibited varying degrees of increase at different times after the use of different types of insecticides [5]. Therefore, we hypothesised that the overexpression of the CarE genes contributes to the resistance of the diamondback moth to insecticides with different modes of action. For instance, one report has shown that the upregulation of Pxae18 and Pxae28 plays a role in chlorpyrifos resistance [15]. In addition, PxCCE016b contributes to chlorantraniliprole resistance [16] and PxEst-6 plays a role in pyrethroid metabolism [17]. Our recent study revealed that PxαE8 overexpression was involved in resistance to beta-cypermethrin and phoxim [5] and that PxαE14 contributed to the detoxification of beta-cypermethrin, bifenthrin, chlorpyrifos, fenvalerate, malathion and phoxim [18]. There are two mechanisms of CarE-mediated pesticide metabolism: delay or prevention of the pesticides’ interaction with the target site through sequestration and enhanced metabolism of the pesticides [19,20]. However, the metabolic resistance of CarEs in the detoxification of multiple insecticides has been rarely reported.
Herein, two CarE genes (PxαE6 and PxαE9) were overexpressed in three multi-resistant field populations of diamondback moth. Then, the role of two genes in the multi-insecticide-resistant field population of P. xylostella relative to five insecticides with different action mechanisms was investigated via observations of of RNA interference, which revealed that PxαE6 played a role in resistance to phoxim, while PxαE9 was implicated in resistance to both beta-cypermethrin and phoxim. The metabolic capacity of recombinant PxαE6 and PxαE9 for beta-cypermethrin or phoxim was determined via gas chromatography–mass spectrometry (GC–MS) or liquid chromatography–tandem mass spectrometry (LC–MS/MS). Homology modelling, molecular docking and dynamics simulations of the two genes in P. xylostella with resistance to the two insecticides were also simulated to explore the molecular mechanism of detoxification. Thus, this study provides a basis for better understanding the mechanisms underlying multi-resistance in P. xylostella and other insect pests.

2. Materials and Methods

2.1. Insect Rearing

Four populations of P. xylostella were used in this study, and the feeding conditions for both larvae and adults were consistent with those in the study by Li et al. [5]. According to these conditions, the SS (sensitive strain) population was reared without exposure to any pesticides for >15 years. The HN population was collected from the vegetable fields of Hainan Province, China, in 2017, and exhibited resistance values of 22.2-, 2881-, 1178-, 1628- and 5.6-fold to beta-cypermethrin, chlorantraniliprole, metaflumizone, phoxim and tebufenozide, respectively. The GD population (GD-2017, GD-2019) was sampled from Guangdong Province, China, in 2017 and 2019, and showed resistance values of 11.3- and 120-fold; 1286- and 80,281-fold; 304- and 1460-fold; 676- and 1116-fold; and 42.7- and 48.0-fold to beta-cypermethrin, chlorantraniliprole, metaflumizone, phoxim and tebufenozide, respectively [5].

2.2. Cloning and Sequence Analysis

The analysis and prediction of the amino acid sequence, isoelectric point (pI), molecular mass, signal peptide, catalytic triad, and substrate-binding pocket for PxαE6 and PxαE9 were conducted using software and online tools. These included BlastP analysis in NCBI (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi (accessed on 5 November 2024)) [21], ExPASy tools (http://web.expasy.org/compute_pi/ (accessed on 5 October 2024)) and the SignalP 4.1 program (https://services.healthtech.dtu.dk/services/SignalP-5.0/ (accessed on 1 November 2024)), respectively. The sequences for PxαE6 (GenBank accession number: XM_011555470.1) and PxαE9 (GenBank accession number: XM_011558495.1) were amplified, cloned and sequenced to determine the correct sequence in the diamondback moth. CarE amino acid sequences from several insects, including Drosophila melanogaster (GenBank accession: NP_524261.1), Helicoverpa armigera (GenBank accession: AMO44416.1), Spodoptera frugiperda (GenBank accession: XP_035438334.1), Spodoptera littoralis (GenBank accession: ACV60236.1), Streltzoviella insularis (GenBank accession: QLI62118.1), Lucilia cuprina (GenBank accession: 4FNM_A) and Musca domestica (AAD29685.1), were downloaded from GenBank (http://www.ncbi.nlm.nih.gov/ (accessed on 1 October 2024)). Multiple alignments of the PxαE6, PxαE9 and CarE genes from these six different insect species were performed using DNAMAN software 10.0.2.100 (Lynnon Corporation, Vaudreuil-Dorion, QC, Canada).

2.3. Total RNA Isolation and Quantitative Real-Time PCR

The temporal expression patterns of PxαE6 and PxαE9 were examined across different populations, developmental stages and tissues/body parts using a SYBR® Premix Ex Taq™ II kit (Takara Biotechnology, Dalian, China) on the ABI 7500 quantitative real-time PCR (Applied Biosystems, Foster, CA, USA). Before conducting this experiment, RNA extraction was performed upon the four populations (third instar), and various tissues, including the head, fat body, midgut, hemolymph, malpighian tubules and integuments, were dissected from 2-day old 4th instar nymphs, and different developmental stages such as eggs, first- to fourth-instar larvae, pupae and adults [21] then were reverse transcribed into cDNA. Ribosomal protein L32 (RPL32) served as an internal control to normalize the gene expression of P. xylostella, and the expression levels of PxαE6 and PxαE9 were calculated according to the method of 2−ΔΔCt [22]. The dates of temporal expression patterns were analysed through one-way ANOVA with Tukey’s multiple comparison test (p < 0.05), and all statistical analyses were executed using GraphPad InStat 6.0 (GraphPad Software, San Diego, CA, USA). Primers of PxαE6, PxαE9 and RPL32 genes were designed as listed in Table 1.

2.4. PxαE6 and PxαE9 RNAi in P. xylostella Larvae

Specific primers containing the T7 promoter sequence were designed for PxαE6 and PxαE9 to avoid off-target effects (Table 1). Fragments of 490 bp and 460 bp from PxαE6 and PxαE9, respectively, were designed and synthesized into dsRNA using the Transcript Aid T7 High Yield Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA), as described previously [18]. Approximately 0.3 μg of dsRNA was injected into the lateral surface of the posterior abdomen of each third instar from the GD-2019 population, using a microinjector (Nanoliter 2000 Injector, WPI Inc., Sarasota, FL, USA), respectively. RNAi efficiency was determined 24, 48 and 72 h after injection by qPCR. Additionally, the survival rates of LC50 for each pesticide were recorded at 48 h after placing them on leaves treated with the pesticide [23].

2.5. In Vitro Protein Expression/Purification of PxαE6 and PxαE9

Following amplification of the full-length PxαE6 and PxαE9 using gene-specific primers (Table 1) containing restriction cutting sites (Xho I and EcoR I for PxαE6, and Xhol and Xba I for PxαE9) from the cDNA, the signal peptide sequence of PxαE9 was removed. The amplified products of both genes were purified and then ligated into the empty pCold II vector, and the correctly sequenced transformants were subsequently transferred into E. coli BL21(DE3). The recombinant PxαE6 and PxαE9 were induced in a Luria Bertani culture medium containing ampicillin by adding isopropyl-beta-D-thiogalactopyranoside (IPTG) to achieve a final concentration of 0.5 mM. Induction culture was carried out at 15 °C and 140 rpm for 24 h. Bacterial isolates were extracted, and the precipitated parts were collected and then subjected to ultrasonic disruption on ice. The procedures for protein extraction, Ni-NTA agarose purification, and Western blotting followed the method described by Li et al. [18]. The two purified recombinant proteins were evaluated using 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and stained with Coomassie Brilliant Blue R-250.

