Identification of Shade Avoidance Response MicroRNAs and Their Targets in Solanum tuberosum L. via High-Throughput Sequencing
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and Shade Treatments
2.2. Total RNA Extraction, sRNA Library Construction and Sequencing
2.3. miRNA Sequencing Data Analysis and miRNA Identification
2.4. Differential Expression Analysis of Known and Novel miRNAs
2.5. RT-qPCR Analysis of Shade-Related miRNAs
2.6. Prediction of miRNA Targets and Functional Annotation
2.7. Validation of miRNA Target Genes by 5′-RLM-RACE
3. Results
3.1. Overview of sRNAs High-Throughput Sequencing
3.2. Identification of Known and Novel miRNAs
3.3. Differential Expression Analysis of miRNAs
3.4. Validation of miRNA Expression by qRT-PCR
3.5. Target Gene Prediction of miRNAs
3.6. GO Enrichment and KEGG Pathway Analyses of miRNA Target Genes
3.7. Targets of miRNAs Involved in Shade Avoidance Response
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Chang, B.W. Cloning and Analysis of Genes Related to Potato Shade-Resistance Response. Master’s Thesis, Anhui Agricultural University, Hefei, China, 2018. [Google Scholar]
- Zhou, Y. TCP Transcription Factors Regulate Shade Avoidance via Promoting the Activity of PIFs and the Expression of Auxin Biosynthetic Genes. Ph.D. Thesis, Lanzhou University, Lanzhou, Chian, 2018. [Google Scholar]
- Duvick, D.N. What Is Yield? Developing Drought- and Low N-Tolerant Maize. Proceedings of a Symposiu. 1997, pp. 332–335. Available online: https://hygeia-analytics.com/wp-content/uploads/2016/12/RP_Hist_Duvick_whatisyield.pdf (accessed on 28 March 2024).
- Xie, Y.R.; Liu, Y.; Wang, H.; Ma, X.J.; Wang, B.B.; Wu, G.X.; Wang, H.Y. Phytochrome-interacting factors directly suppress MIR156 expression to enhance shade-avoidance syndrome in Arabidopsis. Nat. Commun. 2017, 8, 348. [Google Scholar] [CrossRef] [PubMed]
- Li, Y. Screening of Proteins in Soybean Shade Avoidance Control and Their Effects on Sugar Metabolism. Master’s Thesis, Sichuan Agricultural University, Yaan, China, 2020. [Google Scholar]
- Dudley, S.A.; Schmitt, J. Testing the Adaptive Plasticity Hypothesis: Density-Dependent Selection on Manipulated Stem Length in Impatiens capensis. Am. Nat. 1996, 147, 445–465. [Google Scholar] [CrossRef]
- Schmitt, J.; Stinchcombe, J.R.; Heschel, M.S.; Huber, H. The adaptive evolution of plasticity: Phytochrome-mediated shade avoidance responses. Integr. Comp. Biol. 2003, 43, 459–469. [Google Scholar] [CrossRef] [PubMed]
- Gong, W.Z.; Jiang, C.D.; Wu, Y.S.; Chen, H.H.; Liu, W.Y.; Yang, W.Y. Tolerance vs. avoidance: Two strategies of soybean (Glycine max) seedlings in response to shade in intercropping. Photosynthetica 2015, 53, 259–268. [Google Scholar] [CrossRef]
- Green-Tracewicz, E.; Page, E.R.; Swanton, C.J. Shade Avoidance in Soybean Reduces Branching and Increases Plant-to-Plant Variability in Biomass and Yield per Plant. Weed Sci. 2011, 59, 43–49. [Google Scholar] [CrossRef]
- Green-Tracewicz, E.; Page, E.R.; Swanton, C.J. Light Quality and the Critical Period for Weed Control in Soybean. Weed Sci. 2012, 60, 86–91. [Google Scholar] [CrossRef]
- Chen, J.; Li, S.P.; Zhang, D.L. Research progress of molecular physiology on shade avoidance responses in plants. J. Trimetics Crops 2016, 36, 1355–1361. [Google Scholar]
