Major QTL Mapping and Candidate Gene Analysis of Branching Number Habits in Cucumis melo
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Cytological Observation of Axillary Buds
2.3. Branching Number Investigation
2.4. BSA-Seq and Association Region Detection
2.5. Fine Mapping of Candidate Genes
2.6. Prediction of Candidate Genes and Gene Expression Analysis
2.7. Cloning of CmPK1 (Cucumis Phytol Kinase 1)
2.8. Analysis of CmPK1 Expression Patterns
2.9. Genetic Transformation of Cucumber
2.10. Statistical Analysis
3. Results
3.1. Cytological Observation of Axillary Bud Differentiation
3.2. Effect of Different Pruning Methods on the Number of Branches
3.3. Phenotypic Evaluation and Preliminary QTL Mapping of the Number of Branches
3.4. Fine Mapping of Candidate Intervals
3.5. Candidate Gene Expression Patterns and Sequence Analysis
3.6. Preliminary Validation of Gene Function via CmPk1 Cloning and Sequence Analysis
3.7. Construction of the CmPk1 Expression Vector and Genetic Transformation of Cucumber
3.8. Analysis of Branching in CmPk1-Overexpressing Plants
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Confraria, A.; Muñoz-Gasca, A.; Ferreira, L.; Baena-González, E.; Cubas, P. Shoot branching phenotyping in Arabidopsis and tomato. In Environmental Responses in Plants; Duque, P., Szakonyi, D., Eds.; Springer: New York, NY, USA, 2022; pp. 47–59. [Google Scholar]
- Zhang, L.; Yang, Y.; Song, L. The Current Status and High Quality Development Strategies of Watermelon and Melon Industry in Beijing. China Agric. Sci. Technol. Guide 2023, 25, 20–27. [Google Scholar]
- Liu, W.; Xu, X.; Pan, X.; Zhang, Q.; Wang, J.; He, H.; Sun, J.; Cheng, Z.; Zhang, X.; Zhou, H. Analysis and recommendation of commercial watermelon and melon pro-duction in the old course of the Yellow River. Chin. Melon Veg. 2022, 35, 1–11. [Google Scholar]
- Cozzolino, E.; Di Mola, I.; Ottaiano, L.; Bilotto, M.; Petriccione, M.; Ferrara, E.; Mori, M.; Morra, L. Assessing yield and quality of melon (Cucumis melo L.) improved by biodegradable mulching film. Plants 2023, 12, 219. [Google Scholar] [CrossRef] [PubMed]
- Pang, C.; Yu, J.; Zhang, L.; Tang, M.; Liu, H.; Cai, Y.; Chen, F.; Zhang, J. BnaC03.BIN2 regulates plant height by affecting the main inflorescence length and first effective branch height in Brassica napus L. Crop J. 2024, 8, 1102–1111. [Google Scholar] [CrossRef]
- Li, L.; Li, W.; Liu, B.; Liu, Y.; Bai, B.; Cui, F.; Wan, S.; Li, W. Research progress on the formation of plant branches and the main factors affecting branch number. J. Plant Genet. Resour. 2024, 10, 11. [Google Scholar]
- Zhang, H.Q.; Zhang, H.; Gao, Q.M.; Yao, J.L.; Wang, Y.R.; Liu, Z.Z. Transcriptome analysis screening key genes regulating apple branching ability. Agric. Sci. China 2024, 57, 1995–2009. [Google Scholar]