2.6. Enzymatic Activity of Four Populations and Recombinant PxαE6 and PxαE9

The full range of CarEs enzymatic activities in the crude enzyme solution taken from four diamondback moth populations [5], as well as the recombinant PxαE6 and PxαE9, were evaluated using alpha-acetyl ester (α-NA) as a substrate. The procedure for creating the α-Naphthol (α-N) standard curve and determining the enzymatic activity of the two exogenous proteins followed the method described by Li et al. [18]. Absorbance at 600 nm was monitored by SpectraMax Plus 384 (Molecular Devices, San José, CA, USA), and the Bradford method [24] was employed to quantitatively determine the CarEs enzyme and concentrations of exogenous proteins. The enzyme activity of the exogenous protein was calculated based on the α-N standard curve, and Km and Vmax were calculated using an enzyme kinetics model plotted in GraphPad Prism 6.0 (GraphPad, USA). Each experiment was repeated three times. The control group used boiled recombinant protein solution.

2.7. Metabolism of PxαE6 and PxαE9 to Insecticides via LC–MS/MS or GC–MS

First, the 700 μL reactions containing 1.5 mg of purified PxαE6 and PxαE9 in 10 mM Tris-HCl buffer (pH 7.4) were pre-warmed at 30 °C for 5 min before the initiation by the addition of insecticides to reach a final concentration of 80 µM. The reactions were then incubated in an incubator shaker at 30 °C and 120 rpm for 3 h. To halt the reactions, 1 mL of a mixture of acetate and n-hexane in a 2: 1 ratio was added. The remaining insecticides were subsequently extracted using a vortex mixer, and the organic phase was collected and gently dried under a stream of nitrogen. The resulting residue was redissolved in either 500 μL of acetonitrile for LC–MS/MS analysis or in n-hexane for gas chromatography interfaced with an ISQ single quadrupole mass spectrometer (GC–MS) analysis. Before transferring the solutions to 2-mL brown autosampler vials (Agilent, Santa Clara, CA, USA), they were filtered through a 0.22 μm membrane filter. To account for any effects that the enzyme of PxαE6 and PxαE9, the organic solvents, or the pH might have on metabolic enzyme activity during incubation, control experiments were conducted. These included incubations with heat-inactivated PxαE9, and blank incubations where 700 μL of Tris-HCl buffer (10 mM) at pH 7.4 was used instead of the enzyme samples [18,25].
The residue of beta-cypermethrin was measured via GC–MS (Agilent 7890B/7200) and analysed using extract-ion chromatography (EIC) [26]. Phoxim hydrolysis was examined by using an LC–MS/MS (AB5000) equipped with a Symmetry C18 column (2.1 × 150 mm × 5 μm) and analysed via multi-reaction monitoring. The detection methods and steps for GC–MS and LC–MS/MS analysis of the metabolism of PxαE6 and PxαE9 have been described by Li et al. [18].

2.8. Homology Modelling, Ligand Preparation

Homology models of PxαE6 and PxαE9 were created using the Prime module [27] in Schrödinger using the crystal structure of Lucilia cuprina alpha-esterase-7 carboxyl esterase (PDB ID: 5IKX) as a template. The models were further minimised using the OPLS3 force field and the VSGB 2.0 energy model in Schrödinger. Phoxim and beta-cypermethrin were downloaded from PubChem Compound (https://www.ncbi.nlm.nih.gov/pccompound/ (accessed on 14 April 2024)) and prepared using the LigPrep module in Schrödinger [27]. Two insecticides were docked into the homology model of PxαE9 using the induce-fit-docking module 3 refer to reported procedures [28]. The ligand-binding pocket was defined according to the previously identified catalytic centre of the enzyme. The ligands were docked within 20 Å of the receptor box centre at the conserved residue Ser186 of PxαE6 and Ser213 of PxαE9.

3. Results

3.1. CarE Activity in Four Populations

The enzymatic activity determinations for the CarEs of the HN, GD-2017 and GD-2019 populations were 2.20-, 2.02- and 3.38-fold (p < 0.05) those of the SS population, respectively. The results indicated that some CarE genes might have participated in the resistance to the five insecticides in P. xylostella (Figure 1).

3.2. Spatio-Temporal Expression Profile of PxαE6 and PxαE9

The relative expression values for PxαE6 and PxαE9 in the GD-2017 and GD-2019 populations were 2.69- and 9.27-fold, and 8.52- and 15.32-fold higher than those in SS, respectively. PxαE9 showed 3.26 times more expression in HN compared with the SS, whereas PxαE6 displayed a lower expression level (Figure 2A,B). In SS, PxαE6 presented its highest expression in the adult, followed by that in L3 of the larval stage (6.71-fold, Figure 2C). PxαE9 was expressed throughout all larval stages, with its highest expression observed in the fourth-instar larvae (15.17-fold, Figure 2D), followed by that in an adult (8.98-fold, Figure 2D). PxαE6 and PxαE9 were also found in various body parts/tissues, with a significant abundance observed in the midgut, in which the expression levels were 25.61- and 14.00-fold higher, respectively, than in the integument (Figure 2E,F).

3.3. Characterisation of PxαE6 and PxαE9

The cDNAs of PxαE6 and PxαE9 encode proteins consisting of 534 and 561 amino acid residues, respectively, with molecular masses of 60.21 kDa and 62.85 kDa, and isoelectric points (pI) of 5.66 and 4.96, individually. The first 20 amino acids of PxαE9 with underscores were signal peptides. The amino acid sequence of PxαE6 and PxαE9 contains several conserved motifs, including a CarE-superfamily-specific catalytic triad and substrate-binding pocket. The analogous triad was ser186-Glu321-His444 in PxαE6, in which Ser186 was part of the Gly184-Glu185-Ser186-Ala187-Gly188 motif (the conserved Gly-Xaa-Ser-Xaa-Gly motif in all esterases/lipases) (Figure S1). The PxαE6 enzyme activity centre contains the analogous triad, a conserved pentapeptide chain (G-X-S-X-G), an anionic site (Gly119, Glu185, Met324, Phe325), an acyl-binding pocket (Trp219, Pro274, His279, Phe394) and an oxyanion hole (Ala107, Phe108, Ala187). Non-contiguous residues, such as Glu105, Ala107, Glu185, Ala187, Ala190, Leu346, Ser350, Leu351, Leu389, Ala445 and Ala448 in PxαE6 may form substrate-binding pockets [29]. For PxαE9, the enzyme activity centre contains the analogous triad (Ser213-Glu340-His453), a conserved pentapeptide chain (Gly211-Pro212-Ser213-Ala214-Gly215), an anionic site (Thr145, Tyr212, Phe343, Arg344), an acyl-binding pocket (Trp246, Asn293, Phe301, Phe409) and an oxyanion hole (Ala-135, Tyr-136, Ala214). Additionally, Gly133, Ala135, Pro212, Ala214, Ser217, Phe362, Asp366, Leu367, Phe404, Met444 and Lys447 in PxαE9 may form substrate-binding pockets.

