Genetic and Genomic Pathways to Improved Wheat (Triticum aestivum L.) Yields: A Review

Abstract

Wheat (Triticum aestivum L.) is a fundamental crop essential for both human and animal consumption. Addressing the challenge of enhancing wheat yield involves sophisticated applications of molecular genetics and genomic techniques. This review synthesizes current research identifying and characterizing pivotal genes that impact traits such as grain size, number, and weight, critical factors influencing overall yield. Key genes including TaSPL17, ABP7, TaGNI, TaCKX6, TaGS5, TaDA1, WAPO1, TaRht1, TaTGW-7A, TaGW2, TaGS5-3A, TaSus2-2A, TaSus2-2B, TaSus1-7A, and TaSus1-7B are examined for their roles in these traits. The review also explores genes responsive to environmental changes, which are increasingly significant under current climate variability. Multi-trait regulatory genes and quantitative trait loci (QTLs) that contribute to these traits are discussed, highlighting their dual influences on grain size and yield. Furthermore, the paper underscores the utility of emerging technologies such as CRISPR/Cas9, Case13, and multi-omics approaches. These innovations are instrumental for future discoveries and are poised to revolutionize wheat breeding by enabling precise genetic enhancements. Facing unprecedented challenges from climate change, the identification and utilization of these candidates is crucial. This review aims to be a comprehensive resource for researchers, providing an integrative understanding of complex traits in wheat and proposing new avenues for research and crop improvement strategies.

1. Introduction

Wheat is one of the most critical staple foods globally contributing significantly to both food security and economic prosperity [1]. It is a key source of essential nutrients and caloric intake, particularly in developing countries where food security remains a pressing concern [2]. The wheat industry is a major contributor to economic growth, millions of people’s livelihoods, and various countries agricultural exports. While many factors, such as the climate quality of the soil and the resistance of wheat crops to pests, affect wheat production, one aspect that has recently drawn more attention from scientists is seed size [3]. An exciting opportunity for yield optimization exists because the shape of wheat seeds can have a direct impact on germination rates, seedling vigor, and, ultimately, grain output [4]. Therefore, advancing wheat production methods necessitates a thorough understanding of the intricate genetic and environmental components that control seed size [5]. Beyond aesthetics, it has significant effects on crop output and the sustainability of agriculture. The combination of genetics, molecular biology, and advanced technology has considerably advanced the science of seed size in recent years [6]. We start a thorough investigation of the genetic and molecular factors influencing the development of seed size in wheat within the context of this rapid evolving environment [6]. Despite the fact that research on seed size regulation is by no means new, recent developments in genomics gene editing and molecular biology have added to our current understanding of the issue. The complexity of seed size regulation is revealed by these developments, which are also providing revolutionary techniques for increasing crop output [7].

Our investigation focused on the idea of genetic alterations. Harnessing certain genes related to seed size stands out as a shining example of agricultural innovation at a time when precision breeding methods are transforming agriculture [8]. These genetically altered types, sometimes known as transgenic plants, have the power to alter how wheat is grown. They exhibit enhanced growth vigorous seed development, and, consequently, increased crop production [9]. This strategy represents a paradigm shift and provides a long-term answer to the urgent problem of producing more food with fewer resources.

The purpose of this review is to offer a comprehensive exploration of the genetic and molecular mechanisms that govern seed size development in wheat. The principal purpose of this review is the identification of key genes involved in seed size modulation during the critical phase of embryo development. By doing so, this study aims to shed light on the possibilities of genetically modifying these genes to ultimately enhance grain yield. The principal aim of this review is to synthesize existing knowledge on the key genes and loci such as TaSPL17, ABP7, TaGNI, and TaGW2, among others, that influence grain size and yield in wheat. By delineating the roles and regulatory mechanisms of these genes, this review strives to shed light on their difficulties, including those of multi-trait and environment-responsive genes. Furthermore, the review highlights the significance of (QTLs) for their potential in marker-assisted selection, while also emphasizing emerging technologies such as CRISPR/Cas9, Cas13, and multi-omics as instrumental tools for future discoveries. Positioned against the backdrop of a rapidly changing climate, this review underscores the imperative of identifying and leveraging these genetic determinants for the sustainable improvement of wheat yield and grain size, thereby serving as a comprehensive resource that guides future research and crop enhancement strategies.

1.1. The Challenge of Increasing Global Demand and the Need for Higher Yield

The rapidly increasing global demand for essential cereal crops such as wheat, rice, and maize, in anticipation of the world’s population reaching nearly 10 billion by 2050, underscores a significant challenge for ensuring food security worldwide [10]. These crops, fundamental to the diets of billions, face numerous production hurdles attributable to a range of environmental and socio-economic factors. Climate change manifests as unpredictable weather patterns, prolonged droughts, and increased flooding, and severely impacts the growth cycles and yield stability of these cereals. Additionally, the diminishing availability of arable land, coupled with limited water resources, exacerbates the difficulty of meeting escalating food demands [11].

Pests and diseases further threaten crop yields, with emerging strains often outpacing the development of resistant varieties [12]. Conventional breeding techniques, while historically significant in enhancing crop yields, are now proving inadequate due to these evolving challenges. The need for innovative agricultural strategies is more critical than ever.

To address these complexities, the adoption of advanced technologies such as precision agriculture, which utilizes data analytics and IoT devices (Internet of Things) to optimize planting, watering and harvesting processes, is vital. Genetic engineering also plays a crucial role, offering the potential to develop crop varieties with enhanced resistance to environmental stresses and diseases [13,14]. Furthermore, global yield gap analyses developed specifically for wheat, rice, and maize illustrate a considerable disparity between the current average yields achieved using conventional management practices and the potential yields of well-adapted varieties grown under optimal conditions. These analyses serve as a benchmark for gauging the extent of the improvement needed and the direct strategic efforts towards the sustainable intensification of farming practices [10]. Yield gaps and ensuring the sustainable production of wheat, rice, and maize necessitates a comprehensive approach. This approach should include robust research initiatives to develop resilient crop varieties, informed policy making to safeguard and efficiently use agricultural resources, and substantial investments in modern agricultural technologies. Such a multifaceted strategy will be essential for overcoming the imminent challenges and securing global food security as population demands grow.

1.2. Environmental Factors Influencing Wheat Yield Losses

Wheat production faces significant challenges due to a variety of environmental stresses that can lead to substantial yield losses. Understanding these factors is crucial for developing effective management strategies to sustain and enhance wheat productivity under adverse conditions [15]. Climatic stresses such as drought, heat waves, excessive moisture, and frost each uniquely impair wheat crops. Drought, for example, hinders root development and limits water uptake, reducing photosynthetic activity and impacting grain fill and size. Heat stress disrupts plant metabolism and accelerates senescence, while frost can damage cell structures and impede growth. Additionally, biotic stresses from pests like aphids and diseases such as rust and powdery mildew pose serious threats to crop viability [16]. Soil-related issues including salinity, erosion, and nutrient depletion also play a critical role in determining plant health and productivity. These stresses affect wheat at various physiological levels; for instance, drought leads to stomatal closure, which reduces carbon dioxide intake and limits photosynthesis directly reducing yield. Similarly, heat affects enzyme activities essential for photosynthesis and respiration [17]. To mitigate these effects, various strategies are employed. Breeding programs focus on developing stress-resistant wheat varieties, and modern biotechnological tools like CRISPR/Cas9 offer potential for rapid development of such varieties by directly modifying genes associated with stress responses. Agronomic practices, such as optimized irrigation schemes, use of cover crops, and soil amendments, are also vital in managing the impact of environmental stresses [18].

Future research should aim at identifying more precise genetic markers for stress tolerance, which could enhance marker-assisted selection efficiency. Developing comprehensive pest and soil management strategies, along with predictive analytics for anticipating environmental stress impacts, will also be crucial. This integrated approach will help devise robust management strategies that enhance wheat resilience to environmental stresses, thereby securing yield under varying climatic conditions. Such efforts are essential as climate change continues to pose unprecedented challenges to global wheat production.