- Chaturvedi, G.S.; Ingram, K.T. Growth and yield of lowland rice in response to shade and drainage. Philipp. J. Crop Sci. 1989, 14, 61–67. [Google Scholar]
- Yao, Y.; Yamamoto, Y.; Yoshida, T.; Nitta, Y.; Miyazaki, A. Response of differentiated and degenerated spikelets to top-dressing, shading and day/night temperature treatments in rice cultivars with large panicles. Soil Sci. Plant Nutr. 2000, 46, 631–641. [Google Scholar] [CrossRef]
- Greenwald, R.; Bergin, M.H.; Xu, J.; Cohan, D.; Hoogenboom, G.; Chameides, W.L. The influence of aerosols on crop production: A study using the CERES crop model. Agric. Syst. 2006, 89, 390–413. [Google Scholar] [CrossRef]
- Ren, B.; Liu, W.; Zhang, J.; Dong, S.T.; Liu, P.; Zhao, B. Effects of plant density on the photosynthetic and chloroplast characteristics of maize under high-yielding conditions. Sci. Nat. 2017, 104, 12. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.T.; Liu, C.; Li, L. Characteristics of shade avoidance response of tomato seedlings and preliminary study on the effect of bottom filling light during cultivation. Fudan J. 2021, 60, 740–751. [Google Scholar]
- Guo, J.Z.; Peng, L.; Jin, L.; Qu, Z.C.; Li, S.W.; Lu, W.H.; Shi, Y.; Tang, X.H. Effects of light intensity on growth and fluorescence parameters of potato plantlets in vitro. Chin. Potato 2021, 35, 300–307. [Google Scholar]
- Olena, A.F.; Patton, J.G. Genomic organization of microRNAs. J. Cell Physiol. 2010, 222, 540–545. [Google Scholar] [CrossRef]
- Marc, R.F.; Filipowicz, W.; Sonenberg, N. Regulation of mRNA translation and stability by microRNAs. Annu. Rev. Biochem. 2010, 79, 351–379. [Google Scholar] [CrossRef]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
- Qin, J.P.; Tang, Z.H.; Ma, X.X.; Meng, Y.J. Investigating the regulatory roles of the microRNAs and the Argonaute 1-en riched small RNAs in plant metabolism. Gene 2017, 628, 180–189. [Google Scholar] [CrossRef]
- Sun, C.; Zhao, Q.; Liu, D.D.; You, C.X.; Hao, Y.J. Ectopic expression of the apple Md-miRNA156h gene regulates flower and fruit development in Arabidopsis. Plant Cell Tiss. Organ. Cult. 2013, 112, 343–351. [Google Scholar] [CrossRef]
- Tang, F.; Wei, H.R.; Zhao, S.T.; Wang, L.J.; Zheng, H.Q.; Lu, M.Z. Identification of microRNAs involved in regeneration of the secondary vascular system in Populus tomentosa Carr. Front. Plant Sci. 2016, 7, 724–741. [Google Scholar] [CrossRef]
- Lopez-Ortiz, C.; Peña-Garcia, Y.; Bhandari, M.; Abburi, V.L.; Natarajan, P.; Stommel, J.; Nimmakayala, P.; Reddy, U.K. Identification of miRNAs and Their Targets Involved in Flower and Fruit Development across Domesticated and Wild Capsicum Species. Int. J. Mol. Sci. 2021, 22, 4866. [Google Scholar] [CrossRef]
- Liu, Q.; Zhang, Y.C.; Wang, C.Y.; Luo, Y.C.; Huang, Q.J.; Chen, S.Y.; Zhou, H.; Qu, L.H.; Chen, Y.Q. Expression analysis of phytohormone-regulated microRNAs in rice, implying their regulation roles in plant hormone signaling. FEBS Lett. 2009, 583, 723–728. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.H.; Bao, M.L.; Sun, Y.Z.; Yang, Y.J.; Xu, X.H.; Wang, J.H.; Han, N.; Bian, H.W.; Zhu, M.Y. Regulation of auxin response by miR393-targeted transport inhibitor response protein 1 is involved in normal development in Arabidopsis. Plant Mol. Biol. 2011, 77, 619–629. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Z.; Xue, Y.D.; Yang, H.L.; Li, H.M.; Sun, G.Y.; Zhao, X.F.; Ding, D.; Tang, J.H. Genome-wide identification of miRNAs and their targets involved in the developing internodes under maize ears by responding to hormone signaling. PLoS ONE 2016, 11, e0164026. [Google Scholar] [CrossRef] [PubMed]