3.4. Effects of PxαE6 and PxαE9 on Susceptibility of P. xylostella to Insecticides

The qPCR results revealed that the injection of dsPxαE6 and dsPxαE9 significantly reduced the mRNA expression of PxαE6 and PxαE9 by 54.27% and 54.50% at 24 h, 72.92% and 73.46% at 48 h, and 70.80% and 72.66% at 72 h, compared with that of the dsEGFP-injected control (Figure 3A,C). Then, the resistance of dsPxαE6-, dsPxαE9-injected third instars to the five pesticides was detected using the leaf-dipping method. The bioassay results demonstrated that PxαE6 knockdown increased the mortality of larvae treated with an LC50 of phoxim by 19.24%, compared with that of dsEGFP-injected control (Figure 3B); also, PxαE9 knockdown increased the mortality of larvae treated with an LC50 of beta-cypermethrin and phoxim by 19.60% and 13.89%, respectively (Figure 3D). However, silencing PxαE9 had no significant effect on resistance to the other three pesticides, and silencing PxαE6 did not significantly impact resistance to the five insecticides, with the exception of phoxim.

3.5. In Vitro PxαE6 and PxαE9 Hydrolysis Activity Expression Towards Model Substrate α-NA

The recombinant proteins of PxαE6 and PxαE9 were expressed in an E. coli expression system, and then isolated and observed as visualized using Coomassie blue-stained SDS–PAGE, respectively. Western blot analysis revealed that the molecular weights of PxαE6 and PxαE9 were ~60.21 and ~62.85 kDa individually, which was consistent with the result of the SDS–PAGE (Figure 4).
The enzymatic assay demonstrated that the protein PxαE6 catalysed the hydrolysis of the model substrate α-NA, with Vmax of 5.69 ± 0.29 μmol·mg−1·min−1, Km of 46.68 ± 8.98 μM and Kcat/Km of 3.95 μM−1·min−1 (Figure 5A, Table S1). Also, the recombinant PxαE9 catalysed the hydrolysis of α-NA, with Vmax of 1.94 ± 0.11 μmol·mg−1·min−1, Km of 83.80 ± 13.77 μM and Kcat/Km of 0.026 μM−1·min−1 (Figure 5B, Table S1).

3.6. Recombinant PxαE6 and PxαE9 Showed Hydrolysis Activity Towards Beta-Cypermethrin or/and Phoxim

LC-MS/MS assays revealed that incubating protein PxαE6 with 80 μM pesticides significantly decreased the residual amount of phoxim by 12.0% compared to the control; for the control, heat-inactivated PxαE6 was used instead of active PxαE6 (Figure 6A and Figure S2). Compared to the control with boiled recombinant protein, the amounts of beta-cypermethrin and phoxim decreased by 51.6% and 21.1%, respectively, after incubation with recombinant PxαE9, according to the results from GC–MS and LC–MS/MS analyses (Figure 6B,C, Figures S3 and S4).

3.7. Homology Modelling and Molecular Docking Analyses

Molecular docking simulations were conducted to investigate the binding modes of the two recombinant proteins to beta-cypermethrin or/and phoxim. The binding free energies (∆Gbind) of the two proteins (PxαE6 and PxαE9) and phoxim were −55.53 and −38.82 kcal/mol, respectively, and the ∆Gbind of PxαE9 and four isoforms of beta-cypermethrin ranged from −51.29 to −58.40 kcal/mol (Table 2), indicating high binding affinity between PxαE6 and phoxim as well as PxαE9 and the two insecticides.
The theoretical binding modes of the insecticides were analysed based on molecular docking. The catalytic triad (Ser-Glu-His) was represented by deep blue slate lines and the oxyanion hole, anionic site and subsite acyl-binding pocket were represented by green, cyan and orange lines, as described in 3.1, respectively (Figure 7). These four formed the reaction centre with the pentapeptide residue, and the insecticides were encased in the reaction chamber. The oxygen atoms in two phosphate ester bonds of phoxim interact with the hydroxyl hydrogen atom of Ser186 in PxαE6, forming hydrogen bonds (dotted red lines) with lengths of 2.1 Å and 2.0 Å, respectively (Figure 7A). For PxαE9, hydrogen atoms on the amino group of His453 and the amino group of Gln442 interacted with the nitrogen atoms of beta-cypermethrin (coloured green), forming hydrogen bonds with lengths of 2.9 Å and 2.2 Å (Figure 7B). The oxygen atom that connected the ethyl and phosphorus atoms of phoxim connected with hydrogen atoms on the hydroxyl of the residue, Ser213, from protein PxαE9, and formed a hydrogen bond (H-bond) with a distance of 2.1 Å (Figure 7C). The other hydrogen bond (H-bond) was established with the oxygen atom, which connected the ethyl and phosphorus atoms of phoxim and the hydrogen atoms on the nitrogen ring of His436, with a distance of 2.0 Å (Figure 7C).
In addition, there are four isoforms of beta-cypermethrin: (S)-(1R, 3R)-beta-cypermethrin, (R)-(1S, 3S)-beta-cypermethrin, (S)-(1R, 3S)-beta-cypermethrin and (R)-(1S, 3R)-beta-cypermethrin. To elucidate the differential binding affinities of beta-cypermethrin isoform to the PxαE9 protein, molecular docking analysis was performed to assess the theoretical interaction patterns between the four stereoisomers of beta-cypermethrin and PxαE9. The binding free energies (∆Gbind) for PxαE9 and the four isoforms of beta-cypermethrin were −58.40, −56.35, −51.29 and −53.30 kcal/mol respectivly (Table 2), suggesting that (S)-(1R, 3R)-beta-cypermethrin is the isomer most closely bound to PxαE9. The nitrogen atom of (S)-(1R, 3R)-beta-cypermethrin formed a hydrogen bond with the hydrogen atom of Ala135 in PxαE9 at a distance of 2.0 Å (Figure 8A). In addition, (R)-(1S, 3S)-beta-cypermethrin formed two hydrogen bonds with PxαE9 at distances of 2.1 Å and 2.7 Å (Figure 8B), and (R)-(1S, 3R)-beta-cypermethrin had a hydrogen bond distance of 2.3 Å (Figure 8D). Thus, no significant differences were found in the ability of PxαE9 to bind to these four isoforms.