2. Biotechnological Approaches in Yield Enhancement

2.1. Genetic Engineering Techniques for Yield Improvement

Recent advancements in genetic engineering have opened new avenues for enhancing wheat yield, a crucial objective given the global demand for this staple crop. Techniques like CRISPR/Cas9 gene editing have revolutionized the approach to wheat improvement, allowing precise modifications in the genome to enhance traits like drought resistance nutrient efficiency and disease resistance, directly contributing to yield enhancement. Additionally, the integration of omics technologies including genomics, transcriptomics, and proteomics has provided deeper insights into the complex wheat genome enabling the identification and modification of yield-related genes. These approaches, coupled with traditional breeding methods offer a synergistic strategy to meet the increasing wheat demand. However, it is imperative to consider the regulatory and ethical aspects of such interventions, ensuring that the genetically modified wheat varieties are safe acceptable and accessible for widespread cultivation.

To understand how genes are regulated under certain circumstances, it is important to understand the molecular mechanisms relating to these aspects. Although hybridization has been used in traditional breeding to boost yield, it has not been as successful as desired. Advances in omics have been made possible by the development of novel biological technologies such as marker-assisted breeding MAB, QTL mapping, mutation breeding, next-generation sequencing NGS, RNA sequencing, transcriptomics, computational resources, and genome editing techniques (CRISPR cas9; Cas13) [19]. The use of modern breeding technology generates enormous amounts of data. The use of modern breeding technologies, including genomic and transcriptomic databases such as GenBank https://www.ncbi.nlm.nih.gov/genbank/, the Wheat Genome Database https://www.wheatgenome.org/, and the Plant Transcriptional Regulatory Map https://plantregmap.gao-lab.org/ (accessed on 24 January 2024) generates enormous amounts of data that require advanced bioinformatics for analysis, and significant progress in the field of bioinformatics is required to analyze the data. However, it is still difficult to use coupled omics to address physiological and genetic problems. Additionally, the discovery of viroids opens new opportunities for research, economics, and target definition [20]. Considering the discovery of genes, genomic loci, and biochemical pathways, connected with increasing wheat yield, is further examined in relation to comparative genomics, which is crucial to determining the gene of interest processes [21]. Furthermore, recent studies have shown that integrated plant omics technologies, including CRISPR and the Cas13a protein system, have been utilized to manipulate viroid genomes. This genetic engineering aims to mitigate viroid interference, which is a significant barrier to increasing wheat yield. Additionally, high-performance multidimensional phenotyping has been applied to further enhance our understanding and optimization of yield-related traits.

2.2. Marker-Assisted Breeding (MAB)

Marker-assisted breeding is one of the most innovative methods for crop improvement, made possible by the development of technology in biological sciences MAB [22]. This method uses molecular markers to identify and select genetic features in plants enabling a more accurate and effective breeding procedure. With MAB, breeders can more precisely insert or stack desired features in crop varieties than they can with traditional breeding techniques that rely on phenotypic data. This focused strategy not only accelerates the breeding process but also increases the chance of creating superior crop types that can meet the changing needs of agriculture and food production. The use of MAB has transformed plant breeding and ensured a sustainable future for world agriculture [23,24].

Wheat yield has been improved by conventional breeding using hybridization techniques. Two genetically different wheat lines are crossed during hybridization to create a hybrid child that possesses the greatest qualities of both parents [25]. This approach aims to capitalize on the heterosis or hybrid vigor phenomenon in which a hybrid outperforms its parental lines in terms of yield and other agronomic characteristics. In the past, hybridization has been a key component of wheat breeding operations, resulting in the creation of high-yielding, disease- and climate-resistant wheat varieties that have significantly improved global food security. This conventional breeding approach has contributed to the development of contemporary agricultural techniques and remains essential for meeting the rising demand for wheat as a staple crop [26,27].

2.3. QTLs Mapping

Quantitative Trait Loci QTL mapping is a crucial method in plant genetics, particularly in wheat, for identifying regions on chromosomes associated with complex traits like yield, disease resistance, and drought tolerance [28]. The process begins with phenotyping, where traits of interest are measured across a population, followed by genotyping, where the population is screened using molecular markers distributed throughout the genome [29]. A mapping population derived from two parental lines differing in the target traits is essential for QTL mapping. This population could be in the form of F2, backcross, recombinant inbred lines (RILs), or doubled haploids (DHs) [30]. The construction of genetic linkage maps using genotyping data lays the foundation for QTL mapping by showing the relative positions of molecular markers on chromosomes. Subsequent statistical analyses associate phenotypic variation with genotypic variation at marker intervals to estimate QTL positions and their effects on traits. This allows for the localization of QTLs within certain genomic regions, providing insights into the genetic basis of complex traits [31].

QTL mapping is significant for wheat breeding as it aids in the identification of genetic factors underlying important agronomic traits. It facilitates marker-assisted selection MAS, enabling breeders to select individuals based on markers linked to desirable QTLs and, thereby, accelerating the breeding process [32]. Furthermore, understanding the genetic architecture of traits through QTL mapping can inform gene cloning and functional genomics efforts, potentially leading to the manipulation of genes for trait improvement [33]. However, the resolution of QTL mapping, which often results in broad confidence intervals for QTL localization, can be a limitation making it challenging to identify the exact genes responsible for trait variation. This challenge is being addressed through complementary advances in genomics, such as genome-wide association studies GWAS and genomic selection, which offer higher resolution and efficiency in dissecting complex traits [34].

2.4. Next-Generation Sequencing (NGS)

A significant development in genomic research is NGS, which has increased the capacity to quickly and accurately decode and study whole genomes. NGS technologies enable the simultaneous sequencing of millions of DNA or RNA fragments, in contrast to traditional Sanger sequencing, making them an essential tool for a variety of applications from whole-genome sequencing to specific gene research [35]. NGS has democratized genomic research by significantly lowering the cost and time required for sequencing. This has enabled large-scale comparative analyses and detection of genetic variants and thorough insights into the intricate workings of biological systems. A new age of discovery and understanding has been ushered in by the revolutionary nature of NGS, which has changed the fields of genetics, genomics, and molecular biology [36].

NGS technology has been used in agriculture to decode the genomes of important crops such as wheat, a staple food for a sizeable section of the world’s population. Researchers have discovered important genes and regulatory networks linked to productivity, stress resistance, and other agronomic traits by deciphering the complex genomic architecture of wheat [37]. Breeders may now expedite the development of high-yielding wheat varieties that are adaptable to changing environmental conditions through marker-assisted selection, genome-wide association studies, and genomic selection made possible by NGS data [22,38]. Furthermore, these advanced sequencing tools allow for the early detection of genetic markers related to yield, facilitating quicker and more efficient breeding cycles.

2.5. CRISPR Cas9; Cas13

The clustered regularly interspaced short palindromic repeats (CRISPR) system, which was first discovered to be a component of bacterial adaptive immune defenses, has been transformed into a revolutionary genome editing technique. The CRISPR-Cas9 tool, which is the most well-known part of this system and is a versatile instrument that enables precise DNA modifications in living organisms, is the most famous component [39]. Its success in introducing specific genetic alterations has transformed genetics, medicine, and biotechnology. The Cas13 protein targets RNA with high specificity, complementing Cas9’s DNA-targeting abilities and providing a wider range of uses, such as RNA editing and manipulation as well as viral RNA detection [40]. Together, CRISPR-Cas9 and Cas13 exemplify the tremendous potential and flexibility of CRISPR systems, reshaping the paradigms of genomic research and therapeutic development [41]. CRISPR-Cas13 has specificity for RNA sequences, whereas CRISPR-Cas9 targets DNA sequences for precision editing. The use of CRISPR technology in agricultural settings, particularly those of wheat, offers intriguing opportunities for crop development [42].

Wheat yields may increase as a result of the effective targeting and modification of genes encoding several agronomic parameters using CRISPR-Cas9. It is possible to improve seed size or overall grain output in wheat by altering genes involved in hormone cascades, seed development, or stress responses [43]. Furthermore, with the RNA-targeting potential of Cas13, post-transcriptional modifications can be realized, offering another layer of gene regulation that might influence seed development and grain yield [44].

However, it is crucial to note that while these technologies hold promise, they are not without challenges. Regulatory considerations, off-target effects, and the complexity of polyploid wheat genomes can pose obstacles to straightforward applications. However, with continuous advancements CRISPR, tools such as Cas9 and Cas13 can be integral in shaping the future of wheat breeding for enhanced yield and other desired agronomic traits. This study highlights the evolution of wheat breeding, from traditional methods to advanced genomic techniques, as outlined in Figure 1, demonstrating a targeted shift towards developing high-yield wheat varieties. The integration of CRISPR/Cas9 and other genomic tools has revolutionized breeding strategies, enabling precise genetic modifications to enhance yield traits effectively. Despite the complexities associated with these technologies, their application promises significant advancements in agricultural productivity and food security. As these methods continue to evolve, they hold the potential to meet global food demands sustainably.