- Zhao, X.Y.; Li, S.Q.; Zhang, Z.F.; Zhang, W.; Li, X.; Li, B. Progress in Mapping and Cloning of Genes Related to Branch Number in Rapeseed. Life Sci. 2024. [Google Scholar] [CrossRef]
- Marcos, F.B.; Giacomo, G.; Chiara, V.; Matteo, B.; Federeco, M. Genome-wide transcript expression analysis reveals major chickpea and lentil genes associated with plant branching. Front. Plant Sci. 2024, 15, 1384237. [Google Scholar]
- Sheng, Q. Functional Analysis of CsBRC Gene. Master’s Thesis, Guizhou University, Guiyang, China, 2024. [Google Scholar]
- Zhan, J.J.; Chu, Y.; Wang, Y.; Diao, Y.; Zhao, Y.; Liu, L.; Wei, X.; Meng, Y.; Li, F.; Ge, X. Functional analysis and mechanism study of GhCUC2 gene regulating cotton plant type. Plant Biotechnol. J. 2021, 19, 1839–1851. [Google Scholar] [CrossRef]
- Dou, J.; Kang, Q.; Li, T.; Umer, M.J.; Alharthi, B.; Liu, D.; Yang, S.; Niu, H.; Ma, C.; Zhu, H.; et al. Construction and application of a new watermelon germplasm with the phenotype of dwarf and branchless. Funct. Integr. Genom. 2023, 23, 310. [Google Scholar] [CrossRef]
- Dou, J.; Yang, H.; Sun, D.; Yang, S.; Sun, S.; Zhao, S.; Lu, X.; Zhu, H.; Liu, D.; Ma, C.; et al. The branchless gene Clbl in watermelon encoding a TERMINAL FLOWER 1 protein regulates the number of lateral branches. Theor. Appl. Genet. 2022, 135, 65–79. [Google Scholar] [CrossRef] [PubMed]
- Ohara, T.; Wako, T.; Kojima, A.; Yoshida, T.; Ishiuchi, D. Breeding of suppressed-branching melon line ‘Melon chukanbohon nou 4′ (‘Melon parental line 4′) and its characteristics. Acta Hortic. 2001, 588, 227–231. [Google Scholar] [CrossRef]
- Zalapa, J.E.; Staub, J.E.; Mccreight, J. Variance component analysis of plant architectural traits and fruit yield in melon. Euphytica 2008, 162, 129–143. [Google Scholar] [CrossRef]
- Qi, Z.Y.; Li, J.X.; Zou, X.X.; Cao, L.W.; Rao, L.L.; Yu, J.L.; Chen, L.P. Genetic analysis of plant type traits in sweet melon. J. Agric. Biotechnol. 2015, 23, 302–310. [Google Scholar]
- Fang, S.; Zhao, J.; Guo, K.; Duan, Y.; Wang, F.; Nie, L.; Zhao, W. Identification of SHORT VEGETATIVE PHASE (SVP)-like genes and necessary responsibility of CmSVPc for the development of lateral branches in melon (Cucumis melo L.). Sci. Hortic. 2023, 312, 111845. [Google Scholar] [CrossRef]
- Borner, R.; Kampmann, G.; Chandler, J.; Gleißner, R.; Wisman, E.; Apel, K.; Melzer, S. A MADS domain gene involved in the transition to flowering in Arabidopsis. Plant J. 2000, 24, 591–599. [Google Scholar] [CrossRef]
- Cheng, Z.; Zhuo, S.; Liu, X.; Che, G.; Wang, Z.; Gu, R.; Shen, J.; Song, W.; Zhou, Z.; Han, D.; et al. The MADS-box gene CsSHP participates in fruit maturation and floral organ development in cucumber. Front. Plant Sci. 2020, 10, 1781. [Google Scholar] [CrossRef]
- Wang, B.; Smith, S.M.; Li, J. Genetic regulation of shoot architecture. Annu. Rev. Plant Biol. 2018, 69, 437–468. [Google Scholar] [CrossRef]