4. Discussion

The overexpression of CarE genes plays an important role in pesticide resistance through enhanced metabolism of pesticides in various insect pests, such as Myzus persicae [30], Culex mosquitoes [31], Bemisia tabaci [32], Galeruca daurica [33], Lucilia cuprina [34], Nilaparvata lugens [12], Spodoptera litura [35] and Grapholita molesta [36]. The enzymatic assay showed that the specific activity of CarEs in the three multi-resistant populations (HN, GD-2017 and GD-2019) were significantly higher than that in the SS, which indicated the involvement of CarE genes in P. xylostella resistance (Figure 1). Herein, the expression levels of the CarE genes, PxαE6 and PxαE9, varied between 2.69- and 15.32-fold across the three field populations of the diamondback moth, which had evolved multiple resistance mechanisms [5].
Subsequently, the expression profiles of PxαE6 and PxαE9 were examined across different developmental stages and body parts/tissues; the results showed higher expression levels in the larval stage and adult stage, and in the midgut. Two genes were highly expressed in the larval stage when diamondback moth larvae were exposed to insecticides, which was consistent with the results of other studies, such as CarE001A and CarE001H in Helicoverpa armigera [10], Pxae18 and Pxae28 in P. xylostella [15], and BoαE1 in Bradysia odoriphaga [37]. Some CarEs might act as odorant-degrading enzymes (ODEs); the latter were highly expressed in olfactory organs, such as the antennae of the adult, and participate in the rapid deactivation of ester pheromone components [38]; the two genes were also found to have higher expression in adults, which may indicate that they serve distinct functions during various stages of development, further verification would be required. Among the six body parts/tissues tested, PxαE6 was highly expressed in the midgut (25.61-fold) (Figure 2B), indicating that it played a role in the hydrolysis of insecticides during their transportation to the midgut; the midgut is the primary detoxification tissue, and is considered to be responsible for the detoxification of xenobiotics, including pesticides [39]. Comparing the expression levels in different tissues, PxαE9 was abundantly distributed in the midgut (14.00-fold), fat bodies (2.41-fold), and Malpighian tubules (2.42-fold), compared to non-detoxification tissue (head), in the SS population (Figure 2F). This suggests that PxαE9 contributes to the chemical storage metabolism in fat bodies, which have been considered the insect analog of vertebrate liver and fat tissue [40]. Malpighian tubules have been considered arthropod excretory organs crucial for the detoxification and excretion of xenobiotics and metabolic wastes [41]. The overexpression of PxαE9 in the Malpighian tubules also indicates that PxαE9 is involved in the resistance of the diamondback moth. The spatio-temporal expression profiles of PxαE6 and PxαE9 indicated their possible involvement in the response to pesticides in P. xylostella.
To further understand the mechanisms of the two genes’ overexpression–mediated-multi-resistance, RNAi experiments (which are usually used for gene function exploration through ‘function decreased’) were conducted, and these revealed that the repression of PxαE6 and PxαE9 enhanced susceptibility to cypermethrin and/or phoxim. Our results revealed that PxαE9 repression caused mortalities, which increased by 19.60% and 13.89% when the third-instar larvae were exposed to an LC50 of beta-cypermethrin and phoxim, respectively. Also, the expression of active proteins in vitro directly reacts with pesticides, which may provide more direct evidence that CarE genes are related to insecticide resistance. Our results demonstrate that the recombinant PxαE9 exhibited very high degradation rates for beta-cypermethrin (51.6%) and phoxim (21.1%), while PxαE6 showed a degradation rate for phoxim of 12.0%. Similarly, CarE proteins of M. domestica have been confirmed to metabolise permethrin, with overall metabolic efficiencies in the range of 16.2–39.2% [42,43]. PxEst6 of P. xylostella can metabolise bifenthrin, cypermethrin, λ-cyhalothrin and cyfluthrin with efficiencies ranging from 22.7% to 40.5% [17], and BoαE1 of B. odoriphaga can hydrolyse malathion at a rate of 27% in a 2 h incubation [37]. The decomposition rate of the recombinant TcCCE12 protein in T. cinnabarinus towards cyflumetofen was 36.9% [44]. Purified recombinant TCE2 in T. cinnabarinus effectively decomposed 21.23% fenpropathrin and 49.70% cyflumetofen within 2 h [45]. Three CarE genes of Culex quinquefasciatus, CPIJ018231, CPIJ018232 and CPIJ018233, metabolised 30.4%, 34.7% and 23.2% of permethrin in vitro, respectively, as determined via high-performance liquid chromatography [46]. The Ha006a enzyme from Helicoverpa armigera has been reported to possess bioremediation properties, and is capable of hydrolyzing synthetic pyrethroids (fenvalerate, λ-cyhalothrin and deltamethrin) and sequestering organophosphate insecticides (paraoxon ethyl, profenofos and chlorpyrifos) [47]. CarEs facilitate the detoxification of insecticides through two distinct mechanisms: hydrolysis of ester-containing pesticides and sequestration; the latter delays or inhibits the interaction of pesticides with their target sites, as opposed to direct hydrolysis [48,49,50]. The resistance mechanisms of PxαE9 to beta-cypermethrin and phoxim may be hydrolysis and sequestration, respectively. Notably, the depletion percentage for beta-cypermethrin is 51.6%, but that for phoxim is 21.1%, implying that, compared with phosphate esters, PxαE9 prefers to metabolise CarEs. Combining the two results suggest that PxαE9 manages the two insecticides, which have different mechanisms and use separate detoxification pathways, indicating a need for further investigation into these mechanisms.
Studies exploring the interactions between PxαE6 and PxαE9 and the insecticides through homology modelling and docking analyses were also conducted. The structure of the PxαE6 and PxαE9 model was highly conserved, with most being α/β hydrolase structures, especially for the catalytic triad. The ∆Gbind (Table 2) of the two insecticides indicates higher binding affinities between the two insecticides and PxαE6 and PxαE9. In addition, the lower binding energy, with the short distance between PxαE6 and PxαE9 and the insecticide residues indicated a stronger binding affinity between the two proteins and ligands. Through molecular docking, the key amino acid residues associated with the binding and detoxification of the two insecticides were predicted, including Ser213, Gln442 and His453 of PxαE9, as well as Ser186 of PxαE6. Nevertheless, the function of these amino acid residues requires further validation through site-directed mutagenesis and a comparison of the metabolic activity of wild-type versus mutant PxαE6 and PxαE9. These results indicated that PxαE6, PxαE9 were involved in multi-insecticide-resistant P. xylostella populations.
Notably, multi-resistance in P. xylostella may be caused by various mechanisms, such as mutations in the voltage-gated sodium channel, acetylcholinesterase, enhanced activity of other detoxifying enzymes, and their regulation of transcription elements, all of which should be considered in future studies.

5. Conclusions

In summary, our study suggest that PxαE6, PxαE9 overexpression contributes to the metabolic detoxification of beta-cypermethrin or/and phoxim, resulting in the development of multi-resistance in field populations of diamond back moth. These findings provide new insights into the molecular mechanisms of metabolism-based multi-pesticide resistance in diamond back moth and other pests, findings which would help in the development of more effective strategies for multi-insecticide resistance management.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/agronomy14122781/s1. Figure S1. Comparison of the deduced amino acid sequences of PxaE6 and PxaE9 from the P. xylostella with known insect CarEs: Droaophila melanogaster, Helicoverpa armigera, Lucilia cuprina, Musca domestica, Spodoptera littoralis and Streltzoviella insularis, respectively. The catalytic triad residues are vertically boxed in red, the highly conserved pentapeptide residues are marked with underlines in red, the oxyanion hole is marked by arrows, the acyl binding pocket is labeled with triangles, and the anionic site is shown with asterisks. The first 20 amino acids with underscores were signal peptides. Figure S2. Typical liquid chromatography–tandem mass spectrometry multiple reaction monitoring chromatograms of PxαE6 metabolic activity with phoxim. A. Blank, no proteins added; B. Heat-inactivated recombinant PxαE6 was used as a control; C. Active recombinant PxαE6 was used as a treatment. Figure S3. Gas chromatograms at different times in the assay of metabolic activity of recombinant PxαE9 toward β-cypermethrin. A. Blank, no proteins added; B. Heat-inactivated recombinant PxαE9 was used as a control; C. Treatment with active recombinant PxαE9. A–C represent chromatograms of reaction mixture, A′–C′ represent chromatograms of β-cypermethrin. Figure S4. Typical liquid chromatography–tandem mass spectrometry multiple reaction monitoring chromatograms of PxαE9 metabolic activity with phoxim. A. Blank, no proteins added; B. Heat-inactivated recombinant PxαE9 was used as a control; C. Active recombinant PxαE9 was used as a treatment. Table S1. Kinetic parameters of recombinant protein PxαE6 and PxαE9 toward α-NA.