2.6. Integration of Omics Approaches for Yield Enhancement

The integration of omics approaches, including genomics, transcriptomics, proteomics, and metabolomics, holds tremendous potential for enhancing wheat yield. By combining these advanced technologies and analyzing the resulting data, researchers can gain comprehensive insights into the molecular mechanisms governing yield determination. Omics suggests several key benefits and opportunities for yield enhancement. First, it enables the identification of key genes and regulatory networks associated with yield-related traits [45]. Through genomics and transcriptomics, researchers can identify candidate genes and genetic markers linked to important yield components such as grain size, grain number, and biomass accumulation [46]. Understanding the regulatory networks and molecular pathways that control these traits provides a foundation for targeted genetic manipulation and breeding strategies [47].

Second omics approaches contribute to unraveling the genetic basis of yield components. By analyzing the expression patterns of genes and proteins associated with yield, researchers can gain insights into the underlying mechanisms that control these traits. This knowledge facilitates an understanding of the genetic architecture of yield and aids in the selection of superior genotypes with desirable combinations of traits for improved yield potential [20]. Another advantage of integrating omics approaches is the accelerated discovery and use of molecular markers. Omics data provide valuable information on the genetic variation underlying yield-related traits [45]. This information can be used to develop molecular markers linked to these traits enabling marker-assisted selection MAS in breeding programs. MAS allows breeders to select individuals with desired trait combinations at an early stage, thereby reducing the time and resources required for traditional phenotypic selection [48].

Moreover, omics approaches offer insights into gene-environment interactions and their influence on yield. By integrating omics data with environmental data, researchers can identify genes and pathways that respond to specific environmental cues such as drought, heat, or nutrient availability [20]. This knowledge will allow breeders to develop wheat varieties with improved adaptability to different growing conditions and stress tolerance, ultimately enhancing yield stability. Metabolomics, a branch of omics, provides information on metabolic profiles and pathways associated with yield-related traits. By profiling metabolites in high-yielding wheat lines or under different environmental conditions, researchers can identify key metabolic pathways and potential targets for manipulation. Coupling metabolomics with other omics tool has enabled researchers to acquire deeper knowledge of molecular events involved in important biological processes required for plant sustainability. Manipulating these pathways through genetic engineering or breeding strategies can lead to improved nutrient utilization, energy efficiency, and resource allocation, thereby increasing yield potential [49].

In

Table 1. Impact of Omics Technologies on Wheat Yield Enhancement.

Omics Type	Key Findings	Contribution to Yield Enhancement	References
Genomics and Transcriptomics	Identification of genes linked to grain size and biomass accumulation.	Enabled the development of wheat varieties with optimized grain size and biomass traits.	[49]
Transcriptomics	Discovery of genetic markers for grain number and size.	Facilitated marker-assisted selection for traits directly influencing yield.	[46]
Proteomics	Analysis of protein expression related to nutrient utilization.	Improved understanding of nutrient metabolism aiding in breeding for better nutrient efficiency.	[47]
Metabolomics and Environmental Genomics	Identified metabolic pathways and gene–environment interactions affecting yield under stress conditions.	Supported the breeding of wheat varieties tailored to specific environmental conditions for enhanced yield stability.	[20]
Metabolomics	Profiling of metabolites in high-yielding lines under various conditions.	Provided targets for genetic manipulation to improve metabolic pathways crucial for yield.	[49]

a selection of studies is presented that illustrates the diverse applications of omics technologies in wheat research. These examples highlight how genomics transcriptomics, proteomics, and metabolomics have each played a role in uncovering the complex biological processes underlying yield traits. By identifying key genes, proteins, and metabolic pathways, these omics approaches provide valuable insights that enable targeted breeding strategies and genetic manipulations. As such, they are indispensable tools for developing high-yielding wheat varieties that are also resilient to environmental challenges.

Finally, the integration of omics approaches with computational modeling such as systems biology enables the development of predictive models for yield-related processes. These models simulate and predict the effects of genetic and environmental factors on yield, allowing breeders to make informed decisions and optimize breeding strategies. In the forefront of biological research, the expansive ‘Omics’ sciences stand as crucial pillars offering in-depth insights into the intricate mechanisms of life [50]. These interrelated disciplines, which include genomics, epigenomics, transcriptomics, proteomics, and metabolomics, collectively decode the complex layers of biological systems. Their significance is particularly pronounced in plant biology and agriculture, where they provide a deeper understanding of genetic diversity, molecular activities, and the interactions essential for sustaining life. The holistic view offered by these fields is invaluable in comprehending the subtleties of biological functions and the interconnected nature of various biological processes [51,52]. The comprehensive (Figure 2) represents these ‘Omics’ sciences and serves as a testament to their interconnected roles. Beginning with genomics, it illustrates the variations in genetic structure and progresses through the stages of epigenomics, transcriptomics, and proteomics. Each stage represents a different layer of biological information processing, from the transcription of DNA into RNA to the translation of RNA into functional proteins. This journey culminates in metabolomics highlighting the final interactions in plant metabolism such as photosynthesis. Through this integrated approach, the schematic not only elucidates individual ‘Omics’ disciplines but also their collective impact in advancing our understanding of plant biology and agricultural science [53].

In conclusion, the integration of omics approaches offers immense potential for enhancing wheat yield. By combining genomics, transcriptomics, proteomics, and metabolomics, researchers can uncover the genetic basis of yield understand gene-environment interactions, discover metabolic pathways, and develop predictive models. These insights can guide breeding programs towards developing high-yielding wheat varieties with improved traits and stress tolerance. Continued advancements in omics technologies, bioinformatics tools, and collaborative efforts among researchers and breeders are essential to harness the full potential of omics approaches for yield enhancement in wheat.

3. Molecular Perspectives on Wheat Yield

Wheat grain development, a key determinant of grain yield and quality, is governed by a complex interplay of genetic, epigenetic, and environmental factors. This process has been thoroughly studied at both phenotypic and genetic levels. Recent advancements in molecular technologies have enabled detailed characterization of the genes, proteins, and regulatory elements involved in wheat grain development, significantly enriching our understanding of this process. Despite these advancements, the intricate molecular mechanisms of wheat grain development remain less understood compared to diploid species, primarily due to wheat’s allohexaploid nature and its large genome size. A deeper comprehension of how grain development is regulated is essential for enhancing wheat grain yield [54].

Molecular diagnostics has emerged as a pivotal tool in the molecular characterization of wheat. Advanced techniques such as marker-assisted selection and genome sequencing, enable the identification and characterization of allelic variants associated with high-impact genes. This molecular precision facilitates the development of wheat varieties tailored for enhanced yield, disease resistance, and environmental adaptability [19,24]. The molecular characterization of wheat is an interdisciplinary endeavor, intersecting the fields of genetics, biotechnology, and agricultural sciences, with far-reaching implications for global food systems. Molecular diagnostics has become a crucial tool, in this context, to identify and characterize allelic variants linked to these high-impact genes. Researchers can successfully identify the specific allelic variations that lead to improved yield, disease resistance, and other desired features by utilizing cutting-edge molecular approaches, including marker-assisted selection and genome sequencing [22,55].

3.1. Historical Perspective on Wheat Yield Improvements

The classical approaches to improving wheat yield have predominantly relied on selective breeding and hybridization techniques each with distinct advantages and limitations. Selective breeding, one of the oldest methods, involves choosing specific plants with desirable traits for reproduction, thereby enhancing trait prevalence in future generations [56]. This approach is cost-effective and straightforward but is often limited by the genetic diversity available within the crop’s gene pool, potentially leading to a genetic bottleneck. Hybridization, another traditional method, involves crossing two genetically different strains to produce a hybrid that may exhibit superior qualities, a phenomenon known as heterosis or hybrid vigor. While this method can significantly increase yield and introduce new traits, it requires careful selection and can sometimes lead to undesirable traits being expressed due to the mixing of genomes. Both methods have profoundly shaped modern agriculture by improving crop yields and adaptability; however, they often require multiple growing seasons to achieve significant improvements and may not address modern challenges such as climate change and disease resistance as effectively as more contemporary genetic engineering techniques [57].