- Meng, L.; Li, H.; Zhang, L.; Wang, J. QTL IciMapping: Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop J. 2015, 3, 269–283. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Wang, Y.; Zhu, W.; Tao, J. Exploration of the Application of SAS Software in the Teaching of “Biostatistics”. Educ. Teach. Forum 2023, 31, 145–148. [Google Scholar]
- Guo, J.; Tang, Y.L.; Lei, L.M.; Xu, D.L. Application of Origin software in microbiology experimental teaching—Taking the measurement experiment of bacterial growth curve as an example. Educ. Teach. Forum 2024, 11, 21–24. [Google Scholar]
- Yu, G.; Long, F.L.; Zhang, Y.; Liu, J.J. Microsatellite data processing of polyploid plants of Bashan bamboo based on R software package (Polysat). For. Surv. Plan. 2023, 48, 33–38. [Google Scholar]
- Wang, X.G. Application of Biological Software in Nucleic Acid Sequence Alignment and Phylogenetic Analysis. Mod. Agric. Technol. 2015, 12, 347–348. [Google Scholar]
- Lescot, M.; Déhais, P.; Thijs, G. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
- Jiang, J.J.; Su, H.D.; Hong, D.F.; Yang, G.Q.; Yan, L.; Xu, Y.; Zhang, Y.; Zhang, L.X.; Han, F.P.; Jin, S.X.; et al. Progress in plant biotechnology research. Plant Physiol. J. 2023, 59, 1436–1462. [Google Scholar]
- Finlayson, S.A. Arabidopsis TEOSINTE BRANCHED1-LIKE 1 regulates axillary bud outgrowth and is homologous to monocot TEOSINTE BRANCHED1. Plant Cell Physiol. 2007, 48, 667–677. [Google Scholar] [CrossRef]
- Barraj Barraj, R.; Segado, P.; Moreno-González, R.; Heredia, A.; Fernández-Muñoz, R.; Domínguez, E. Genome-wide QTL analysis of tomato fruit cuticle deposition and composition. Hortic. Res. 2021, 8, 113. [Google Scholar] [CrossRef]
- Lauss, K.; Keurentjes, J.J. QTL epi Mapping in Arabidopsis thaliana. In Plant Chromatin Dynamics: Methods and Protocols; Bemer, M., Baroux, C., Eds.; Springer: Berlin/Heidelberg, Germany, 2018; pp. 373–394. [Google Scholar]
- Hong, J.E.; Hossain, M.R.; Jung, H.J.; Nou, I.S. QTL associated with Gummy Stem Blight (GSB) resistance in watermelon. BMC Genom. 2022, 23, 632. [Google Scholar] [CrossRef]
- Huang, K.L.; Tian, J.; Wang, H.; Fu, Y.F.; Li, Y.; Zheng, Y.; Li, X.B. Fatty acid export protein BnFAX6 functions in lipid synthesis and axillary bud growth in Brassica napus. Plant Physiol. 2021, 186, 2064–2077. [Google Scholar] [CrossRef]
- Zou, J.; Zhang, S.; Zhang, W.; Li, G.; Chen, Z.; Zhai, W.; Zhao, X.; Pan, X.; Xie, Q.; Zhu, L. The rice HIGH-TILLERING DWARF1 encoding an ortholog of Arabidopsis MAX3 is required for negative regulation of the outgrowth of axillary buds. Plant J. 2006, 48, 687–698. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Wang, R.; Qian, Q.; Yan, M.; Meng, X.; Fu, Z.; Yan, C.; Jiang, B.; Su, Z.; Li, J.; et al. DWARF27, an iron-containing protein required for the biosynthesis of strigolactones, regulates rice tiller bud outgrowth. Plant Cell 2009, 21, 1512–1525. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Wang, K.; Li, Z.; Li, Y.; He, J.; Li, H.; Wang, B.; Xin, T.; Tian, H.; Tian, J.; et al. Architecture design of cucurbit crops for enhanced productivity by a natural allele. Nat. Plants 2022, 8, 1394–1407. [Google Scholar] [CrossRef] [PubMed]
- Dong, F.Y.; Song, J.H.; Zhang, H.D.; Zhang, J.R.; Chen, Y.F.; Zhou, X.; Li, Y. TaSPL6B, a member of the Squamosa promoter binding protein-like family, regulates shoot branching and florescence in Arabidopsis thaliana. BMC Plant Biol. 2024, 1, 708–718. [Google Scholar] [CrossRef]
- Huh, Y.J.; Han, B.H.; Park, S.K.; Lee, S.Y.; Kil, M.J.; Pak, C.H. Inhibition of chrysanthemum axillary buds via transformation with the antisense tomato lateral suppressor gene is season dependent. Hortic. Environ. Biotechnol. 2013, 3, 280–287. [Google Scholar] [CrossRef]
- Xing, W.J.; Ma, Q.L.; Liu, Z.B. Research progress on plant branching development. Mol. Plant Breed. 2024, 5, 06. [Google Scholar]
- Chen, F.Q.; Zhang, H.J.; MA, H.L. Research progress on hormone regulation of plant branching/tillering. Acta Prataculturae Sin. 2024, 33, 212–225. [Google Scholar]
- Chen, L.; Sun, B.; Xu, L.; Liu, W. Wound signaling: The missing link in plant regeneration. Plant Signal. Behav. 2016, 11, 4273–4284. [Google Scholar] [CrossRef]
- Luo, Z.; Janssen, B.J.; Snowden, K.C. The molecular and genetic regulation of shoot branching. Plant Physiol. 2021, 187, 1033–1044. [Google Scholar] [CrossRef]
No. | Marker ID | Chr. | Position | Forward Sequence (5′-3′) Reverse Sequence (5′-3′) | Reverse Sequence (5′-3′) |
---|---|---|---|---|---|
1 | CmSSR09548 | chr03 | 22655225..22656260 | TGGGAGACTAATGGGGCATA | CCACTGTTGATAGTTGGGGT |
2 | CmSSR09556 | chr03 | 22723436..22724495 | AAACCTGAAAACGCCTCCTC | CACAAAAGTCTTATGGAGTCGC |
3 | CmSSR09560 | chr03 | 22806860..22807889 | CAATCCAACAACGAACCTGA | GCTATTTGGCACGTTTGGTT |
4 | CmSSR09580 | chr03 | 22950641..22951664 | GGGAAATGGGGAGATGAGTT | CCATTTTGCTTCTTCGTTGA |
5 | CmSSR09630 | chr03 | 23297772..23298797 | GGGCACTGTCGTCCAACTAT | TCCTGACCCAAAATTCATGC |
6 | CmSSR09645 | chr03 | 23412937..23413966 | GGGTTGACAAGGTTCGAAAA | TGGCTTGACTGAACCCTCTT |
7 | CmSSR09655 | chr03 | 23458868..23459903 | TGATGATGATGGGGGTAGGT | TAACCCTCAAATGCGGAAAC |
8 | CmSSR09665 | chr03 | 23497874..23498909 | CAATCCTGTTTGGGATCTGG | ATCCCATGTGTCTTTGGCTC |
9 | CmSSR09670 | chr03 | 23531657..23532683 | GGGTCATTTTCAAAGGCAAA | ATGCAATGATGGGAAAGGAG |
10 | CmSSR09680 | chr03 | 23560675..23561700 | TTTTGGTGTCCGATGTGAAA | AACGGGGGACTAAACACAGA |
11 | CmSSR09685 | chr03 | 23577030..23578057 | TCAATAGTTTCTTTGGTGATGGAG | TGTAGGGGTTCTGTCTTTTGG |
12 | CmSSR09695 | chr03 | 23681602..23682665 | TACACTCCTTTCCCTTTCGG | ATTGGGGGACGTTCTTCTTT |
13 | CmSSR09765 | chr03 | 24132324..24133368 | TCCATTAAAACCCTACCCCC | ACTCACCACACTCGTCCCTC |
14 | CmSSR09830 | chr03 | 24694523..24695558 | GTCGCAGAATGTGGGATTTT | AATCAAGGCTCATGATTGGC |
15 | CmSSR09855 | chr03 | 24926605..24927638 | ACATGCCGAAGCCCATAA | TTTCCACATTAATGCCTCAGA |
16 | CmSSR09875 | chr03 | 25010469..25011500 | TTTGAGCAAAATGGAAAGGG | GGAAAGGGAGGAGCTCATTT |
No. | Primers | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
---|---|---|---|
1 | MELO3C019871 | AGGCTCGGTACTTCGCTTCA | ACTGGAGATTCACGCCAGAAG |
2 | MELO3C019872 | TCTCGAGGAGGGGTACTTGG | GGAACTTGCTTGTGTGCTGG |
3 | MELO3C019873 | GCGTTCATGAGGCTAGAGGG | GCAGCACAATGGGTCACTTC |
4 | MELO3C019874 | AGACTTCCAATCCAGCGGTC | AACGTCTTTGGGGCCTTCTC |
5 | MELO3C030060 | CTTCCCTCTCCGTCGAACTG | GAGTAGGCACCGACGAGAAC |
6 | MELO3C030061 | AGCATTTGTATGGGCGAGGT | CTCAAACCCACCATTTTGTTCA |
7 | MELO3C030074 | CGTCGTTTCACCATCTGTCC | TTGCGAGCATTTGTATGGGC |
8 | MELO3C030075 | CCAAAAACCTCAAACCCACCA | AGCATTTGTATGGGCGAGGT |
9 | MELO3C030274 | CACACCCTTCCTTGCACCTT | CTAGTTGTTCGTCGGTGGCT |
Treatment | Mean and Standard Deviation | ||
---|---|---|---|
S8 | S7 | F1 | |
no pruning | 3 ± 0.83 | 10 ± 0.81 | 7 ± 0.75 |
single vine pruning | 3 ± 0.54 | 10 ± 0.87 | 7 ± 0.85 |
double vine pruning | 3 ± 0.49 | 9 ± 0.75 | 6 ± 0.69 |
Generation | Mean | Maximum | Minimum | Range |
---|---|---|---|---|
S8 | 3 | 4 | 2 | 2 |
S7 | 7 | 11 | 6 | 4 |
F1 | 4 | 7 | 3 | 2 |
F2 | 4 | 9 | 3 | 6 |
Daqing F2:3 | 4 | 10 | 3 | 7 |
Sanya F2:3 | 5 | 10 | 2 | 8 |
Traits | Chromosome | Start | End | Region (kb) | LOD | Contribution | |
---|---|---|---|---|---|---|---|
BSA sequencing by F2 population | br-2021-3.1 | chr03 | 22,690,000 | 25,350,000 | 2.66 | - | - |
br-2021-3.2 | chr03 | 4,270,000 | 4,770,000 | 0.5 | - | - | |
Fine mapping by RILs individuals | bnDQ-2022-3.1 | chr03 | 22,723,436 | 22,807,889 | 85.45 | 11.37 | 0.4911 |
bnSY-2022-3.1 | chr03 | 22,723,436 | 22,807,889 | 85.45 | 10.85 | 45.01 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, L.; Yang, L.; Zhang, F.; Dai, D.; Wang, D.; Sheng, Y. Major QTL Mapping and Candidate Gene Analysis of Branching Number Habits in Cucumis melo. Agronomy 2024, 14, 3012. https://doi.org/10.3390/agronomy14123012
Wang L, Yang L, Zhang F, Dai D, Wang D, Sheng Y. Major QTL Mapping and Candidate Gene Analysis of Branching Number Habits in Cucumis melo. Agronomy. 2024; 14(12):3012. https://doi.org/10.3390/agronomy14123012
Chicago/Turabian StyleWang, Ling, Limin Yang, Fan Zhang, Dongyang Dai, Di Wang, and Yunyan Sheng. 2024. "Major QTL Mapping and Candidate Gene Analysis of Branching Number Habits in Cucumis melo" Agronomy 14, no. 12: 3012. https://doi.org/10.3390/agronomy14123012
APA StyleWang, L., Yang, L., Zhang, F., Dai, D., Wang, D., & Sheng, Y. (2024). Major QTL Mapping and Candidate Gene Analysis of Branching Number Habits in Cucumis melo. Agronomy, 14(12), 3012. https://doi.org/10.3390/agronomy14123012