Author Contributions

Conceptualization, R.L. and P.L.; Writing—original draft preparation, R.L.; Writing—review and editing, P.L., L.L., Y.Z. and H.Z.; Contributions to the data analysis and provision of reagents and analytical tools, R.L., Z.H., H.Z. and J.Z.; Critical editing and proofreading of the manuscript, L.L., Y.Z. and H.Z.; Performance of the bioassays, R.L. and J.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the China Postdoctoral Science Foundation, grant number 2023M730312; the Science and Technology Plan Projects of the State Administration for Market Regulation, grant number 2022MK002; and the National Key Research and Development Plan, grant number 2022YFF0606105.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Sarfraz, M.; Keddie, B.A. Conserving the efficacy of insecticides against Plutella xylostella (L.) (Lep. Plutellidae). J. Appl. Entomol. 2005, 129, 149–157. [Google Scholar] [CrossRef]
  2. Li, Z.Y.; Feng, X.; Liu, S.S.; You, M.S.; Furlong, M.J. Biology, ecology, and management of the diamondback moth in China. Annu. Rev. Entomol. 2016, 61, 277–296. [Google Scholar] [CrossRef] [PubMed]
  3. Sparks, T.C.; Crossthwaite, A.J.; Nauen, R.; Banba, S.; Cordova, D.; Earley, F.; Ebbinghaus-Kintscher, U.; Fujioka, S.; Hirao, A.H.; Karmon, D.; et al. Insecticides, biologics and nematicides: Updates to IRAC’s mode of action classification—A tool for resistance management. Pestic. Biochem. Physiol. 2020, 167, 104587. [Google Scholar] [CrossRef] [PubMed]
  4. Li, X.X.; Shi, H.Y.; Liang, P.; Gao, X.W. Characterization of UDP-glucuronosyltransferase genes and their possible roles in multi-insecticide resistance in Plutella xylostella (L.). Pest Manag. Sci. 2018, 74, 695–704. [Google Scholar] [CrossRef]
  5. Li, R.; Zhu, B.; Shan, J.Q.; Li, L.H.; Liang, P.; Gao, X.W. Functional analysis of a carboxylesterase gene involved in beta-cypermethrin and phoxim resistance in Plutella xylostella (L.). Pest Manag. Sci. 2021, 77, 2097–2105. [Google Scholar] [CrossRef]
  6. Hemingway, J.; Hawkes, N.J.; McCarroll, L.; Ranson, H. The molecular basis of insecticide resistance in mosquitoes. Insect Biochem. Mol. Biol. 2004, 34, 653–665. [Google Scholar] [CrossRef]
  7. Liu, N.N. Insecticide resistance in mosquitoes: Impact, mechanisms, and research directions. Annu. Rev. Entomol. 2015, 60, 537–559. [Google Scholar] [CrossRef]
  8. Liu, K.Y.; Ma, S.Y.; Zhang, K.; Gao, R.B.; Jin, H.F.; Gao, P.; Yuchi, Z.G.; Wu, S.Y. Functional characterization of knockdown resistance mutation L1014S in the german cockroach, Blattella germanica (Linnaeus). J. Agric. Food Chem. 2023, 71, 2734–2744. [Google Scholar] [CrossRef]
  9. Chang, Y.M.; Xu, W.H.; Wang, S.; Zhu, M.Y.; Ru, Y.N.; Xu, Z.H.; Chen, G.Y.; Li, Y.Q. Characterization of four carboxylesterases involved in detoxification of β-cypermethrin, λ-cyhalothrin, and malathion in Helicoverpa armigera. J. Agric. Food Chem. 2024; online. [Google Scholar]
  10. Li, Y.Q.; Bai, L.S.; Zhao, C.X.; Xu, J.J.; Sun, Z.J.; Dong, Y.L.; Li, D.X.; Liu, X.L.; Ma, Z.Q. Functional characterization of two carboxylesterase genes involved in pyrethroid detoxification in Helicoverpa armigera. J. Agric. Food Chem. 2020, 68, 3390–3402. [Google Scholar] [CrossRef]
  11. Yang, X.; Dai, J.; Zhao, S.J.; Li, R.; Goulette, T.; Chen, X.; Xiao, H. Identification and characterization of a novel carboxylesterase from Phaseolus vulgaris for detection of organophosphate and carbamates pesticides. J. Sci. Food Agric. 2018, 98, 5095–5104. [Google Scholar] [CrossRef]
  12. Mao, K.K.; Ren, Z.J.; Li, W.H.; Cai, T.W.; Qin, X.Y.; Wan, H.; Jin, B.R.; He, S.; Li, J.H. Carboxylesterase genes in nitenpyram-resistant brown planthoppers, Nilaparvata lugens. Insect Sci. 2021, 28, 1049–1060. [Google Scholar] [CrossRef] [PubMed]
  13. Wang, Q.; Rui, C.; Wang, Q.; Wang, L.; Li, F.; Nahiyoon, S.A.; Yuan, H.; Cui, L. Mechanisms of increased indoxacarb toxicity in methoxyfenozide-resistant cotton bollworm Helicoverpa armigera (Lepidoptera: Noctuidae). Toxics 2020, 8, 71. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, Y.; Ma, M.C.; Guo, Z.; You, C.M.; Gao, X.W.; Shi, X.Y. Esterase-mediated spinosad resistance in house flies Musca domestica (Diptera: Muscidae). Ecotoxicology 2020, 29, 35–44. [Google Scholar] [CrossRef] [PubMed]
  15. Xie, M.; Ren, N.N.; You, Y.C.; Chen, W.J.; Song, Q.S.; You, M.S. Molecular characterisation of two alpha-esterase genes involving chlorpyrifos detoxification in the diamondback moth, Plutella xylostella. Pest Manag. Sci. 2017, 73, 1204–1212. [Google Scholar] [CrossRef] [PubMed]
  16. Hu, Z.D.; Feng, X.; Lin, Q.S.; Chen, H.Y.; Li, Z.Y.; Yin, F.; Liang, P.; Gao, X.W. cDNA cloning and characterization of the carboxylesterase PxCCE016b from the diamondback moth, Plutella xylostella. J. Integr. Agric. 2016, 15, 1059–1068. [Google Scholar] [CrossRef]
  17. Li, Y.F.; Sun, H.; Tian, Z.; Li, Y.; Ye, X.; Li, R.C.; Li, X.Y.; Zheng, S.L.; Liu, J.Y.; Zhang, Y.L. Identification of key residues of carboxylesterase PxEst-6 involved in pyrethroid metabolism in Plutella xylostella (L.). J. Hazard. Mater. 2021, 407, 124612. [Google Scholar] [CrossRef]
  18. Li, R.; Zhu, B.; Hu, X.P.; Shi, X.Y.; Qi, L.L.; Liang, P.; Gao, X.-W. Overexpression of PxαE14 contributed to multiple insecticides detoxification in Plutella xylostella (L.). J. Agric. Food. Chem. 2022, 70, 5794–5804. [Google Scholar] [CrossRef]
  19. Oakeshott, J.; Claudianos, C.; Newcomb, R.D.; Russell, R.G. 5.10 Biochemical genetics and genomics of insect esterases. In Comprehensive Molecular Insect Science; Gilbert, L.I., Iatrou, K., Gill, S.S., Eds.; Elsevier: London, UK, 2005; pp. 309–381. [Google Scholar]
  20. Oakeshott, J.G.; Devonshire, A.L.; Claudianos, C.; Sutherland, T.D.; Horne, I.; Campbell, P.M.; Ollis, D.L.; Russell, R.J. Comparing the organophosphorus and carbamate insecticide resistance mutations in cholin- and carboxyl-esterases. Chem.-Biol. Interact. 2005, 157, 269–275. [Google Scholar] [CrossRef]