To manipulate advantageous alleles in molecular breeding programs, the molecular diagnosis of these allelic differences is a priceless resource. This enables the generation of wheat varieties that are optimized for productivity, resilience, and environmental adaptability by enabling breeders to focus on genetic markers connected to better attributes. Therefore, molecular diagnostics play a crucial role in the development of wheat molecular breeding, allowing for a more focused and effective approach to crop improvement [58]. The subject of wheat genetic engineering has undergone a succession of significant improvements since 1992, especially in the area of molecular characterization (Figure 3). With these advancements, scientists have been able to pinpoint and modify the genes responsible for important features such as disease resistance, drought tolerance, and grain yield.

This visual timeline encapsulates the rapid evolution and innovative spirit of wheat genetic engineering, tracing a path from physical gene insertion techniques to sophisticated genome editing tools that promise to revolutionize wheat breeding and production. It underscores a clear trend towards developing wheat varieties that combine improved traits with consumer and environmental considerations at the forefront.

3.2. Determining Genes Involved in Different Traits for High Yield

Grain development in wheat is a complex process highly influenced by genetic factors. Understanding the roles of specific genes associated with traits such as grain size, number, and weight is crucial for enhancing wheat yield. Several key genes have been identified and characterized for their impact on these traits, providing valuable insights for targeted breeding programs [5]. Table 1 lists genes that have been identified characterized and cloned for their roles in affecting grain weight, size, and overall yield. This research, informed by genome-wide association studies GWAS, has enhanced our understanding of the genetic foundations of grain yield. GWAS results have facilitated a more comprehensive mapping of genes associated with yield traits, enabling targeted genetic improvements.

The TaSPL17 gene plays a crucial role as a key regulatory component in wheat development. This study accomplishes two significant objectives. Firstly, it develops a comprehensive phenotype-genotype map for 27 spike morphology traits across 306 wheat accessions from around the world. Secondly, it elucidates the mechanism by which TaSPL17 regulates grain number and size in wheat. Additionally, the study delves into the geographical differentiation and breeding selection of TaSPL17 haplotypes, highlighting their potential value in wheat breeding programs. To achieve the first objective, a Genome-Wide Association Study GWAS was conducted using 40 million Single Nucleotide Polymorphisms SNPs. Although a substantial number of wheat GWAS has been previously conducted, many of these studies on complex traits were underpowered owing to the relatively small number of SNPs used (<1 million). This gene predominantly affects the development of the spikelet and floret meristems, which, in turn, positively regulates the size and quantity of grains. In this instance, TaSPL17 serves as a regulatory hub, directing a convoluted interaction between cellular differentiation and growth pathways that eventually results in an increased grain yield per plant [59].

The ABP7 gene is an irreplaceable asset in contemporary agronomic methods by emerging as a significant regulator of yield-related characteristics and overall grain yield in transgenic wheat. This study investigated the role of ABP7, a bHLH transcription factor from maize that is involved in grain development, in regulating grain yield-related traits in transgenic wheat. Transgenic wheat lines overexpressing ABP7 were generated and increased grain number per spike, grain weight per spike, thousand-grain weight, grain length, grain width, and grain yield per plot compared to wild-type WT plants. These studies suggest that ABP7 positively regulates grain yield-related traits and plot-grain yield in transgenic wheat. Consequently, ABP7 can be integrated as a molecular tool into wheat breeding for high grain yield via genetic engineering [60].

QTL, associated with grain weight and number, have been identified throughout the hexaploid wheat genome, leading to the discovery of numerous genes that impact these traits. Genes that have been shown as having these traits, including TaGNI, TaCKX6, TaGS5, TaDA1, WAPO1, and TaRht1, are revealing hitherto unheard-of information about the genetic factors impacting the grain weight and number characterized in wheat. This study seeks to highlight how each of these strategies affects the source or sink tissue and makes recommendations for how agronomically preferable alleles of these genes might work best together to improve yield [61]. These genes that control floral architecture and floret fertility also contain the potential for a stable yield improvement. WAPO1 directly impacts the floral architecture, with a higher expression leading to more spikelets and a higher GN; however, this is coupled with a higher rate of floret abortion [62]. GNI directly impacts floret abortions regardless of the environment, with less functional alleles resulting in a larger GN [63,64]. Combining alleles of WAPO1 that promote more spikelets with alleles of GNI that reduce floret abortion may be useful in further enhancing GN. It is still possible for a larger number of grains to have a smaller GW as a result of the source-to-sink relationship, but this decrease can potentially be mitigated by additionally selecting for alleles of genes that directly enhance GW through the promotion of larger pericarp cells at anthesis. The frequency with which crosses between a high GN and high GW cultivar adapted to an area display transgressive segregation [65,66,67] is a good indicator of a strategy to identify the genes that may lead to the most stable yield gai ns. The recommendations for breeding would be to perform such a cross with locally adapted cultivars and to utilize a Genome Wide Association GWAS analysis on the resulting population to identify which genes are associated with the most improvement to GN or GW in the adapted environment [61].

The combination of Specific-Locus Amplified Fragment sequencing (SLAF-seq) and bulk segregant analysis BSA to clone and characterize the TaTGW-7A gene linked to wheat grain weight represents a significant advancement in wheat genomics and breeding. The gene TaTGW-7A, situated on chromosome 7A, plays a pivotal role in determining the thousand grain weight TGW in wheat a key metric of yield. To fully comprehend TaTGW-7A’s sequence structure and allelic variants, researchers can efficiently identify and isolate the genomic area where it occurs using SLAF-seq-BSA technology. This makes it possible to characterize the effects of genes on grain weight in detail, giving us vital knowledge that may be applied immediately to breeding efforts that aim to increase yield. This study adds to the amount of knowledge by clarifying the genetic basis of grain weight via TaTGW-7A, which will help guide targeted genetic interventions to increase wheat output. As a cornerstone for prospective allele stacking techniques with other yield-influencing genes, the described gene not only provides immediate utility for marker-assisted selection but also acts as a foundation [68].

This gene is defined by a complete genome sequence and an open reading frame ORF. Notably, a single nucleotide polymorphism SNP, in its first exon, distinguishes two alleles at the TaTGW-7A locus. This SNP results in a valine-to-alanine amino acid substitution, which correlates with a significant shift from higher to lower TGW. To facilitate the discrimination of these alleles, scientists have developed specialized molecular markers: the Cleaved Amplified Polymorphic Sequence CAPS marker named TGW7A and an Insertion-Deletion (InDel) marker named TG9. These markers distinguish between the higher TGW allele TaTGW-7Aa and the lower TGW allele TaTGW-7Ab. In various studies, a major Quantitative Trait Locus QTL co-segregating with TaTGW-7A was found to explain a considerable portion of the phenotypic variance for TGW ranging from 21.7% to 27.1% in a Recombinant Inbred Line (RIL) population across diverse environments. Further validation in natural populations and Chinese mini-core collections underscored the association of TaTGW-7A with TGW. Quantitative real-time PCR studies revealed that the TaTGW-7Aa allele exhibits higher transcript levels during grain development, highlighting its potential in enhancing TGW. The prevalence of the TaTGW-7Aa allele in a significant majority of Chinese wheat varieties (86.0%) and mini-core collections (65.0%) indicates its favorable selection in breeding programs. The discovery and application of these molecular markers, TGW7A and TG9, therefore, mark a significant advance in wheat breeding, providing a powerful tool for the improvement of TGW [59,68,69].

GW2 is a gene recently identified as a critical factor in determining grain weight in cereal crops presents three homoeologs (TaGW2-A1, -B1 and -D1) in hexaploid common wheat (Triticum aestivum L.). In a comprehensive study involving gene editing mutants, distinct functionalities of the TaGW2 homoeologs were elucidated. Mutants lacking one or more of the TaGW2 homoeologs (specifically, B1, D1, or both) offered valuable insights into their respective roles in wheat grain traits. It was observed that both TaGW2-B1 and -D1 significantly influence thousand-grain weight TGW by affecting grain width and length, with TaGW2-B1 exhibiting a more pronounced effect compared to TaGW2-D1. A notable functional interaction between these homoeologs was also discovered, as evidenced by the TGW increase in double mutants (lacking both B1 and D1) being significantly greater than that in single mutants. Additionally, these homoeologs were found to regulate cell number and size in the outer pericarp of developing grains again with TaGW2-B1 showing greater potency. Beyond these morphological impacts, the TaGW2 homoeologs also play a role in determining grain protein content, which was generally higher in mutants particularly in those lacking two or three homoeologs. This increase in protein content corresponded with improvements in two key wheat end-use quality parameters: flour protein content and gluten strength. These findings illuminate the distinct and additive interactions of TaGW2 homoeologs in controlling both grain weight and protein content traits in common wheat, offering promising avenues for future research and potential applications in wheat crop improvement [70].