- Yuan, J.; Wang, X.; Qu, S.T.; Shen, T.; Li, M.J.; Zhu, L.C. The roles of miR156 in abiotic and biotic stresses in plants. Plant Physiol. Biochem. 2023, 204, 108150. [Google Scholar] [CrossRef] [PubMed]
- Kumar, D.; Ramkumar, M.K.; Dutta, B.; Kumar, A.; Pandey, R.; Jain, P.K.; Gaikwad, K.; Mishra, D.C.; Chaturvedi, K.K.; Rai, A.; et al. Integration of miRNA dynamics and drought tolerant QTLs in rice reveals the role of miR2919 in drought stress response. BMC Genom. 2023, 24, 526. [Google Scholar] [CrossRef]
- Yu, Y.H.; Ni, Z.Y.; Wang, Y.; Wan, H.N.; Hu, Z.; Jiang, Q.Y.; Sun, X.J.; Zhang, H. Overexpression of soybean miR169c confers increased drought stress sensitivity in transgenic Arabidopsis thaliana. Plant Sci. 2019, 285, 68–78. [Google Scholar] [CrossRef]
- Nguyen, D.Q.; Brown, C.W.; Pegler, J.L.; Eamens, A.L.; Grof, C.P.L. Molecular Manipulation of MicroRNA397 Abundance Influences the Development and Salt Stress Response of Arabidopsis thaliana. Int. J. Mol. Sci. 2020, 21, 7879. [Google Scholar] [CrossRef]
- Wan, J.; Meng, S.J.; Wang, Q.Y.; Zhao, J.W.; Qiu, X.Q.; Wang, L.F.; Li, J.; Lin, Y.; Mu, L.Q.; Dang, K.T.; et al. Suppression of microRNA168 enhances salt tolerance in rice (Oryza sativa L.). BMC Plant Biol. 2022, 22, 563. [Google Scholar] [CrossRef]
- Qiao, H.L.; Jiao, B.; Wang, J.; Yang, Y.; Yang, F.; Geng, Z.; Zhao, G.Y.; Liu, Y.W.; Dong, F.S.; Wang, Y.Q.; et al. Comparative Analysis of miRNA Expression Profiles under Salt Stress in Wheat. Genes 2023, 14, 1586. [Google Scholar] [CrossRef]
- Zhou, M.Q.; Tang, W. MicroRNA156 amplifies transcription factor-associated cold stress tolerance in plant cells. Mol. Genet. Genom. 2019, 294, 379–393. [Google Scholar] [CrossRef]
- Abla, M.; Sun, H.G.; Li, Z.Y.; Wei, C.X.; Gao, F.; Zhou, Y.J.; Feng, J.C. Identification of miRNAs and Their Response to Cold Stress in Astragalus Membranaceus. Biomolecules 2019, 9, 182. [Google Scholar] [CrossRef]
- Megha, S.; Basu, U.; Kav, N.N.V. Regulation of low temperature stress in plants by microRNAs. Plant Cell Environ. 2018, 41, 1–15. [Google Scholar] [CrossRef]
- Li, J.; Cao, Y.M.; Zhang, J.X.; Zhu, C.J.; Tang, G.L.; Yan, J. The miR165/166-PHABULOSA module promotes thermotolerance by transcriptionally and posttranslationally regulating HSFA1. Plant Cell 2023, 35, 2952–2971. [Google Scholar] [CrossRef]
- Ravichandran, S.; Ragupathy, R.; Edwards, T.; Domaratzki, M.; Cloutier, S. MicroRNA-guided regulation of heat stress response in wheat. BMC Genom. 2019, 20, 488. [Google Scholar] [CrossRef]
- Paul, S.; Duhan, J.S.; Jaiswal, S.; Angadi, U.B.; Sharma, R.; Raghav, N.; Gupta, O.P.; Sheoran, S.; Sharma, P.; Singh, R.; et al. RNA-Seq Analysis of Developing Grains of Wheat to Intrigue into the Complex Molecular Mechanism of the Heat Stress Response. Front. Plant Sci. 2022, 13, 90439. [Google Scholar] [CrossRef]
- Yuan, L.Z.; Tang, J.H.; Liu, J.Y.; Song, H.; Zhang, M.B.; Li, H.P.; Li, Z.H. Differential miRNA expression in maize ear subjected to shading tolerance. Acta Physiol. Plant 2016, 38, 1–12. [Google Scholar] [CrossRef]
- Panigrahy, M.; Panigrahi, K.C.S.; Poli, Y.; Ranga, A.; Majeed, N. Integrated Expression Analysis of Small RNA, Degradome and Microarray Reveals Complex Regulatory Action of miRNA during Prolonged Shade in Swarnaprabha Rice. Biology 2022, 11, 798. [Google Scholar] [CrossRef]
- Zhang, R.X.; Marshall, D.; Bryan, G.J.; Hornyik, C. Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing. PLoS ONE 2013, 8, e57233. [Google Scholar] [CrossRef]
- Lakhotia, N.; Joshi, G.; Bhardwaj, A.R.; Katiyar-Agarwal, S.; Agarwal, M.; Jagannath, A.; Goel, S.; Kumar, A. Identification and characterization of miRNAome in root, stem, leaf and tuber developmental stages of potato (Solanum tuberosum L.) by high-throughput sequencing. BMC Plant Biol. 2014, 14, 6. [Google Scholar] [CrossRef]
- Zhang, W.W.; Luo, Y.P.; Gong, X.; Zeng, W.H.; Li, S.G. Computational identification of 48 potato microRNAs and their targets. Comput. Biol. Chem. 2009, 33, 84–93. [Google Scholar] [CrossRef]
- Rey-Burusco, M.F.; Daleo, G.R.; Feldman, M.L. Identification of potassium phosphite responsive miRNAs and their targets in potato. PLoS ONE 2019, 14, e0222346. [Google Scholar] [CrossRef] [PubMed]
- Jie, J.M. Study on Physiological and Biochemical Changes, and Identification of Tolerance of Pepper Seedlings Under Low Temperature and Poor Light Stress. Ph.D. Thesis, Gansu Agricultural University, Lanzhou, China, 2008. [Google Scholar]
- Wang, L. Rice Starch Quality and Grain Yield Formations and Physiological Mechanism of Hybrid Rice to Shading After Heading. Ph.D. Thesis, Sichuan Agricultural University, Yaan, China, 2016. [Google Scholar]
- Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Ruotti, V.; Stewart, R.M.; Thomson, J.A.; Dewey, C.N. RNA-Seq gene expression estimation with read mapping uncertainty. Bioinformatics 2010, 26, 493–500. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.; Livak, K. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1110. [Google Scholar] [CrossRef]
- Allen, E.; Xie, Z.; Gustafson, A.M.; Carrington, J.C. microRNA-directed phasing during trans-acting siRNA biogenesis in plants. Cell 2005, 121, 207–221. [Google Scholar] [CrossRef]
- Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef]
- Liu, J.J.; Ren, Y.; Sun, Y.; Yin, Y.G.; Han, B.; Zhang, L.P.; Song, Y.; Zhang, Z.; Xu, Y.Y.; Fan, D.Y.; et al. Identification and Analysis of the MIR399 Gene Family in Grapevine Reveal Their Potential Functions in Abiotic Stress. Int. J. Mol. Sci. 2024, 25, 2979. [Google Scholar] [CrossRef]
- Pegler, J.L.; Nguyen, D.Q.; Oultram, J.M.J.; Grof, C.P.L.; Eamens, A.L. Molecular Manipulation of the miR396 and miR399 Expression Modules Alters the Response of Arabidopsis thaliana to Phosphate Stress. Plants 2021, 10, 2570. [Google Scholar] [CrossRef]
- Wang, R.; Fang, Y.N.; Wu, X.M.; Qing, M.; Li, C.C.; Xie, K.D.; Deng, X.X.; Guo, W.W. The miR399-CsUBC24 Module Regulates Reproductive Development and Male Fertility in Citrus. Plant Physiol. 2020, 183, 1681–1695. [Google Scholar] [CrossRef]
- Qiao, Y.; Zhang, J.J.; Zhang, J.W.; Wang, Z.W.; Ran, A.; Guo, H.X.; Wang, D.; Zhang, J.L. Integrated RNA-seq and sRNA-seq analysis reveals miRNA effects on secondary metabolism in Solanum tuberosum L. Mol. Genet. Genom. 2017, 292, 37–52. [Google Scholar] [CrossRef]
- Kapadia, C.; Datta, R.; Mahammad, S.M.; Tomar, R.S.; Kheni, J.K.; Ercisli, S. Genome-Wide Identification, Quantification, and Validation of Differentially Expressed miRNAs in Eggplant (Solanum melongena L.) Based on Their Response to Ralstonia solanacearum Infection. ACS Omega 2023, 8, 2648–2657. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Mumtaz, M.A.; Zhang, Y.H.; Yang, Z.; Hao, Y.Y.; Shu, H.Y.; Zhu, J.; Bao, W.L.; Cheng, S.H.; Zhu, G.P.; et al. Response of anthocyanin biosynthesis to light by strand-specific transcriptome and miRNA analysis in Capsicum annuum. BMC Plant Biol. 2022, 22, 79. [Google Scholar] [CrossRef] [PubMed]
- Lyu, X.; Mu, R.; Liu, B. Shade avoidance syndrome in soybean and ideotype toward shade tolerance. Mol. Breed. 2023, 43, 31. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Jafari, F.; Wang, H. Integration of light and hormone signaling pathways in the regulation of plant shade avoidance syndrome. aBIOTECH 2021, 2, 131–145. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.H.; Tian, Y.M.; Luo, X.J.; Zhou, T.; Huang, Z.P.; Liu, Y.; Qiu, Y.H.; Hou, B.; Sun, D.; Deng, H.Y.; et al. Identification and characterization of microRNAs related to salt stress in broccoli, using high-throughput sequencing and bioinformatics analysis. BMC Plant Biol. 2014, 14, 226. [Google Scholar] [CrossRef][Green Version]
- Islam, W.; Naveed, H.; Idress, A.; Ishaq, D.U.; Kurfi, B.G.; Zeng, F.J. Plant responses to metals stress: MicroRNAs in focus. Environ. Sci. Pollut. Res. 2022, 29, 69197–69212. [Google Scholar] [CrossRef]
- Zhu, Q.H.; Upadhyaya, N.M.; Gubler, F.; Helliwell, C.A. Over-expression of miR172 causes loss of spikelet determinacy and floral organ abnormalities in rice (Oryza sativa). BMC Plant Biol. 2009, 9, 149. [Google Scholar] [CrossRef]
- Sun, Y.; Luo, W.; Chang, H.; Li, Z.; Zhou, J.; Li, X.; Zheng, J.; Hao, M. Identification of miRNAs and Their Target Genes Involved in Cucumber Fruit Expansion Using Small RNA and Degradome Sequencing. Biomolecules 2019, 9, 483. [Google Scholar] [CrossRef]
- Wu, X.J.; Ma, Y.H.; Wu, J.; Wang, P.J.; Zhang, Z.C.; Xie, R.; Liu, J.; Fan, B.B.; Wei, W.; Nie, L.Z.; et al. Identification of microRNAs and their target genes related to the accumulation of anthocyanin in purple potato tubers (Solanum tuberosum). Plant Direct 2022, 6, e418. [Google Scholar] [CrossRef]
- Yang, Y.F.; Qiu, Y.Q.; Ye, W.; Sun, G.; Li, H.S. RNA sequencing-based exploration of the effects of far-red light on microRNAs involved in the shade-avoidance response of D. officinale. PeerJ 2023, 11, e15001. [Google Scholar] [CrossRef]
- Wang, L.; Gu, X.L.; Xu, D.Y.; Wang, W.; Wang, H.; Zeng, M.H.; Chang, Z.Y.; Huang, H.; Cui, X.F. miR396-targeted AtGRF transcription factors are required for coordination of cell division and differentiation during leaf development in Arabidopsis. J. Exp. Bot. 2011, 62, 761–773. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.R.; Zhao, J.M.; Li, Z.G.; Hu, Q.; Yuan, N.; Zhou, M.; Xia, X.X.; Noorai, R.; Saski, C.; Li, S.G.; et al. MicroRNA396-mediated alteration in plant development and salinity stress response in creeping bentgrass. Hortic. Res. 2019, 6, 48. [Google Scholar] [CrossRef] [PubMed]
- Akdogan, G.; Tufekci, E.D.; Uranbey, S.; Unver, T. miRNA-based drought regulation in wheat. Funct. Integr. Genom. 2016, 16, 221–233. [Google Scholar] [CrossRef] [PubMed]
- Ding, B.S.; Yue, Y.; Chen, X.; Long, X.H.; Zhou, Z.S. Identification and expression analysis of miR396 and its target genes in Jerusalem artichoke under temperature stress. Gene 2024, 893, 147908. [Google Scholar] [CrossRef]
- Gupta, O.P.; Meena, N.L.; Sharma, I.; Sharma, P. Differential regulation of microRNAs in response to osmotic, salt and cold stresses in wheat. Mol. Biol. Rep. 2014, 41, 4623–4629. [Google Scholar] [CrossRef]
- Ali, S.; Huang, S.L.; Zhou, J.J.; Bai, Y.S.; Liu, Y.; Shi, L.Y.; Liu, S.; Hu, Z.L.; Tang, Y.L. miR397-LACs mediated cadmium stress tolerance in Arabidopsis thaliana. Plant Mol. Biol. 2023, 113, 415–430. [Google Scholar] [CrossRef]
- Omidvar, V.; Mohorianu, I.; Dalmay, T.; Fellner, M. MicroRNA Regulation of Abiotic Stress Response in 7B-1 Male-Sterile Tomato Mutant. Plant Genome 2015, 8, 0008. [Google Scholar] [CrossRef]
- Luo, M.; Sun, X.Y.; Xu, M.; Tian, Z.D. Identification of miRNAs Involving Potato-Phytophthora infestans Interaction. Plants 2023, 12, 461. [Google Scholar] [CrossRef]
- Bukhari, S.A.; Shang, S.H.; Zhang, M.; Zheng, W.T.; Zhang, G.P.; Wang, T.Z.; Shamsi, I.H.; Wu, F.B. Genome-wide identification of chromium stress-responsive micro RNAs and their target genes in tobacco (Nicotiana tabacum) roots. Environ. Toxicol. Chem. 2015, 34, 2573–2582. [Google Scholar] [CrossRef]
- He, X.C.; Lv, H.S.; Huang, J.F.; Ma, L.Q.; Yang, M.F. Advances on Target Gene Alidation Method of Plant miRNA. Adv. Biotechnol. 2017, 2, 102–105. [Google Scholar]
- Lopez Vazquez, A.; Allenbach Petrolati, L.; Legris, M.; Dessimoz, C.; Lampugnani, E.R.; Glover, N.; Fankhauser, C. Protein S-acylation controls the subcellular localization and biological activity of PHYTOCHROME KINASE SUBSTRATE. Plant Cell 2023, 35, 2635–2653. [Google Scholar] [CrossRef] [PubMed]
- Park, J.E.; Seo, P.J.; Lee, A.K.; Jung, J.H.; Kim, Y.S.; Park, C.M. An Arabidopsis GH3 gene, encoding an auxin-conjugating enzyme, mediates phytochrome B-regulated light signals in hypocotyl growth. Plant Cell Physiol. 2007, 48, 1236–1241. [Google Scholar] [CrossRef] [PubMed]
- Nomoto, Y.; Kubozono, S.; Yamashino, T.; Nakamichi, N.; Mizuno, T. Circadian clock- and PIF4-controlled plant growth: A coincidence mechanism directly integrates a hormone signaling network into the photoperiodic control of plant architectures in Arabidopsis thaliana. Plant Cell Physiol. 2012, 53, 1950–1964. [Google Scholar] [CrossRef]
- Ren, X.Y. QTL Mapping for Phenotypic Plasticity in Arabidopsis thaliana Under Light Effects. Master’s Thesis, Beijing Forestry University, Beijing, China, 2021. [Google Scholar]
- Buti, S.; Hayes, S.; Pierik, R. The bHLH network underlying plant shade-avoidance. Physiol. Plant 2020, 169, 312–324. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q. The Molecular Mechanism of Bluelight-Dependent Phosphorylation and Degradation of Arabidopsis Cryptochrome2. Ph.D. Thesis, Jilin University, Changchun, China, 2016. [Google Scholar]
- Pan, J.W.; Zhao, S.Z.; Zhang, Y.; Li, C.S.; Wang, Y.H.; Wang, X.J. Regulation of Phytochrome Interacting Factors (PIFs) on Plant Growth and Development. Shandong Agric. Sci. 2014, 6, 150–156. [Google Scholar]
- Keller, M.M.; Jaillais, Y.; Pedmale, U.V.; Moreno, J.E.; Chory, J.; Ballaré, C.L. Cryptochrome 1 and phytochrome B control shade-avoidance responses in Arabidopsis via partially independent hormonal cascades. Plant J. 2011, 67, 195–207. [Google Scholar] [CrossRef]
- Mao, Z.L.; Wei, X.W.; Li, L.; Xu, P.; Zhang, J.Y.; Wang, W.X.; Guo, T.T.; Kou, S.; Wang, W.T.; Miao, L.X.; et al. Arabidopsis cryptochrome 1 controls photomorphogenesis through regulation of H2A.Z deposition. Plant Cell 2021, 33, 1961–1979. [Google Scholar] [CrossRef]









| miRNA | Primer Sequence (5′–3′) | 
|---|---|
| St18s RNA | TTAGAGGAAGGAGAAGTCGTAACAA | 
| novel_miR_29 | TCAACGCTACACTCAATCATG | 
| novel_miR_94 | GGCTGTTTTCCTGTTACTACTAGC | 
| stu-miR408b-3p | GCACTGCCTCTTCCCTGG | 
| stu-miR482a-3p | TTCCAATTCCACCCATTCC | 
| novel_miR_76 | GTTCAATAAGGCTGTGGGAAG | 
| novel_miR_61 | GCGCTGACTGATTTTACTTGATC | 
| stu-miR6149-5p | TTGCAACACACCTGAATCGTC | 
| novel_miR_175 | TTTGGATTGAAGGGAGCTCTA | 
| novel_miR_31 | GCTTGGTTGAGTGAGCATCTAAG | 
| novel_miR_125 | GCTTGGTTGAGTGAGCATCTAAG | 
| CK-1 | CK-3 | D5–1 | D5–2 | D5–3 | D10–1 | D10–2 | D10–3 | |
|---|---|---|---|---|---|---|---|---|
| Raw reads | 12,416,902 | 12,350,548 | 10,982,544 | 13,840,468 | 11,989,189 | 12,177,270 | 12,015,238 | 13,272,065 | 
| length filter | 2,478,853 | 2,472,752 | 1,234,216 | 2,133,580 | 2,113,010 | 2,380,032 | 2,225,285 | 2,795,600 | 
| Low quality | 58 | 77 | 64 | 61 | 65 | 69 | 72 | 74 | 
| Containing‘N’reads | 1 | 1 | 0 | 0 | 2 | 5 | 3 | 3 | 
| Clean reads | 9,937,990 | 9,877,718 | 9,748,264 | 11,706,827 | 9,876,112 | 9,797,164 | 9,789,878 | 10,476,388 | 
| rRNA | 4,551,604 | 5,465,399 | 5,720,270 | 5,289,981 | 4,307,391 | 3,918,617 | 4,352,700 | 4,181,643 | 
| scRNA | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 
| snRNA | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 
| snoRNA | 10,243 | 8830 | 7973 | 8257 | 6180 | 6474 | 8238 | 5915 | 
| tRNA | 207,482 | 243,521 | 142,955 | 207,469 | 168,697 | 155,323 | 171,960 | 223,737 | 
| Repbase | 78,136 | 62,988 | 70,062 | 118,935 | 109,252 | 111,846 | 114,343 | 113,050 | 
| Mapped_Reads | 2,715,284 | 2,109,407 | 2,076,538 | 3,367,345 | 2,899,458 | 3,077,051 | 2,837,757 | 3,221,056 | 
| Q20 (%) | 99.27 | 99.23 | 99.28 | 99.29 | 99.27 | 99.28 | 99.25 | 99.23 | 
| Q30 (%) | 97.55 | 97.51 | 97.66 | 97.68 | 97.58 | 97.57 | 97.58 | 97.41 | 
| GC (%) | 45.82 | 46.72 | 46.85 | 45.67 | 45.53 | 44.89 | 46.02 | 45.46 | 
| Types | All miRNA | miRNA with Target | Target Gene | 
|---|---|---|---|
| Known miRNA | 307 | 297 | 4796 | 
| Novel miRNA | 218 | 207 | 2863 | 
| Total | 525 | 504 | 6842 | 
| miRNA | miRNA Sequences | Target Gene | Transcript Annotation | GO Term | 
|---|---|---|---|---|
| novel_miR_29 | TCAACGCTACACTCAATCATG | gene.Soltu.DM.03G030260.1 | protein PHYTOCHROME KINASE SUBSTRATE 3-like | GO:0009638 (phototropism); GO:0016301 (kinase activity); | 
| novel_miR_94 | TGTTTTCCTGTTACTACTAGC | gene.Soltu.DM.05G019950.4 | probable indole-3-acetic acid-amido synthetase GH3.5 | GO:0009416 (response to light stimulus); GO:0009628 (response to abiotic stimulus); | 
| stu-miR482a-3p | TTTCCAATTCCACCCATTCCTA | gene.Soltu.DM.05G009460.1 | receptor-like protein kinase HERK 1 | GO:0004674 (protein serine/threonine kinase activity); GO:0005524 (ATP binding); | 
| gene.Soltu.DM.09G029050.1 | receptor like protein kinase S.2 | GO:0004672 (protein kinase activity); GO:0005524 (ATP binding); | ||
| gene.Soltu.DM.06G000210.1 | receptor-like protein kinase ANXUR1 | GO:0004672 (protein kinase activity); GO:0005524 (ATP binding); | ||
| gene.Soltu.DM.06G000200.1 | receptor-like protein kinase ANXUR1 | GO:0004672 (protein kinase activity); GO:0005524 (ATP binding); | ||
| novel_miR_76 | GTTCAATAAGGCTGTGGGAAG | gene.Soltu.DM.01G027830.1 | transcription factor bHLH130-like | GO:0046983 (protein dimerization activity); | 
| novel_miR_61 | TGACTGATTTTACTTGATC | gene.Soltu.DM.08G018860.1 | DDB1- and CUL4-associated factor homolog 1 | GO:0016567 (protein ubiquitination); | 
| stu-miR6149-5p | TTGCAACACACCTGAATCGTC | gene.Soltu.DM.01G022170.1 | cullin-1 | GO:0006511 (ubiquitin-dependent protein catabolic process); GO:0031625 (ubiquitin protein ligase binding); | 
| gene.Soltu.DM.01G022170.4 | cullin-1 | GO:0006511 (ubiquitin-dependent protein catabolic process); GO:0031625 (ubiquitin protein ligase binding); | ||
| novel_miR_175 | TTTGGATTGAAGGGAGCTCTA | gene.Soltu.DM.02G005160.1 | gibberellin 3-beta-dioxygenase 1-like | GO:0016491 (oxidoreductase activity); GO:0046872 (metal ion binding); | 
| gene.Soltu.DM.02G005090.1 | gibberellin 3-beta-dioxygenase 1-like | GO:0016491 (oxidoreductase activity); GO:0046872 (metal ion binding); | ||
| gene.Soltu.DM.02G005130.1 | gibberellin 3-beta-dioxygenase 1-like | GO:0016491 (oxidoreductase activity); GO:0046872 (metal ion binding); | ||
| gene.Soltu.DM.01G010800.1 | gibberellin 3-beta-dioxygenase 1-like | GO:0016491 (oxidoreductase activity); GO:0046872 (metal ion binding); | ||
| gene.Soltu.DM.03G000170.1 | G-type lectin S-receptor-like serine/threonine-protein kinase At1g34300 | GO:0004674 (protein serine/threonine kinase activity); | ||
| novel_miR_31 | TTGGTTGAGTGAGCATCTAAG | gene.Soltu.DM.09G027910.1 | probable indole-3-pyruvate monooxygenase YUCCA3 | GO:0004499 (N,N-dimethylaniline monooxygenase activity); GO:0050660 (flavin adenine dinucleotide binding); | 
| novel_miR_125 | TTGGTTGAGTGAGCATCTAAG | gene.Soltu.DM.12G007030.1 | cryptochrome-1-like | GO:0009638phototropism (phototropism); GO:0009640 (photomorphogenesis); GO:0009644 (response to high light intensity); GO:0009646 (response to absence of light); GO:0009882 (blue light photoreceptor activity); GO:0010114 (response to red light); GO:0010117 (photoprotection); GO:0010218 (response to far red light); GO:0042752 (regulation of circadian rhythm); GO:1902448 (positive regulation of shade avoidance); | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, M.; Yang, J.; Zhang, N.; Qiao, R.; Li, X.; Zhu, F.; Si, H. Identification of Shade Avoidance Response MicroRNAs and Their Targets in Solanum tuberosum L. via High-Throughput Sequencing. Agronomy 2024, 14, 2833. https://doi.org/10.3390/agronomy14122833
Liu M, Yang J, Zhang N, Qiao R, Li X, Zhu F, Si H. Identification of Shade Avoidance Response MicroRNAs and Their Targets in Solanum tuberosum L. via High-Throughput Sequencing. Agronomy. 2024; 14(12):2833. https://doi.org/10.3390/agronomy14122833
Chicago/Turabian StyleLiu, Mei, Jiangwei Yang, Ning Zhang, Run Qiao, Xinxia Li, Fengjiao Zhu, and Huaijun Si. 2024. "Identification of Shade Avoidance Response MicroRNAs and Their Targets in Solanum tuberosum L. via High-Throughput Sequencing" Agronomy 14, no. 12: 2833. https://doi.org/10.3390/agronomy14122833
APA StyleLiu, M., Yang, J., Zhang, N., Qiao, R., Li, X., Zhu, F., & Si, H. (2024). Identification of Shade Avoidance Response MicroRNAs and Their Targets in Solanum tuberosum L. via High-Throughput Sequencing. Agronomy, 14(12), 2833. https://doi.org/10.3390/agronomy14122833
 
        


 
       