  21. Li, R.; Sun, X.; Liang, P.; Gao, X.W. Characterization of carboxylesterase PxαE8 and its role in multi-insecticide resistance in Plutella xylostella (L.). J. Integr. Agric. 2022, 21, 1713–1721. [Google Scholar] [CrossRef]
  22. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  23. Guo, L.; Bian, Q.L.; Zhang, H.J.; Gao, X.W.; Liang, P. Bioassay technique for Plutella xylostella: Leaf-dip method. Chin. J. Appl. Entomol. 2013, 50, 556–560. [Google Scholar]
  24. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
  25. Ai, G.M.; Zou, D.Y.; Shi, X.Y.; Liang, P.; Song, D.L.; Gao, X.W. HPLC assay for characterizing α-Cyano-3-phenoxybenzyl pyrethroids hydrolytic metabolism by Helicoverpa armigera (Hübner) based on the quantitative analysis of 3-Phenoxybenzoic acid. J. Agric. Food Chem. 2010, 58, 694–701. [Google Scholar] [CrossRef] [PubMed]
  26. Andelkovic, D.; Brankovic, M.; Kocic, G.; Mitic, S.; Pavlovic, R. Sorbent-excluding sample preparation method for GC-MS pesticide analysis in apple peel. Biomed. Chromatogr. 2020, 34, e4720. [Google Scholar] [CrossRef] [PubMed]
  27. Schrödinger Release 2018-2: Prime or LigPrep; Schrödinger, LLC.: New York, NY, USA, 2018.
  28. Hu, X.P.; Pang, J.P.; Zhang, J.T.; Shen, C.; Chai, X.; Wang, E.C.; Chen, H.Y.; Wang, X.W.; Duan, M.J.; Fu, W.T.; et al. Discovery of novel GR ligands toward druggable GR antagonist conformations identified by MD simulations and markov state model analysis. Adv. Sci. 2022, 9, e2102435. [Google Scholar] [CrossRef] [PubMed]
  29. Cygler, M.; Schrag, J.D.; Sussman, M.; Harel, I.; Silman, M.K.; Gentry, B.P. Relationship between sequence conservation and three-dimensional structure in a large family of esterases, lipases, and related proteins. Protein Sci. 1993, 2, 366–382. [Google Scholar] [CrossRef]
  30. Field, L.M.; Devonshire, A.L. Evidence that the E4 and FE4 esterase genes responsible for insecticide resistance in the aphid Myzus persicae (Sulzer) are part of a gene family. Biochem. J. 1998, 330, 169–173. [Google Scholar] [CrossRef]
  31. Hemingway, J.; Karunaratne, S.H. Mosquito carboxylesterases: A review of the molecular biology and biochemistry of a major insecticide resistance mechanism. Med. Vet. Entomol. 1998, 12, 1–12. [Google Scholar] [CrossRef]
  32. Alon, M.; Alon, F.; Nauen, R.; Morin, S. Organophosphates’ resistance in the B-biotype of Bemisia tabaci (Hemiptera: Aleyrodidae) is associated with a point mutation in an ace1-type acetylcholinesterase and overexpression of carboxylesterase. Insect Biochem. Mol. Biol. 2008, 38, 940–949. [Google Scholar] [CrossRef]
  33. Ren, H.; Zhang, H.L.; Tan, Y.; Ni, R.Y.; Shan, Y.M.; Li, F.; Dai, G.X.; Li, L.; Li, Y.Y.; Pang, B.P. Sublethal effects of chlorantraniliprole on biological characteristics, detoxifying enzyme activity and gene expression profile in the Allium mongolicum Regel leaf beetle Galeruca daurica (Coleoptera: Chrysomelidae). J. Appl. Entomol. 2024, 148, 287–303. [Google Scholar] [CrossRef]
  34. Heidari, R.; Devonshire, A.L.; Campbell, B.E.; Dorrian, S.J.; Oakeshott, J.G.; Russell, R.J. Hydrolysis of pyrethroids by carboxylesterases from Lucilia cuprina and Drosophila melanogaster with active sites modified by in vitro mutagenesis. Insect Biochem. Mol. Biol. 2005, 35, 597–609. [Google Scholar] [CrossRef] [PubMed]
  35. Shi, Y.; Li, W.L.; Zhou, Y.L.; Liao, X.L.; Shi, L. Contribution of multiple overexpressed carboxylesterase genes to indoxacarb resistance in Spodoptera litura. Pest Manag. Sci. 2022, 78, 1903–1914. [Google Scholar] [CrossRef] [PubMed]
  36. Li, J.; Jia, Y.; Zhang, D.; Li, Z.; Zhang, S.; Liu, X. Molecular identification of carboxylesterase genes and their potential roles in the insecticide susceptibility of Grapholita molesta. Insect Mol. Biol. 2023, 32, 305–315. [Google Scholar] [CrossRef] [PubMed]
  37. Tang, B.W.; Dai, W.; Qi, L.J.; Du, S.K.; Zhang, C.N. Functional characterization of an alpha-esterase gene associated with malathion detoxification in Bradysia odoriphaga. J. Agric. Food Chem. 2020, 68, 6076–6083. [Google Scholar] [CrossRef] [PubMed]
  38. Shangguan, C.; Kuang, Y.; Gao, L.; Zhu, B.; Chen, X.D.; Yu, X. Antennae-enriched expression of candidate odorant degrading enzyme genes in the turnip aphid, Lipaphis erysimi. Front. Physiol. 2023, 14, 1228570. [Google Scholar] [CrossRef]
  39. Li, J.; Lv, Y.; Liu, Y.; Bi, R.; Pan, Y.; Shang, Q. Inducible gut-specific carboxylesterase SlCOE030 in polyphagous pests of Spodoptera litura conferring tolerance between imidacloprid and cyantraniliprole. J. Agric. Food Chem. 2023, 71, 4281–4291. [Google Scholar] [CrossRef]
  40. Pinch, M.; Mitra, S.; Rodriguez, S.D.; Li, Y.; Kandel, Y.; Dungan, B.; Holguin, F.O.; Attardo, G.M.; Hansen, I.A. Fat and happy: Profiling mosquito fat body lipid storage and composition post-blood meal. Front. Insect Sci. 2021, 16, 693168. [Google Scholar] [CrossRef]
  41. Xu, Y.J.; Zhang, Y.N.; Yang, X.; Hao, S.P.; Wang, Y.J.; Yang, X.X.; Shen, Y.Q.; Su, Q.; Xiao, Y.D.; Liu, J.Q.; et al. Proteotranscriptomic analyses of the midgut and Malpighian tubules after a sublethal concentration of Cry1Ab exposure on Spodoptera litura. Pest Manag. Sci. 2024, 80, 2587–2595. [Google Scholar] [CrossRef]
  42. Feng, X.C.; Liu, N.N. Functional characterization of carboxylesterases in insecticide resistant house flies, Musca domestica. J. Vis. Exp. 2018, 138, e58106. [Google Scholar] [CrossRef]
  43. Feng, X.C.; Liu, N.N. Functional analyses of house fly carboxylesterases involved in insecticide resistance. Front. Physiol. 2020, 11, 595009. [Google Scholar] [CrossRef]
  44. Wei, P.; Li, J.H.; Liu, X.Y.; Nan, C.; Shi, L.; Zhang, Y.C.; Li, C.Z.; He, L. Functional analysis of four upregulated carboxylesterase genes associated with fenpropathrin resistance in Tetranychus cinnabarinus (Boisduval). Pest Manag. Sci. 2019, 75, 252–261. [Google Scholar] [CrossRef] [PubMed]
  45. Shi, L.; Wei, P.; Wang, X.Z.; Shen, G.M.; Zhang, J.; Xiao, W.; Xu, Z.F.; Xu, Q.; He, L. Functional analysis of esterase TCE2 gene from Tetranychus cinnabarinus (Boisduval) involved in acaricide resistance. Sci. Rep. 2016, 6, 18646. [Google Scholar] [CrossRef] [PubMed]