According to (Lv et al., 2022) [71], in a previous study, it was found that the grain size differs between Chinese Spring CS and its TaGW2-6A allelic variant (NIL31). In addition, the expression of the key starch biosynthesis enzyme gene TaAGPS differs significantly in the two materials. However, the underlying molecular mechanism associated with the action of TaGW2-6A has not been reported. In the present study, we found that TaGW2-6A-CS interacted with TaAGPS, whereas TaGW2-6A-NIL31 did not interact with it in vitro nor in vivo. Furthermore, we found that the C-terminal LXLX domain (376–424 aa) of TaGW2-6A recognized TaAGPS. However the TaGW2-6A allelic variant lacked this key interaction region due to premature translation termination. We also found that TaGW2-6A-CS can ubiquitinate TaAGPS and degrade it via the 26 S proteasome pathway. In addition, our analysis of the activity of ADP-glucose pyrophosphorylase (AGPase) indicated that the AGPase level in the endosperm cells was lower in CS than NIL31. Cytological observations demonstrated that the average number of starch granules and the average area of starch granules in endosperm cells were lower in CS than in NIL31. The overexpression of TaAGPS positively regulated the seed size in transgenic Arabidopsis. These findings provide novel insights into the molecular mechanism that allows TaGW2-6A-TaAGPS to regulate seed size via the starch synthesis pathway [71].

According to (Hong et al., 2014) [72], a specific TaGW2-RNA interference (RNAi) cassette was developed for this investigation and used to construct the small-grain Chinese bread wheat variety “Shi 4185.” In wheat lines with TaGW2-RNAi transgenics, the transcript levels of TaGW2A, TaGW2B, and TaGW2D were all downregulated at the same time. After being cloned from bread wheat the TaGS5 genes were physically mapped on 3AS and 3DS. The TaGS5-A1 gene’s sixth exon included an SNP according to sequencing data. TaGS5 genes were physically mapped on the 3A and 3D chromosomes in this study and they showed strong correlations with plant height, grain size, TKW, spike length, and internode length below spike. Thus far, research has revealed that nearly every chromosome in bread wheat carries yield-related QTLs such as group 3 [73]. Adding another layer of complexity, “TaGS5-3A” was found, by [74], to be significantly correlated with both a larger grain size and a higher TGW, traits that are indispensable for enhanced grain yield. In this study, we isolated TaGS5 homoeologues in wheat and mapped them on chromosomes 3A, 3B, and 3D. Temporal and spatial expression analysis showed that TaGS5 homoeologues were preferentially expressed in young spikes and developing grains.

According to (Hou et al., 2014) [75], sucrose synthase catalysis is the first step in the conversion of sucrose to starch, that is, the conversion of sucrose to fructose and UDP-glucose by the wheat sucrose synthase genes (TaSus1 and TaSus2) that are located on chromosomes 7A/7B/7D and 2A/2B/2D, respectively. A total of 1520 wheat accessions were genotyped at the six loci. Two, two, five, and two haplotypes were identified at the TaSus2-2A, TaSus2-2B, TaSus1-7A, and TaSus1-7B loci, respectively. Their main variations were detected within the introns. Significant differences between the haplotypes correlated with TKW differences among 348 modern Chinese cultivars from the core collection. Frequency changes for favored haplotypes showed gradual increases in cultivars released since beginning of the last century in China, Europe, and North America. Geographic distributions and time changes of favored haplotypes were characterized in six major wheat production regions worldwide. Strong selection bottlenecks to haplotype variations occurred at polyploidization and domestication and during breeding of wheat. Genetic-effect differences between haplotypes at the same locus influence the selection time and intensity. This work shows that the endosperm starch synthesis pathway is a major target of indirect selection in global wheat breeding for higher yield [75].

The sucrose and starch metabolic pathways of wheat have a substantial impact on grain production and are important biochemical factors in grain growth and maturation (Figure 4). Starch content, which makes up approximately 70% of the grain endosperm, is a major determinant of TGW [76]. The mobilization and allocation of carbon resources within the plant are governed by sugar metabolism, which has a direct impact on nutrient density in the grain [77]. Concurrently, the ultimate grain weight and size, which are important yield-related metrics, are greatly influenced by starch metabolism and enzymatic regulation [78]. To maximize wheat grain output, these metabolic pathways can be modified using genetic engineering or selective breeding. Researchers can create wheat strains with improved yield characteristics by understanding and subsequently changing the enzymes and genes involved in sucrose and starch metabolism [79]. Hence, the molecular understanding and manipulation of sucrose and starch metabolism are crucial avenues for yield improvement in wheat cultivation.

Moreover, studies have highlighted several key genetic targets that can significantly enhance grain yield and size in wheat, offering promising strategies for breeding programs focused on increasing agricultural productivity. The identification of beneficial alleles that impact grain weight and number is crucial, as these traits are directly linked to yield improvements. Additionally, investigations into the regulation of thousand grain weight and overall grain size have shown that genetic interventions can effectively boost these parameters. The primer sequences of each gene are described in

Table 2. Primer Sequences for Key Genes Involved in Wheat Yield Improvement.

Study	Gene	Function of Gene	Primer Sequence (F/R)	Reference
TaSPL17 controlling grain number and size in wheat.	TaSPL17	Grain Number & Size	F: TACGTTACCCTAAGTCTGCGC R: GAGCCCTTCCTTCCCATACC	[59]
ABP7 can be utilized in wheat breeding for grain yield improvement.	ABP7	Grain yield	F: GGTGGGTACCAAGACCTGTGGCAAAC R: TGCGGGACTCTAATCATAAAAACC	[60]
These genes that impact grain weight and number and the most beneficial alleles of those genes with respect to increasing the yield.	TaGNI, TaCKX6, TaGS5, TaDA1, WAPO1, and TaRht1	Grain Weight and Number in Wheat	F: ACAAAATAGGCGCTATAGCTGCTC R: CGGGACAGATGATTTCTAGAGGTT	[61] https://www.mdpi.com/article/10.3390/plants11131772/s1 (accessed on 24 January 2024)
TGW7A can be used for improvement of TGW in breeding programs.	TaTGW-7A	Grain Weight	F: AATGATACGGCGACCACCGA R: CAAGCAGAAGACGGCATACG	[68]
This gene increase, thousand-grain weight, and grain size in wheat.	TaGW2	Grain Size	F: AGA GCA ATT TGT AAG TCT TAT TCC R: GCT TCA ATG ACT TTC TGT TCT TCC	[72]
TaGS5 gene revealed its association with kernel weight in Chinese bread wheat.	TaGS5	Grain Weight	F: CAAGCCACTCACTCTCACAT R: GATCAGCGCTATCCCTTCTG	[73]
TaGS5-3A is a positive regulator of grain size in wheat.	TaGS5-3A	Larger grain size	F: TGTCAATGGGATGTTGCCTG R: TCATCGGTGTGTAGGAAGCTG	[74]
Study of these genes shows that the endosperm starch synthesis pathway is a major target of indirect selection in global wheat breeding for higher yield.	TaSus2-2A, TaSus2-2B, TaSus1-7A, and TaSus1-7B	Thousand-grain weight (TGW)	F: ATGGCTGCCAAGCTGACTCG R: CACACCGGTCAGGGTCATCA	[75]

. These findings provide essential insights for breeding strategies aiming to optimize yield in wheat [59,60,61,68].

3.3. Molecular Mechanisms behind Wheat Yield Modulation

The molecular mechanisms behind wheat yield primarily involve genetic factors and hormonal regulation and environmental interactions [80]. Key genetic factors include genes controlling flowering time, plant height, and grain size. However, hormonal regulation, especially by gibberellins and auxins, plays a crucial role in determining the grain size and number [81,82], and understanding and manipulating these mechanisms can lead to improved wheat varieties with enhanced yield potential.