  46. Gong, Y.H.; Li, M.; Li, T.; Liu, N.N. Molecular and functional characterization of three novel carboxylesterases in the detoxification of permethrin in the mosquito, Culex quinquefasciatus. Insect Sci. 2022, 29, 199–214. [Google Scholar] [CrossRef] [PubMed]
  47. Kaur, H.; Rode, S.; Lonare, S.; Demiwal, P.; Narasimhappa, P.; Arun, E.; Kumar, R.; Das, J.; Ramamurthy, P.C.; Sircar, D.; et al. Heterologous expression, biochemical characterization and prospects for insecticide biosensing potential of carboxylesterase Ha006a from Helicoverpa armigera. Pestic. Biochem. Physiol. 2024, 200, 105844. [Google Scholar] [CrossRef] [PubMed]
  48. Bass, C.; Puinean, A.M.; Zimmer, C.T.; Denholm, I.; Field, L.M.; Foster, S.P.; Gutbrod, O.; Nauen, R.; Slater, R.; Williamson, M.S. The evolution of insecticide resistance in the peach potato aphid, Myzus persicae. Insect Biochem. Mol. Biol. 2014, 51, 41–51. [Google Scholar] [CrossRef]
  49. Hopkins, D.H.; Fraser, N.J.; Mabbitt, P.D.; Carr, P.D.; Oakeshott, J.G.; Jackson, C.J. Structure of an insecticide sequestering carboxylesterase from the disease vector Culex quinquefasciatus: What makes an enzyme a good insecticide sponge? Biochemistry 2017, 56, 5512–5525. [Google Scholar] [CrossRef]
  50. Li, Z.Y.; Chen, M.L.; Bai, W.J.; Zhang, S.X.; Meng, L.W.; Dou, W.; Wang, J.J.; Yuan, G.R. Identification, expression profiles and involvement in insecticides tolerance and detoxification of carboxylesterase genes in Bactrocera dorsalis. Pestic. Biochem. Physiol. 2023, 193, 105443. [Google Scholar] [CrossRef]
Agronomy 14 02781 g001
Figure 1. CarE-specific activity of third-instars of Plutella xylostella from SS, HN, GD-2017 and GD-2019 populations. Means with distinct lowercase letters are significantly different.
Figure 1. CarE-specific activity of third-instars of Plutella xylostella from SS, HN, GD-2017 and GD-2019 populations. Means with distinct lowercase letters are significantly different.
Agronomy 14 02781 g001
Agronomy 14 02781 g002
Figure 2. Relative expression of PxaE6 and PxαE9 in four populations (A,B) and various developmental stages (C,D) and body parts/tissues (E,F) of Plutella xylostella. SS, susceptible population. Three field populations: HN, GD-2017 and GD-2019. L1–L4, first to fourth instars. MT, malpighian tubule. The results are depicted as the mean ± standard deviation (n = 3), with bars labeled by distinct lowercase letters indicating a statistically significant difference (p < 0.05) according to a one-way ANOVA followed by Tukey’s post hoc test.
Figure 2. Relative expression of PxaE6 and PxαE9 in four populations (A,B) and various developmental stages (C,D) and body parts/tissues (E,F) of Plutella xylostella. SS, susceptible population. Three field populations: HN, GD-2017 and GD-2019. L1–L4, first to fourth instars. MT, malpighian tubule. The results are depicted as the mean ± standard deviation (n = 3), with bars labeled by distinct lowercase letters indicating a statistically significant difference (p < 0.05) according to a one-way ANOVA followed by Tukey’s post hoc test.
Agronomy 14 02781 g002
Agronomy 14 02781 g003
Figure 3. Relative expression of PxaE6 (A) and PxαE9 (C) in the 3rd larvae with dsRNA of selected PxαE9 or dsEGFP. Mortalities of dsPxαE6- (B) and dsPxαE9-injected (D) third instars of P. xylostella 48 h post treatment with LC50. CYP, beta-cypermethrin; CHL, chlorantraniliprole; PHO, phoxim; TEB, tebufenozide; MET: metaflumizone. The asterisk * denotes a significant distinction between the treatment and control groups (Student’s t-test; p < 0.05). Lowercase letters indicating a statistically significant difference (p < 0.05) according to a one-way ANOVA followed by Tukey’s post hoc test.
Figure 3. Relative expression of PxaE6 (A) and PxαE9 (C) in the 3rd larvae with dsRNA of selected PxαE9 or dsEGFP. Mortalities of dsPxαE6- (B) and dsPxαE9-injected (D) third instars of P. xylostella 48 h post treatment with LC50. CYP, beta-cypermethrin; CHL, chlorantraniliprole; PHO, phoxim; TEB, tebufenozide; MET: metaflumizone. The asterisk * denotes a significant distinction between the treatment and control groups (Student’s t-test; p < 0.05). Lowercase letters indicating a statistically significant difference (p < 0.05) according to a one-way ANOVA followed by Tukey’s post hoc test.
Agronomy 14 02781 g003
Agronomy 14 02781 g004
Figure 4. Analysis of recombinant PxαE6 and PxαE9 by SDS-PAGE (A) and WB assay (B). The recombinant proteins were fractionated on 10% gels, and WB analysis was conducted using an anti-His tag antibody. Lanes 1, pColdII vector with 0.5 mM IPTG; M, protein ladder; Lanes 2, recombinant vector of PxαE6 with 0.5 mM IPTG; Lanes 3, purified proteins of PxαE6; Lanes 4, recombinant vector of PxαE9 with 0.5 mM IPTG; Lanes 5, purified proteins of PxαE9. WB: Western blot.
Figure 4. Analysis of recombinant PxαE6 and PxαE9 by SDS-PAGE (A) and WB assay (B). The recombinant proteins were fractionated on 10% gels, and WB analysis was conducted using an anti-His tag antibody. Lanes 1, pColdII vector with 0.5 mM IPTG; M, protein ladder; Lanes 2, recombinant vector of PxαE6 with 0.5 mM IPTG; Lanes 3, purified proteins of PxαE6; Lanes 4, recombinant vector of PxαE9 with 0.5 mM IPTG; Lanes 5, purified proteins of PxαE9. WB: Western blot.
Agronomy 14 02781 g004
Agronomy 14 02781 g005
Figure 5. The catalytic kinetic parameters of recombinant PxαE6 (A) and PxαE9 (B). Vmax, maximum velocity; Km, Michaelis–Menten constant. Values are presented as mean ± standard error (SE).
Figure 5. The catalytic kinetic parameters of recombinant PxαE6 (A) and PxαE9 (B). Vmax, maximum velocity; Km, Michaelis–Menten constant. Values are presented as mean ± standard error (SE).
Agronomy 14 02781 g005
Agronomy 14 02781 g006