The molecular mechanisms that determine grain size and weight in major cereal crops such as maize, rice, wheat, sorghum, and barley. These insights are pivotal for enhancing crop yields, a crucial factor in global food security. At the outset, the paper emphasizes the critical role of seed development, focusing on the endosperm, which is composed of starch and protein-storing cells, the basal endosperm transfer layer, and the aleurone layer. The development and structure of the endosperm are key in determining the final grain size and weight, highlighting the significance of the early stages of cereal crop development [83]. The study meticulously dissects 17 key molecular pathways that regulate grain size and weight. Notably, the ubiquitin-proteasome pathway is identified as a major contributor across various cereal crops influencing grain size and weight through ubiquitin-mediated proteasomal degradation. Genes like GW2 and their orthologs are integral to this pathway. Additionally, the G-protein signaling pathway, especially in rice involving genes such as OsD1/RGA1, OsRGB1, and OsGS3, is shown to significantly influence grain size and weight. The paper also delves into the Mitogen-Activated Protein Kinase MAPK signaling pathway in rice and maize, revealing a complex network of kinases and transcription factors that are essential for grain size regulation [84].

The roles of phytohormones including auxin, cytokinin, ethylene, and gibberellins are thoroughly examined for their intricate roles in grain development. Auxin transport and signaling particularly through genes like OsTSG1 in rice are crucial for seed development and maturation. Cytokinin signaling, mediated by enzymes such as IPT and CKX, plays a significant role in determining grain size and weight. Similarly, the ethylene pathway impacts grain size through genes regulating its levels and signaling, while gibberellins synthesized by a GA-GID1-DELLA trimer are also influential in this context [32]. Transcription factors and post-transcriptional regulation are highlighted as key elements in controlling grain size and weight. Various transcription factors, including bHLH, bZIP, MADS-box, NAC, and NF-Y, are involved in complex regulatory networks and pathways. Additionally, the role of microRNAs, such as OsmiR156 in rice is underscored for their significance in grain yield-related signaling [85].

The study sheds light on the importance of plant-specific pentatricopeptide repeat proteins particularly in maize, RNA editing, and seed development. Moreover, the balance of photosynthetic product transportation and accumulation with genes like OsSWEET4 and OsBT1 in rice is critical for regulating grain weight [86]. Environmental factors like heat, drought. and water logging, and their influence on grain size and weight, are acknowledged, underlining the need for developing stress-tolerant varieties. The paper also discusses advanced biotechnological strategies such as QTL mapping and GWAS, which have been instrumental in identifying genetic loci related to grain size and weight particularly in maize [86]. As part of an overview of the molecular mechanisms influencing grain size and weight in cereal crops, the insights gained from this study are invaluable for guiding future breeding programs and biotechnological interventions aiming to enhance grain yield and quality and, thereby, contributing significantly to the resilience and productivity of agricultural systems globally.

Figure 5, based on an extensive bibliometric analysis, displays the molecular mechanisms governing grain size and weight in wheat and other cereal crops that are crucial for improving yield. This study has identified relevant molecular mechanisms from the literature. Through this analysis, a comprehensive overview of 17 key pathways was obtained encompassing 13 previously identified and four newly discovered unknown pathways involved in grain size and weight control.

3.4. Role of Hormone Signaling Genes

Hormone signaling pathways play a pivotal role in controlling seed size in wheat, mediated by intricate interactions between different hormonal pathways. Wheat seed size is regulated by genes associated with auxin and gibberellin GA signaling, which are essential for various aspects of plant growth and development [87]. Auxin, a key regulator of cell elongation and division, influences seed development by modulating cell lengthening and expansion. Genes involved in auxin biosynthesis transport and signaling pathways directly impact the variation in seed size [88]. Similarly, gibberellins GAs, which promote seed growth by affecting cell division and elongation, also play a critical role. The genes regulating GA biosynthesis and signaling are directly linked to the control of seed size in wheat. The interaction between auxin and gibberellin signaling pathways is crucial, as these hormones often regulate overlapping sets of genes that contribute to seed development. Crosstalk between these pathways allows for the fine-tuning of growth processes ensuring that the development of the seed is coordinated with other physiological changes in the plant [89].

Furthermore, the complexity of seed size regulation is enhanced by the interaction between these hormone pathways and other signaling mechanisms such as those involving cytokinins and brassinosteroids, which also affect seed growth. Cytokinins have been shown to modulate auxin transport and sensitivity, integrating developmental signals with environmental cues, while brassinosteroids can synergize with gibberellins to promote cell expansion and seed growth. This intricate network of hormonal interactions exemplifies the sophisticated regulatory mechanisms that control seed size, illustrating how multiple hormonal signals are integrated to modulate this important trait.

3.5. Transcription Factors in Seed Development

The expression of genes involved in seed formation is orchestrated by transcription factors TFs, which play a key role in gene control. APETALA2/ethylene-responsive element binding protein (EREBP) family TFs have been discovered as key controllers of wheat seed size. These TFs alter the expression of genes involved in cell growth, which affects the final dimensions of the seed [90]. Additionally, variations in seed size have been linked to members of the MADS-box transcription factor family. These TFs have various functions during fruit and seed development in plants. Recent research has revealed the role of MADS-box transcription factors TFs in the genetic regulation of seed size, illuminating the complex regulatory networks at action [90].

3.6. MicroRNAs in Post-Transcriptional Regulation

Small non-coding RNAs called microRNAs (miRNAs) are involved in the post-transcriptional regulation of genes. They regulate gene expression by attaching to messenger RNAs (mRNAs) and either promoting or preventing translation. Certain miRNAs have been connected to regulate the expression of genes associated with seed size in wheat [91]. For instance, miR164 affects cell division and expansion during seed development by targeting a no apical meristem NAM transcription factor. By controlling the expression of genes involved in growth and development, miR156 and miR529 have been linked to seed size modification. The complex interplay between target genes and miRNAs adds another level of complexity to the genetic control of seed size [92].

3.7. Impact of Epigenetic Modifications on Yield

The impact of epigenetic modifications on wheat yield has emerged as a crucial area of study in plant genetics and crop improvement. Epigenetic changes, which include DNA methylation, histone modifications, and RNA-mediated regulation, play a significant role in modulating gene expression without altering the underlying DNA sequence. These modifications are influenced by various environmental factors and are integral to plant development and stress responses directly affecting yield [93,94]. Recent research has highlighted the potential of manipulating epigenetic marks to enhance desirable traits in wheat such as drought tolerance and disease resistance, thereby indirectly improving yield [50]. For example, studies have shown that alterations in DNA methylation patterns can lead to changes in phenotypic traits associated with yield. Furthermore, the advent of epigenome editing tools like CRISPR/dCas9 offers a novel approach to precisely modify epigenetic states opening new avenues for crop improvement [95]. Understanding and harnessing these epigenetic mechanisms could, thus, provide a powerful strategy to enhance wheat yield addressing the growing global food demand.

In the control of genes associated with seed size, epigenetic alterations like DNA methylation and histone modifications have become important players [96]. These changes may affect how genes are expressed throughout the formation of seeds, resulting in variance in seed size [96]. The variance in seed size may result from these alterations impact on gene expression patterns during seed development [97].

4. Advancements in Wheat Genomics

4.1. Achievements in Wheat Improvement through Genetic and Genomic Pathways

In the pursuit of advancing wheat production, the application of genetic and genomic pathways has yielded substantial achievements, demonstrating significant impacts on agricultural practices and crop improvement. Enhanced yield has been a major focus, with genomic selection and marker-assisted selection playing pivotal roles. These techniques have streamlined the breeding process, allowing for the rapid development of high-yielding wheat varieties [20]. Additionally, genetic mapping and CRISPR/Cas9 technologies have been instrumental in introducing disease resistance traits into wheat, effectively reducing crop losses and dependency on chemical treatments [21]. Improvements in grain quality have been achieved through gene editing and genomic analysis, which have facilitated the modification of genes related to grain size, gluten content, and nutritional value, thus meeting higher standards of food quality and safety [98]. Stress tolerance has also been enhanced through the use of genetic mapping and omics technologies, enabling the breeding of wheat strains that are resilient to abiotic stresses such as extreme temperatures and salinity [15].

Resource use efficiency has been another significant achievement, with genomic selection and physiological genomics contributing to the development of wheat varieties that utilize water and nutrients more efficiently. This advancement supports sustainable agriculture in resource-limited settings [79]. Moreover, the custom development of wheat varieties suited to specific environmental conditions has been facilitated by genomic information and association mapping, as evidenced by projects like the International Wheat Genome Sequencing Consortium (IWGSC). This approach has allowed breeders to tailor wheat varieties to local climates and soil types, enhancing both farming success and sustainability. These achievements highlight the transformative impact of genetic and genomic technologies in wheat breeding, offering new avenues for enhancing yield, quality, and resilience in wheat crops. As these technologies continue to evolve, they promise to further revolutionize agricultural practices, contributing significantly to global food security and sustainable agriculture (

Table 3. Achievements in Wheat Improvement Through Genetic and Genomic Pathways.

Achievement	Genetic and Genomic Pathways	Description	Impact	References
Enhanced Yield	Genomic Selection, Marker-Assisted Selection	Development of varieties with higher yields through genomic selection and marker-assisted selection.	Increases agricultural productivity and efficiency.	[20]
Disease Resistance	Genetic Mapping, CRISPR/Cas9	Introduction of disease resistance traits using genetic mapping and CRISPR/Cas9.	Reduces crop losses and chemical pesticide use.	[21]
Improved Grain Quality	Gene Editing, Genomic Analysis	Modification of genes related to grain size, gluten content, and nutrition.	Meets higher food quality standards and safety.	[98]
Stress Tolerance	Genetic Mapping, Omics Technologies	Breeding of strains that tolerate abiotic stresses such as drought, salinity, and extreme temperatures.	Enhances resilience to climate change.	[15]
Resource Use Efficiency	Genomic Selection, Physiological Genomics	Development of varieties that use water and nutrients more efficiently.	Improves sustainability in resource-limited settings.	[79]
Tailored Wheat Varieties	Genomic Information, Association Mapping	Custom development of varieties suited to specific climates and soil types using genomic information.	Enhances local farming success and sustainability.	International Wheat Genome Sequencing Consortium (IWGSC). https://www.wheatgenome.org/ (accessed on 24 January 2024)

).

4.2. Genomic Selection and Its Impact on Breeding Programs

Genomic selection GS has substantially transformed wheat breeding programs, marking a pivotal shift in crop improvement strategies. This approach integrates modern genomics with traditional breeding techniques, leveraging the vast array of genomic data now available for wheat. GS relies on the use of molecular markers spread across the genome, enabling breeders to estimate the breeding value of a plant based on its genetic character [99]. This is a significant departure from conventional selection methods which primarily depend on phenotypic observations. The impact of GS on wheat breeding is profound in several ways. Firstly, it accelerates the breeding process. Traditional breeding methods require multiple growing seasons to observe and select desirable traits. In contrast, GS can predict these traits in early-stage plants, significantly shortening the breeding cycle. This rapid turnaround is crucial in responding to urgent agricultural challenges such as evolving pest pressures or sudden climatic changes. Moreover, GS enhances the precision of selection. While traditional breeding often involves a degree of guesswork and is influenced by environmental factors, genomic selection is more direct and accurate. It allows breeders to target specific traits with a high degree of confidence [100]. Genomic selection (GS) has revolutionized wheat breeding programs, offering a swift and efficient method to enhance crop traits such as yield and grain quality. This technique integrates modern genomics with traditional breeding by using molecular markers spread across the genome to predict the breeding value of plants early in their development [101]. For example, GS has been instrumental in developing wheat varieties specifically designed for improved grain development and yield. A prominent example includes the development of wheat varieties that have shown significant improvements in grain size and weight, enabling farmers to achieve higher yields per acre without the need for additional agricultural inputs. This application of GS not only accelerates the breeding process but also ensures that new varieties meet the specific yield-enhancement goals of modern agriculture [102]. Another significant benefit of GS in wheat breeding is its ability to handle complex traits. Traits like yield and stress resistance are influenced by multiple genes and environmental interactions. GS can capture these polygenic traits more effectively than traditional methods. By evaluating the cumulative effect of numerous small-effect genes GS provides a more holistic and robust prediction of a plant’s performance [103].

Furthermore, GS has facilitated the development of wheat varieties better suited to specific environments or agricultural practices. This customization is increasingly important as farming systems diversify and as climate change alters growing conditions. GS allows breeders to develop varieties that are not only high yielding but also resilient to specific local challenges such as salinity or heat stress. Genomic selection represents a significant advancement in wheat breeding. It brings speed, precision, and a higher degree of customization to the development of new wheat varieties. As genomic technologies continue to evolve, the potential for further enhancing wheat breeding programs is substantial, promising to contribute significantly to global food security and sustainable agriculture.

4.3. Role of Bioinformatics in Wheat Genomics Research

In wheat genomics research, bioinformatics plays a crucial and multifaceted role, essential for deciphering the complex genetic makeup of this vital crop. The wheat genome, characterized by its large size, high polyploidy, and abundance of repetitive sequences, poses significant challenges that bioinformatics tools adeptly address. These tools enable the sequencing, assembly, and annotation of the wheat genome a foundational step for all subsequent genomic studies. Comparative genomics, facilitated by bioinformatics, allows researchers to compare the wheat genome with those of other species, aiding in gene annotation and revealing evolutionary insights. This comparative approach is particularly useful in identifying genes linked to key agricultural traits like yield [51]. Bioinformatics has become indispensable in managing the vast data generated by wheat genomic projects. Its role extends from the sequencing and assembly of the wheat genome to more complex analyses such as comparative genomics [104]. For example, bioinformatics tools were crucial in the sequencing of the wheat genome, which identified over 108,000 genes, and facilitated comparative studies with other cereals to uncover genes linked to yield improvements. This has enabled targeted genetic enhancements, such as improving gluten strength for better bread-making quality [51]. Bioinformatics is also instrumental in transcriptome analysis where RNA sequencing data is analyzed to understand gene expression patterns in different tissues and under various environmental conditions. This is crucial for unraveling the molecular basis of wheat growth, development, and adaptation. Furthermore, bioinformatics integrates data from proteomics and metabolomics studies, enhancing our understanding of the complex interactions between genetic information, protein synthesis, and metabolic pathways [105].

A pivotal application of bioinformatics in wheat research is in genomic selection, a technique that has revolutionized wheat breeding [106]. Here, bioinformatics tools are used to predict the breeding value of plants based on genomic data, Bioinformatics tools, leveraging data from comprehensive genomic databases such as the Wheat Genomes database http://www.wheatgenome.info,andPlantGDB, https://ngdc.cncb.ac.cn/databasecommons/database/id/1433 (accessed on 12 February 2024) are used to predict the breeding value of plants based on genomic data, enabling breeders to select plants with desirable traits more efficiently and rapidly than traditional methods. Additionally, bioinformatics is essential for the management and sharing of the vast amount of data generated in wheat genomics research, ensuring that this valuable information is accessible and utilizable by the global research community. Bioinformatics is not just a support tool but a driving force in wheat genomics research [107]. It provides the computational power and analytical capabilities necessary to navigate the complexity of the wheat genome, leading to advancements in our understanding of wheat biology and the development of improved wheat varieties. This integration of bioinformatics in plant science is key to addressing the challenges of agriculture and food security in the modern world.

4.4. Genome Sequencing and Association Mapping

The wheat genome has been sequenced owing to recent developments in DNA sequencing technology. The enormous size and complexity of the wheat genome posed difficulties, but multinational partnerships led to the creation of high-quality reference genomes for common wheat and its wild cousins. This pioneering effort has provided scientists with a thorough blueprint of the wheat genome, facilitating the identification of important genes involved in growth [79]. Utilizing the inherent genetic diversity found in several wheat populations, association mapping can identify the genes responsible for features. This strategy entails genotyping a sizable number of wheat accessions and comparing their genetic profiles with their phenotypic features. It can reveal the relationships between genes and growth-related features, offering insightful information about the genetic basis of wheat yield [108].

The synergy between genome sequencing and association mapping is a cornerstone of modern wheat genomics. Sequencing provides the foundational genetic map, essential for any genetic analysis, while association mapping builds on this foundation, pinpointing the specific genetic elements that contribute to key agronomic traits. This powerful combination not only deepens our understanding of wheat genetics but also drives practical applications in breeding [109]. Through marker-assisted selection and genomic selection, breeders can develop improved wheat varieties more efficiently, tailoring them to specific environmental conditions and challenges. This integration of cutting-edge genomics techniques illustrates the dynamic and evolving nature of agricultural science, highlighting its critical role in addressing global food security challenges in an era of rapid environmental change [110]. For example, this technique enabled the pinpointing of markers associated with increased grain size and enhanced photosynthetic efficiency, traits that directly contribute to higher wheat yields. This application of genomic insights has significantly accelerated the development of wheat varieties optimized for greater productivity, directly addressing the global demand for increased agricultural output without expanding farmland [111].

4.5. Functional Genomics and Gene Expression Profiling

Transcriptomics, proteomics, and metabolomics are examples of functional genomic methodologies that provide a deeper understanding of gene function and control. During different stages of wheat development, researchers can examine protein profiles, metabolite levels, and patterns of gene expression using data from functional genomics databases like WheatExp https://wheat.pw.usda.gov/WheatExp/ and WheatOmics 1.0, http://202.194.139.32/, https://www.france-genomique.org/projet/wheatomics/?lang=en (accessed on 16 January 2024) researchers can examine protein profiles, metabolite levels, and gene expression patterns. These data can be used to discover genes that actively influence wheat yield by comparing them to variables related to growth [98]. For example, the use of RNA-Seq technology has enabled scientists to meticulously track gene expression changes throughout the stages of grain growth facilitating the discovery of genes directly linked to grain size and weight. These genes are now prime targets for genetic engineering aimed at enhancing wheat yield. Similarly, proteomics has provided valuable insights into protein dynamics during grain development, helping breeders to understand and manipulate protein profiles that influence grain quality and yield. This detailed molecular knowledge is instrumental in developing wheat varieties with optimized grain characteristics, significantly boosting agricultural productivity [112].

Functional genomics and gene expression profiling are intimately connected fields that play a pivotal role in understanding the complex biological processes within organisms. Functional genomics focuses on elucidating the roles and interactions of various genes and proteins in a given organism, providing a comprehensive view of the genetic basis of its biological functions and traits. This field leverages a range of high-throughput techniques, including DNA sequencing, RNA sequencing (RNA-Seq), and proteomics, to study genes and their functions at a genome-wide level. The goal is to move beyond merely identifying genes, to understanding their functions, interactions, and regulatory mechanisms [113,114]. Gene expression profiling is a critical component of functional genomics, offering insights into how genes are regulated and expressed under various conditions. It involves measuring the expression levels of a large number of genes simultaneously, typically using techniques like microarrays or RNA-Seq. This profiling provides a snapshot of the active biological processes within a cell or organism at a given time, revealing which genes are turned on or off in different tissues, during various developmental stages, or in response to environmental stimuli [115].

One of the key applications of functional genomics and gene expression profiling is in the study of complex diseases and traits. By analyzing gene expression patterns, researchers can identify genes and pathways that are involved in disease processes or contribute to specific traits. This information is invaluable for understanding the underlying mechanisms of these conditions and for identifying potential targets for therapeutic intervention. In agriculture, these techniques have revolutionized the way we understand crop biology and breeding. For example, in crops like wheat and rice, functional genomics and gene expression profiling have been used to identify genes associated with desirable traits such as yield, pest resistance, and drought tolerance. This knowledge facilitates the development of improved crop varieties through genetic engineering or marker-assisted breeding [116].

Moreover, functional genomics and gene expression profiling are crucial for understanding the responses of organisms to environmental changes. By studying how gene expression patterns shift in response to factors like temperature, light and water availability, researchers can gain insights into how organisms adapt to their environments. This is particularly relevant in the context of climate change, as understanding these adaptive mechanisms is key to developing strategies for conservation and sustainability. Functional genomics and gene expression profiling represent a powerful synergy in modern biology. They provide a comprehensive view of gene function and regulation, offering invaluable insights into the biological processes underlying health, disease, and development in both humans and plants. As technology continues to advance, these fields will undoubtedly deepen our understanding of the complexities of life and open new avenues for innovation in medicine, agriculture, and biotechnology.

5. Future Prospects and Directions for Yield Improvement

Wheat yield improvement continues to be a dynamic and developing area, with several new opportunities and directions emerging. In this section, we discuss some crucial areas that promise to increase wheat yields in the upcoming years.

According to a thorough examination of genetic factors and technological developments, there are undoubtedly bright futures for increasing wheat output, but they are also complicated and need multifaceted ways to be solved. A comprehensive approach to understanding the complex molecular pathways that control yield is now possible owing to developments in multi-omics technologies that integrate genomes, transcriptomics, proteomics, and metabolomics. Using such a coordinated strategy, scientists will be able to develop thorough models that can forecast yield results under various environmental and genetic circumstances. Revolutionary gene-editing technologies, such as CRISPR/Cas9 and cas13, have also recently emerged. With the help of these techniques, the rate of targeted crop improvement could be accelerated by changing genes and loci linked to yield parameters such as TaSPL17, ABP7, TaGW2, and others.

Through their interactions with important genes, quantitative trait loci (QTLs) increase complexity and opportunity. Deeper knowledge of these interactions, which might be attained by sophisticated epistatic analysis and gene-QTL interaction research, could be beneficial for future breeding operations. Marker-assisted selection is an invaluable tool for breeders, especially when traversing the genetic intricacies present in wheat. The selection procedure can be expedited by exploiting genetic markers linked to high yields and concentrating on genotypes that promise the best results.

It is important to recognize the numerous obstacles that still need to be overcome. There are also trade-offs between yield and other agronomic features that are unavoidable, such as a lack of genetic diversity and genotype-environment interactions. Regulatory challenges and ethical issues must also be considered, particularly those involving gene editing and genetically modified organisms (GMOs). To allow for responsible scientific advancement, these challenges demand a review and, potentially, reform of international regulations.

To overcome these obstacles, a comprehensive interdisciplinary strategy is essential. Collaboration among specialists in genetics, molecular biology, data science, agronomy, and legal studies may result in solutions that are not only scientifically cutting edge but also morally just and legally acceptable. A synergistic fusion of cutting-edge research, moral responsibility, and flexible legal frameworks is needed to navigate the future, even though the future is positive for the improvement of wheat output.

6. Conclusions

In conclusion, this study has thoroughly examined various strategies and methods aimed at enhancing wheat production, highlighting the critical need to increase yield capacity to meet the growing global demand for food. We have provided a comprehensive overview of key genes and loci such as TaSPL17, ABP7, TaGNI, TaGS5, TaDA1, WAPO1, TaRht1, TaTGW-7A, TaGW2, TaGS5-3A, TaSus2-2A, TaSus2-2B, TaSus1-7A, and TaSus1-7B, which play significant roles in controlling traits directly impacting wheat yield. The review underscores the potential of genetic methods, including the use of quantitative trait loci (QTLs), which add a crucial layer of information for understanding and manipulating grain size and production. As we look to the future, breeding programs should prioritize interactions between these QTLs and the identified genes to exploit their synergistic effects fully. The advent of modern technologies such as CRISPR/Cas9, Case13, and multi-omics approaches has revolutionized our approach to studying complex genetic traits. These technologies accelerate the pace of crop improvement by enhancing the speed and precision of genetic interventions. Through marker-assisted selection, breeders can now identify and select desirable genotypes earlier in the breeding cycle, while gene editing provides tools for precise modifications of yield-influencing genes. Despite the advancements, significant challenges remain. The genetic complexity of wheat environmental interactions limited genetic diversity and the balancing of yield with other agronomic traits pose substantial hurdles. Moreover, ethical and regulatory concerns continue to shape the scope and direction of genetic research. Looking forward to it is imperative that continuous research and innovation address these challenges. The integration of omics technologies will be pivotal in deepening our understanding of the molecular dynamics controlling yield. By mapping critical genes regulatory networks and metabolic pathways, these technologies not only illuminate the path to higher yields but also offer insights into creating more resilient crop varieties. The future of wheat yield improvement is promising, driven by a blend of traditional breeding techniques and cutting-edge genetic tools. As we harness the full potential of these advancements, the integration of scientific research’s ethical considerations and practical applications will be crucial in achieving sustainable and substantial improvements in wheat production.