Figure 6. Residues of phoxim after incubation with purified recombinant PxαE6 (A). Residues of beta-cypermethrin (B) and phoxim (C) after incubation with purified PxαE9. Heat-inactivated recombinant PxαE6 or PxαE9 (boiled PxαE6 or PxαE9) and blank controls (no proteins were added) were used as double controls. The data were presented as mean ± standard deviation (SD) with n = 3 replicates. Bars labeled with distinct lowercase letters indicated significant differences (p < 0.05) based on one-way ANOVA followed by Tukey’s multiple comparison test.
Figure 6. Residues of phoxim after incubation with purified recombinant PxαE6 (A). Residues of beta-cypermethrin (B) and phoxim (C) after incubation with purified PxαE9. Heat-inactivated recombinant PxαE6 or PxαE9 (boiled PxαE6 or PxαE9) and blank controls (no proteins were added) were used as double controls. The data were presented as mean ± standard deviation (SD) with n = 3 replicates. Bars labeled with distinct lowercase letters indicated significant differences (p < 0.05) based on one-way ANOVA followed by Tukey’s multiple comparison test.
Agronomy 14 02781 g006
Agronomy 14 02781 g007
Figure 7. The overall structure (left) and binding model (right) of PxαE6 and PxaE9 relative to insecticides. (A) PxαE6 and phoxim. (B) PxαE9 and beta-cypermethrin. (C) PxαE9 and phoxim. Note: Beta-cypermethrin and phoxim are represented in green and cyan, respectively. Gray, H; blue, N; red, O; green, Cl; firebrick, Br; yellow, S; orange, P. Residues of catalytic triad (Ser-Glu-His) are presented with deep-blue slate lines. Oxyanion holes are presented with green lines, anion sites are blue-colored lines and acyl binding pockets are shown with orange lines. Other amino acids which can form hydrogen bonds with pesticides are shown with yellow lines. The hydrogen bonds are shown with red dotted lines.
Figure 7. The overall structure (left) and binding model (right) of PxαE6 and PxaE9 relative to insecticides. (A) PxαE6 and phoxim. (B) PxαE9 and beta-cypermethrin. (C) PxαE9 and phoxim. Note: Beta-cypermethrin and phoxim are represented in green and cyan, respectively. Gray, H; blue, N; red, O; green, Cl; firebrick, Br; yellow, S; orange, P. Residues of catalytic triad (Ser-Glu-His) are presented with deep-blue slate lines. Oxyanion holes are presented with green lines, anion sites are blue-colored lines and acyl binding pockets are shown with orange lines. Other amino acids which can form hydrogen bonds with pesticides are shown with yellow lines. The hydrogen bonds are shown with red dotted lines.
Agronomy 14 02781 g007
Agronomy 14 02781 g008
Figure 8. (A–D) The binding models of PxαE9 and (S)-(1R, 3R)-beta-cypermethrin, (R)-(1S, 3S) -beta-cypermethrin, (S)-(1R, 3S) -beta-cypermethrin and (R)-(1S, 3R)-beta-cypermethrin. Note: The beta-cypermethrin molecule is depicted by green lines. Residues of catalytic triad (Ser-Glu-His) are represented with deep-blue slate lines. Anion sites are depicted with blue lines, oxyanion holes are represented with green lines, and acyl binding pockets are represented by orange lines. The hydrogen bonds are illustrated with red dotted lines.
Figure 8. (A–D) The binding models of PxαE9 and (S)-(1R, 3R)-beta-cypermethrin, (R)-(1S, 3S) -beta-cypermethrin, (S)-(1R, 3S) -beta-cypermethrin and (R)-(1S, 3R)-beta-cypermethrin. Note: The beta-cypermethrin molecule is depicted by green lines. Residues of catalytic triad (Ser-Glu-His) are represented with deep-blue slate lines. Anion sites are depicted with blue lines, oxyanion holes are represented with green lines, and acyl binding pockets are represented by orange lines. The hydrogen bonds are illustrated with red dotted lines.
Agronomy 14 02781 g008
Table 1. Primers used in this study.
Table 1. Primers used in this study.
NameProduct Length (bp)Sense Primer (5′-3′)Anti-Sense Primer (5′-3′)
PxαE6-ORF1605ATGGTGGTGGTGAACGTTACCGAAGGAAGTTATTGTTGATAAATAGATACATTATT
PxαE6-qPCR106CGCAGGAATGAAGGACCAAGTCCAGCACTCTCACCAAAGA
PxαE6-RNAi490taatacgactcactatagggCAGCCTTGAGGTGGGTTAAGtaatacgactcactatagggATTAGTGCTTCGTCAGCCGT
PxαE6-Xhol-EcoR I1605CCGCTCGAGGTGGTGGTGAACGTTACCGAAGGAAGCCGGAATTCTTATTGTTGATAAATAGATACATTATT
PxαE9-ORF1686ATGGCCAAATATACGTTTTTTCTAGCTTACAACTCCGAGTGTTCAACACCCGTTG
PxαE9-qPCR123AAGGAAGCAACTCCCGACTTAGATGTCGTCCCAGAACCTG
PxαE9-RNAi460taatacgactcactatagggGCCGACAATGTATCCGAGTTtaatacgactcactatagggCCTGAAGCCTCACAGACCTC
RPL32-qPCR132ATCCGCCATCAGTCCGACCGGGCTGAACCGTAACCAATGTTG
PxαE9-Xhol-Xba I1623CCGCTCGAGGCTGATGTGCAGGAAAGTGTCCTAGTCTAGACAACTCCGAGTGTTCAACACCCGTTG
Note: T7 promoter sequences are expressed in lower-case. The Xhol, EcoR I and Xba I sites are underlined.
Table 2. The binding free energies (∆Gbind) of insecticides with PxαE6 or PxαE9.
Table 2. The binding free energies (∆Gbind) of insecticides with PxαE6 or PxαE9.
CarEsInsecticide∆Gbind (kcal/mol)
PxαE6Phoxim−55.53
PxαE9Phoxim−38.82
(S)-(1R, 3R)-beta-cypermethrin−58.40
(R)-(1S, 3S)-beta-cypermethrin−56.35
(S)-(1R, 3S)-beta-cypermethrin−51.29
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, R.; Liang, L.; Zhao, Y.; Zhang, J.; Hao, Z.; Zhao, H.; Liang, P. Functional Analysis of Two Carboxylesterase Genes Involved in Beta-Cypermethrin and Phoxim Resistance in Plutella xylostella (L.). Agronomy 2024, 14, 2781. https://doi.org/10.3390/agronomy14122781

AMA Style

Li R, Liang L, Zhao Y, Zhang J, Hao Z, Zhao H, Liang P. Functional Analysis of Two Carboxylesterase Genes Involved in Beta-Cypermethrin and Phoxim Resistance in Plutella xylostella (L.). Agronomy. 2024; 14(12):2781. https://doi.org/10.3390/agronomy14122781

Chicago/Turabian Style

Li, Ran, Liang Liang, Yujia Zhao, Junyi Zhang, Zhiyuan Hao, Haibo Zhao, and Pei Liang. 2024. "Functional Analysis of Two Carboxylesterase Genes Involved in Beta-Cypermethrin and Phoxim Resistance in Plutella xylostella (L.)" Agronomy 14, no. 12: 2781. https://doi.org/10.3390/agronomy14122781

APA Style

Li, R., Liang, L., Zhao, Y., Zhang, J., Hao, Z., Zhao, H., & Liang, P. (2024). Functional Analysis of Two Carboxylesterase Genes Involved in Beta-Cypermethrin and Phoxim Resistance in Plutella xylostella (L.). Agronomy, 14(12), 2781. https://doi.org/10.3390/agronomy14122781

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop