Influence of Bacterial Fertilizers on the Structure of the Rhizospheric Fungal Community of Cereals South of Western Siberia

Abstract

The general lack of knowledge on the conditions of Western Siberia (Omsk region) and the taxonomic diversity of zonal soils determines the relevance of these studies. The research was carried out in order to study the effect of complex biologics on the taxonomic diversity of the fungal component of the microbiome of the rhizosphere of cereals and the phytosanitary condition of crops in the southern forest-steppe (meadow-chernozem soil) and subtaiga (gray forest soil) zones of the Omsk Irtysh region (Western Siberia). This work was carried out in 2022–2023, using laboratory studies in combination with field experiments and metagenomic and statistical analyses. The objects of research were varieties of cereals and grain forage crops of Omsk selection: soil microorganisms. The scheme of the experiment involved the study of the following options: varieties of cereals (factor A): spring soft wheat—Omsk 42, Omsk 44, Tarskaya 12; durum wheat—Omsk coral; barley—Omsk 101; oats—Siberian hercules; bacterial preparation for seed inoculation (factor B) without the drug—Mizorin and Flavobacterin. The sampling of the plant rhizosphere for metagenomic analysis was carried out during the earing phase (July). For the first time, the taxonomic composition of the fungal community was determined based on the analysis of amplicon libraries of fragments of ribosomal operons of ITS2 fungi during colonization of crop roots by nitrogen-fixing bacteria in various soil and climatic zones of the Omsk region. The fungal component of the microbiome was analyzed in two zones of the Omsk region (southern forest-steppe and subtaiga). The five dominant phyla of soil fungi were located in the following decreasing series: Ascomycota (about 70%) > Mortierellomycota (about 7%) > Basidiomycota (about 5%) > Mucoromycota (3%) > Chytridiomycota (1%). The five main genera of fungi inhabiting the rhizosphere of cereals are located in a decreasing row: Giberella (6.9%) > Mortierella (6.6%) > Chaetomium (4.8%) > Cladosporium (3.8%) > Rhizopus (3.3%). The predominantly positive effect of biologics of associative nitrogen fixation on the fungal community of the soil (rhizosphere) of experimental sites located in different soil and climatic zones has been established. During seed bacterization, the growth of saprotrophic fungal genera was noted in relation to the control variants Pseudogymnoascus, Chloridium, Clonostachys, Trihoderma, etc., and the fungicidal properties of bacterial strains introduced into the soil were actively manifested relative to phytopathogenic fungi of the genera Alternaria, Blumeria, Fusarium, etc. According to the results of determining the number of infectious structures of Rhizoctonia solani, it was found that the population of the soil with viable cells of this pathogen was 1–3 pcs/g (below the threshold of harmfulness, PV 20 pcs/g of soil), which indicates a favorable phytosanitary situation with respect to the pathogen. The fungicidal effect of the applied bacterial fertilizers on Rhizoctonia solani could not be detected. The number of Bipolaris sorokiniana varied depending on the drug used. In the conditions of the southern forest-steppe zone of the Omsk region (meadow-chernozem soil), the greatest fungicidal effect was noted in Flavobacterin application variants on wheat of the Omsk 42 variety, durum wheat of the Omsk coral variety, and barley; the decrease in conidia relative to the control was 73, 35, and 29%, respectively. In the subtaiga zone of the Omsk Irtysh region (gray forest soil), as in the southern forest-steppe zone, pre-sowing bacterization of seeds with Flavobacterin led to a decrease in Bipolaris sorokiniana in the rhizosphere of wheat of the Omsk 42 variety by 18%, and oats by 27%, to control. The use of the drug Mizorin in some variants of the experiment led to an insignificant decrease in the harmful fungus or had no effect at all.

1. Introduction

Increasing the yield of grain crops is the main task of agriculture. Since most of the acreage in Russia is located in areas of risky agriculture (obtaining crops is associated with certain risks, which, in turn, are dictated by the climate; in fact, most of Russia can be attributed to this zone—the cold regions of Siberia, the Far East, the and European North), the use of bacterial fertilizers may be one of the main factors in obtaining stable yields [1].

Since the middle of the 20th century and especially during the last 20 years, agriculture in economically developed countries has focused on the development of organic agriculture and the production of environmentally friendly and full-fledged food products, which is based on reducing or completely banning the treatment of plants and soil with synthetic mineral fertilizers, chemical protective agents, and genetically modified organisms [2].

Soil is a heterogeneous substrate with a micromosaic structure [3,4,5]. Representatives of almost all groups of microorganisms are found in it; the main ones are soil fungi and bacteria [6]. Among the mechanisms of the structural and functional organization of biocenoses, the relationships of the organisms that make them up, due to trophic connections and changes in environmental conditions, are of great importance [7]. The processes of synthesis, transformation, and accumulation of organic and mineral substances with the participation of microflora are continuously taking place in soils [8,9].

In the modern scientific literature, there is a large number of works on the use of microbiological fertilizers for cereals and forage crops. The works of Siberian scientists have shown that inoculation of seeds before sowing with preparations of associative nitrogen fixers significantly increases the number of agronomically important groups of microorganisms and also has a positive effect in combination with the use of mineral fertilizers on the total number of rhizospheric microbiota [10,11].

One of the main trends in microbiological research in the XXI century was the active use of high-performance sequencing systems for the analysis of natural microbiomes, which became one of the most promising bioindicators of the ecological state of the environment [12]. Due to the fact that the soil microbial community has an exceptionally high number (up to several billion microorganisms per 1 g of soil) and a very high taxonomic and functional diversity (up to tens of thousands of species per 1 g of soil), this community is extremely responsive to the effects of physical, chemical, biological, and climatic factors manifested in changes in the numbers of individual taxonomic groups. Until very recently, the use of the indicator potential of natural microbiomes was limited to the analysis of their cultured component, which, as it is now clear, makes up no more than 1–5% of the total number of natural microbiomes since most of them are “uncultivated”. However, with the development of high-performance sequencing systems based on sequencing DNA isolated from the environment, the situation has changed radically. Currently, the full range of microbiomes is available for analyzing the dynamics caused by the influence of various factors, including the smallest taxa with a relative number of up to 10⁻⁴–10⁻⁵. In various works using soil DNA analysis, a clear connection has been shown between the taxonomic structure of the soil microbiome and the effects of various natural and anthropogenic factors [13], contamination of 183 soils with petroleum products [14], and natural salinity [15]. In all cases, it has been shown that it is possible to identify microbial taxa that specifically respond to a particular factor and have the character of bioindicators that are promising for qualitative and quantitative analysis of environmental shifts caused by the influence of these factors.

In this paper, the object of the study was shifts in the taxonomic structure of the fungal component of the microbiome of arable soils under the influence of microbiological preparations.

The study of interactions between plants and microorganisms is one of the most relevant and rapidly developing areas of modern biology. These interactions, which play an extremely important role in the life, nutrition of plants, and protection from pathogens and pests, are little studied for agricultural crops in the region, which is their novelty.

The purpose of the work is to analyze the microbial status of the rhizosphere of grain crops in various soil and climatic conditions of Western Siberia, as well as to determine the fungicidal ability of the applied biologics relative to phytopathogens in the soil.

Research objectives: to conduct a metagenomic analysis of the fungal community of the rhizosphere of crops to form a more holistic picture of the effect of the studied agrobiological agents on the soil microbiome; to determine the effect of diazotrophic microorganisms on the phytosanitary condition of the root zone of the soil.

2. Materials and Methods

2.1. Conditions and Scheme of Experiments

In 2023, in field experience in two zones of the Omsk region (southern forest-steppe—experimental site No. 1, and subtaiga—experimental site No. 2), the effect of biologics on microbial cenosis of the rhizosphere of new crop varieties was studied.

The southern forest-steppe zone has a favorable heat supply and insufficient moisture in most years. The annual precipitation is 320–370 mm in the northern half of the zonal agricultural landscape and 300–350 mm in the southern half. During the warm period (above 5 °C), the amount of precipitation is 160–210 mm.

In the conditions of the southern forest-steppe zone, the aridity of the growing season in 2023 was due to the air temperature of 17.8 °C, which is 1 °C higher than normal with a precipitation deficit of 178 mm, or 86% of the annual average with a GTC of 0.80. July was extremely hot at an air temperature of 22.6 °C with an excess of 3.2 °C.

The territory of the subtaiga zone is relatively cool and more humidified. The annual precipitation is more than 420 mm, 320–360 mm falls during the warm period (April–October), and more than 260 mm in the middle of the growing season. Moisture reserves in the soil during all periods of vegetation of crops are sufficient for their favorable growth and development. The growing season of 2023 was generally more favorable, with 115% of the annual average precipitation. The average daily air temperature for the period May–September was 15.5 °C, which is 1.6 °C higher than normal (GTC 1.34).

The scheme of the experiment involved the study of the following options: agriculture (factor A) spring soft wheat—Omsk 42, Omsk 44, Tarskaya 12, durum wheat—Omsk coral, barley—Omsk 101, oats—Siberian hercules; bacterial preparation for seed inoculation (factor B) without the drug, Mizorin, Flavobacterin. Rhizosphere sampling was carried out in the phases of plant development: tillering (June), earing (July), and grain filling (August). The arrangement of options in the experience is systematic.

For seed inoculation, complex-acting preparations manufactured at the All-Russian Research Institute of Agricultural Microbiology (FSBSI ARRIAM, St. Petersburg, Pushkin) were used: Mizorin and Flavobacterin. Mizorin (Arthrobacter mysorens 7) is a bacterial preparation for increasing yields and improving product quality. The application rate is 0.3 kg (L)/hectare. The seed rate is 1.5 kg per 1 ton of seeds. Flavobacterin (Flavobacterium sp. L-30) is a biopesticide, a preparation of nitrogen-fixing bacteria with a fungicidal stimulating effect, recommended for pre-sowing treatment of grain seed material. The application rate is 0.3 kg (L)/hectare. The seed rate is 1.5 kg per 1 ton of seeds.

Inoculation of seeds of all varieties was carried out on the day of sowing at the rate of 600 g per hectare of seeds. The area of one plot is 13.5 m² (15 × 0.9); the predecessor is ripen lying fallow. The repetition of the variants is 4 times. The area under the experiment is 942 m².

The predecessor is pure fallow. The sowing of crops was carried out with the SSFC-7.0 seeder in optimal time with the implementation of a complex of spring field work with the recommended seeding rate. Varieties were included in the State Register of Breeding Achievements with admission in the Western Siberian region.

2.2. Characteristics of Object Research

The study of rhizospheric fungal communities was carried out on varieties of Omsk breeding and in the southern forest-steppe and subtaiga zones of Western Siberia.

The soft wheat of the Omsk 42 variety is medium–late; baking qualities are excellent. Strong wheat. It is characterized by high resistance to drought (in vitro IU = 0.55), brown (IU = 0.05–0.18) and stem (IU = 0.07–0.28) rust, medium to powdery mildew (IU = 0.47–0.59) (limits of the resistance index for three years) [16].

The soft wheat variety Tarskaya 12 is medium–early, with high and stable yields, drought resistance, disease tolerance, lodging resistance, and high grain quality. It is characterized by high resistance to brown rust (IU < 0.35) and medium to powdery mildew and stem rust (IU = 0.47 and 0.46, respectively).

Soft wheat Omsk 44 is medium-ripened; baking qualities are excellent; strong wheat. The main advantages are high and stable yields, high resistance to leaf and smut diseases, and high grain quality. It is resistant to powdery mildew and brown rust. It exhibits high resistance to stem rust (IU < 0.35).

Durum wheat Omsk coral is medium-ripened. The weight of 1000 grains is 36–45 g. The average yield in the Western Siberian region is 29.3 kg/ha. Quality: grain size—786 g/L, vitreous content—61%, protein content—14.32%, and gluten content—27.3%. Macaroni color score: 3.5 points, the best macaroni score is 4.3 points. Moderately resistant to dusty smut and brown rust.

Oats (Siberian Hercules)—medium-ripened, filmy, and coarse. The grain is large, thick-fruited type; the mass of 1000 grains is 36.5–41.1 g. The maximum grain yield of 5.75 t/ha (+0.66 t/ha to the standard) was obtained in the year 2017. Dignities: high grain productivity, resistance to smut pathogens, and excellent grain qualities.

Omsk barley 101 is medium-ripened. The weight of 1000 grains is 44–56 g. The average yield in the Western Siberian region was 37.2 kg/ha. Grain quality: the protein content in the grain, on average, is 14.0%; starch—58.52%; and crude fat—2.11%. It is resistant to lodging. Grain fodder. Moderately resistant to stone smut. It is highly susceptible to helminthosporiosis and root rot.

The soil of the experimental site No. 1 is meadow-chernozem medium-sized, medium-humus heavy loamy with a content of 6.5% humus in the arable (0–20 cm) layer, total nitrogen—0.32%, and water pH—6.5. The content of nitrate nitrogen in the soil is up to 10 mg/kg in the 0–20 cm layer (very low), mobile phosphorus and potassium (according to Chirikov)—120 and 297 mg/kg, respectively (high and very high).

The soil of the experimental site No. 2 is gray forest podzolized, medium-sized loamy. The capacity of the arable horizon is 18–20 cm with a humus content of 2.5–3.0%. The content of mobile phosphorus in the arable horizont is average—120 mg/kg of soil and exchangeable potassium—low; −75 mg/kg of soil. The reaction of the soil solution is slightly acidic (salt pH 5.9–6.0). The research was conducted on the basis of short-term experiments.

2.3. Taxonomic Analysis of the Mushroom Community

The work on establishing the taxonomic diversity of the fungal community was carried out by the department “Genomic Technologies” of the Center for the Collective Use of Scientific Equipment “Genomic Technologies, Proteomics and Cell Biology” of the FSBSI ARRIAM (CCU GTP and CB of the FSBSI ARRIAM). The RIAM protocol was used to isolate the total DNA of fungal biomass from soil samples [17].

The taxonomic analysis of the fungal community was performed using the following ITS3 primers: (5′-3′) GCATCGATGAAGAACGCAGC/ITS4 and (5′-3′) TCCTCCGCTTATTGATATGC. All primers had service sequences containing linkers and barcodes (necessary for sequencing using Illumina technology). PCR was performed in 15 µL of a reaction mixture containing 0.5–1 unit of activity of Q5^® High Fidelity DNA Polymerase (NEB, Ipswich, MA, USA), 5 pcM of direct and reverse primers, 10 ng of DNA matrix, and 2 nM of each dNTP (LifeTechnologies, Delhi, India). The mixture was denatured at 94 °C for 1 min., followed by 35 cycles: 94 °C–30 s, 50 °C–30 s, 72 °C–30 s. The final elongation was carried out at 72 °C for 3 min. PCR products were purified according to the Illumina recommended method using AMPureXP (Beckman Coulter, Brea, CA, USA).

Further preparation of the libraries was carried out in accordance with the instructions of the manufacturer using the MiSeq Reagent Kit Preparation Guide (Illumina, San Diego, CA, USA) (https://support.illumina.com/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf) (accessed on 14 November 2023). The libraries were sequenced in accordance with the manufacturer’s instructions on the Illumina MiSeq device (Illumina, San Diego, CA, USA) using the MiSeq^® ReagentKit v3 reagent kit (600 cycle) with two-way reading (2 × 300 n).

The initial processing of the data obtained, namely, the demultiplexing of samples and the removal of adapters, was carried out using software from Illumina (Illumina, San Diego, CA, USA).

For subsequent “denoising”, combining sequences, removing chimeric readings, restoring the original phylotypes (ASV, Amplicon sequence variant), and further taxonomic classification of the obtained ASVS, the software packages dada2 [18] and phyloseq [19] were used. The work was carried out in the R software environment. The UNITE 2021 database was used for taxonomic analysis [20]. The tools of the QIIME v.2023.7 software package were used to present taxonomic analysis data [21].

Statistical processing was carried out in Microsoft Excel 2016 and Statistica 10.0 programs. The relationship between proline content and yield was evaluated by correlation analysis.

3. Results

3.1. Taxonomic Profile of the Fungal Component of the Microbiome

Fungi are one of the largest groups of eukaryotes that play a key role in the cycle of carbon and other elements in terrestrial ecosystems. Fungi can exist as free-living saprotrophs or interact closely with other organisms, entering into mutualistic relationships or acting as pathogens.

The fungal component of the microbiome was analyzed in two zones of the Omsk region (southern forest-steppe and subtaiga). In total, according to metagenomic analysis, 15 fungal phyla were identified in soil samples of the rhizosphere of wheat and oats selected in experiments. In meadow-chernozem soil—10; in gray forest soil—15.

Soil fungal communities were dominated by Ascomycota with a relative abundance of about 70%, followed by Mortierellomycota (about 7%), Basidiomycota (on average 5%), Mucoromycota (3%) and Chytridiomycota (1%). A significant number were unclassified mushrooms (k__Fungi)—more than 13%. Representatives of the phyla Aphelidiomycota, Basidiobolomycota, Blastocladiomycota, Calcarisporiellomycota, Glomeromycota, Kickxellomycota, Monoblepharomycota, Olpidiomycota, Rozellomycota, and Zoopagomycota accounted for a maximum of 0.1–0.2% (Figure 1).

Fungi of the phylum Ascomycota dominate both the meadow-chernozemic and gray forest soils in all variants of the experiments. The predominance of representatives of the phylum Ascomycota in the fungal component of microbial communities in soils of different types was also revealed by other researchers [22]. One of the reasons for the widespread distribution of fungi in this phylum is due to the fact that their conidia can easily spread by wind [23]. Ascomycota are stress-resistant and highly competitive [24].

Most marsupial fungi are saprotrophs and participate in the decomposition of plant biomass. Some representatives can form symbiotic associations with macro- and microorganisms or be phytopathogens [25].

Comparing the number of marsupial fungi in the samples, it can be noted that, despite significant fluctuations in values among variants and replicates, there are more of them in meadow-chernozem soils (62.1–86.4%) compared to the soil of the experiment conducted in the taiga forest zone on gray forest soil (52.1–87.4%).

The analysis failed to reveal significant differences in the influence of agricultural plants on the number of representatives of this phylum in the meadow-chernozemic soil. In the analysis of gray forest soil, it was found that the abundance of Ascomycota was slightly higher in the wheat rhizosphere compared to the oat rhizosphere. In general, it was not possible to detect any pattern in the effect of biological products on representatives of this phylum. In gray forest soil, the differences in the variants were more pronounced in the rhizosphere of oats, the seeds of which were subjected to pre-sowing treatment with the preparations Mizorin and Flavobacterin; the number of marsupial fungi was higher than in the control without inoculation, and in the rhizosphere of wheat, the picture was the opposite.

Basidiomycota occupied the second place in number in the meadow-chernozem soil based on the analysis of ITS gene sequences and amounted to from 0.9 to 30.2% of the total number at the phylum level. In the gray forest soil, Basidiomycota occupied third place, behind Mortierellomycota, and accounted for 1.1–15.7% (Figure 2 and Figure 3).

Some species of Basidiomycota are plant pathogens. Others form symbiotic associations with the roots of vascular plants, helping the plants absorb nutrients from the soil, primarily phosphorus and potassium, and in return receiving sugars produced through photosynthesis. However, it should be noted that marsupial and basidiomycetes form ectomycorrhizae with trees and shrubs and not with herbaceous plants [26].

At the same time, according to Xiaofang Zhang and others (2023), the relative abundance of Basidiomycota in grassland soils was significantly higher than in forested soils. It is known that Basidiomycota can decompose persistent components of plant litter by secreting lignin-modifying enzymes [27].

The content of Mortierellomycota in the meadow-chernozem soil varied from 1.0 to 12.9%, and in the gray forest soil from 3.2 to 12.9%. In the control variants, the number of representatives of this phylum was on average higher in gray forest soil (3.5% in the oat rhizosphere and 5.4% in the wheat rhizosphere) than in the meadow-chernozem soil, where 8.43% represent Mortierellomycota and occur in the rhizosphere of wheat at 7.5%. It is known that Mortierellomycota mainly live in the rhizosphere [28]. It has been suggested that soils with higher clay content may be more favorable for Mortierellomycota [26].

Among other phyla of fungi, the abundance of Chytridiomycota was also higher in gray forest soils (0.4–7.1%) compared to meadow-chernozem soils (0.1–1.9%). In all variants with inoculation, the number of representatives of this phylum is higher than in the control without the use of biological products. Moreover, this trend occurs both on gray forest soil and on meadow-chernozem soil. The highest values were recorded in variants using Flavobacterin. Based on the results of our analyses, it was not possible to identify any patterns in the influence of agricultural crops on Chytridiomycota.

Mucoromycota, based on the analysis of ITS gene sequences, constituted 0.1 to 5.3% of the fungal component of the microbiome in the meadow-chernozemic soil; in the gray forest soil there were much more (1.0 to 32.7%). Fungi of this phylum were present in all analyzed samples. There were more in the rhizosphere of wheat than in the rhizosphere of oats. On meadow-chernozemic soil, the effect of inoculation on the number of mucor fungi was not significantly manifested. While on gray forest soil there was a tendency towards a decrease in the number of Mucoromycota in the rhizosphere of oats in the variants with the use of Mizorin and Flavobacterin and, conversely, an increase in the number in the rhizosphere of wheat in the variants with biological products.

Aphelidiomycota is a taxon that unites fungi-like organisms, some of which parasitize algae [29,30].

In the studied samples, Aphelidiomycota were identified only in gray forest soil. No patterns of influence of the cultivated crop and the use of bio-preparations Mizorin and Flavobacterin on representatives of the phylum Aphelidiomycota were found when analyzing the data obtained.

Basidiobolomycota was identified in only 1 sample of gray forest soil out of 48 analyzed, and Blastocladiomycota in two samples, also in gray forest soil.

Glomeromycota is a phylum of soil fungi that form mycorrhizae with herbaceous plants. Glomeromycota are obligate symbionts that enter into mutualistic relationships with the roots of more than 80% of terrestrial plant species and can account for up to 50% of the total microbial biomass of the soil [31,32].

At the same time, in our samples, fungi of this taxon accounted for no more than 1%. They were detected less frequently in meadow-chernozem soil than in gray forest soil; interestingly, only in variants with inoculation with biological products. They were detected on meadow-chernozemic soil in the rhizosphere of oats, in the variant with inoculation with Flavobacterin, and in the rhizosphere of wheat, both with the use of Flavobacterin and Mizorin. On gray forest soil, they were present in the oat rhizosphere in almost all variants, both in the control and in the experiment. And in the rhizosphere of wheat, they were found only in variants with the use of biological products: Flavobacterin—in 3 out of 4 samples; Mizorin—in 1 out of 4.

The content of representatives of the phylum Kickxellomycota in the samples of both soils did not exceed 0.8%. However, it should be noted that Kickxellomycota were more often detected in meadow-chernozem soil than in gray forest soil, and in the rhizosphere of wheat more often than in the rhizosphere of oats.

Monoblepharomycota were identified both in meadow-chernozem and gray forest soil; the amount did not exceed 0.4%. Fungi of this taxon were present in both the rhizosphere of oats and wheat, but it should be noted that they were more common in inoculated plants than in control plants. This is especially true for options with Flavobacterin.

Olpidiomycota were identified in most samples of meadow-chernozem soil and in gray forest soil—only in one. Moreover, representatives of this phylum were more often detected in the rhizosphere of wheat. It was in the wheat rhizosphere of the variant without inoculation that the highest values were recorded (1.1–3.8%). It is worth noting that among the representatives of this phylum, many fungi are phytopathogens.

Rozellomycota includes parasites of various hosts—fungi, algae, and protozoa. In the soil of the experiment conducted in the southern forest-steppe zone on meadow-chernozem soil, representatives of this phylum were not identified. In the gray forest soil of the taiga zone, Rozellomycota accounted for 0 to 0.5% in the structure of the fungal microbiome. It was not possible to identify a significant influence of crop (oats, wheat). As for the influence of biological products, there is a tendency to reduce the content of these fungi in variants with inoculation. Especially in samples from the wheat rhizosphere when inoculated with Mizorin.

Most species belonging to the phylum Zoopagomycota are also parasites or predators of microscopic animals, such as amoebas, nematodes, and insect larvae [30]. Zoopagomycota were identified in both soils but were rare in the meadow-chernozem soil, only in 5 out of 48 samples analyzed. At the same time, in gray forest soil, they were found in 13 out of 48 samples, and all these samples were taken from the rhizosphere of oats, while representatives of this phylum were not found in the rhizosphere of wheat.

A significant number of fungi (from 5.0 to 28.9%) in all studied samples were not classified and classified as Fung_unclassifide.

Soil is a favorable environment for the habitat and reproduction of many microorganisms. Its mineral and organic composition and physicochemical state regulate the number and composition of microbial communities, which in turn are characterized by structural, taxonomic, and functional diversity [33,34].

Over the past two decades, the structure and diversity of soil microbial communities and their relationship with external factors have been actively studied using metagenomics. The soil microbiome is sensitive to the influence of various factors, including soil type, changes in weather conditions, and the use of microbial preparations that determine the activity and direction of biological processes in agrocenoses. The state of soil microbial cenosis provides an objective assessment of their impact on agroecosystems. Bacteria and soil fungi play the main role in the transformations occurring in soils; the use of high-throughput sequencing of the 16S rRNA gene makes it possible to expand knowledge about the taxonomic structure of microbiomes of various ecological niches [35,36].

Based on metagenomic soil analysis, the microbiome component (genus) of microscopic fungi in meadow-chernozem and gray forest soil was studied. Their taxonomic structure became the object of study for the first time using metagenomic methods in the conditions of the southern forest-steppe and subtaiga of the Omsk region of Western Siberia.

Phylogenetic analysis of soil fungi based on the analysis of ITS gene sequences identified 19 main genera of cereals inhabiting the rhizosphere: Giberella (6.9%), Mortierella (6.6%), Chaetomium (4.8%), Cladosporium (3.8%), Rhizopus (3.3%), Fusarium (3.1%), Podospora (2.3%), Pseudogyminoascus (2.3%), Alternaria (1.9%), Setophoma (1.9%), Blumeria (1.8%), Myrothecium (1.6%), Trihoderma (1.5%), Clostridium (1.3%), Microdochium (1.2%), Fusicola (1.1%), Clonostachys (1.0%), Peniccilum (0.9%), Bipolaris (0.4%), and unclassified genera (Figure 4).

The Cladosporium microbiome component is characterized by dark-colored mycelium and lives in the soil, mainly on plant debris; there is much of it in the forest litter, which decomposes. Most species are saprotrophs; some are parasites that cause brown spots or cladosporiosis. According to the research results, the total percentage of representatives of the genus Cladosporium was 3.8% in the taxonomic structure of the microbiome of the studied soils. In the rhizosphere of crops on meadow-chernozem soil, a pronounced tendency was observed to reduce representatives of this genus from the control variant of 1.6–21.4% to variants with the use of bacterization of wheat seeds with Flavobacterin of 0.9–10.9%. In the rhizosphere of crops on gray forest soil, the percentage of fungi of the genus Cladosporium was significantly lower and amounted to 0.5–2.8%; biological products had an inhibitory effect on this genus (0.1–1.6%).

At a level of 1.9%, the soils contained the genus Alternaria, associated with wheat grain, and a saprophyte (facultative parasite), often interacting with other soil parasitic fungi, the genus Setophoma. The presence of an association on the control variant of meadow-chernozem soil at 0.8–5.0% is of particular concern since it is capable of producing mycotoxins, toxic secondary metabolites that can accumulate in colonized tissues [37,38]. Flavobacterin showed a fungicidal effect, reducing the number of fungi of this genus to 0.1–1.0% in the rhizosphere of wheat in the southern forest-steppe zone. In the root zone of oats, no significant difference was observed between the experimental variants. A somewhat different situation was observed in the rhizosphere of gray forest soil. In the control variant of the meadow-chernozem soil, there were fewer oats of the genus Alternaria than in the similar variant on the gray forest soil. Inoculation with Mizorin inhibited the growth of representatives of this genus, amounting to 0.1–1.0%, with a control level of 2.0–4.4%. The number of fungi of the studied genus in the wheat rhizosphere remained close to the control (Figure 5 and Figure 6).

Mushrooms p. Setophoma colonize internal plant tissues and form mutualistic associations with their host plant. The main area of their reproduction is vegetable crops. Treatment of seeds with biological preparations affected the endophyte only in the rhizosphere of oats on meadow-chernozem soil; a decrease was noted when inoculated with Flavobacterin. If we compare the research areas, we can state that on the poorer gray forest soil there were significantly fewer representatives of this genus than on the meadow-chernozem soil, which echoes the studies of other authors [39,40,41].

By the nature of relationships with plants, the genus Bipolaris (0.4%) belongs to the facultative parasites. No fungi of this genus were found in the oat rhizosphere in both study areas. It should be noted that a favorable breeding environment for the infectious fungus Bipolaris developed on gray forest soil in the control variant of the wheat rhizosphere (0.3–3.4%). The use of seed bacterization did not improve the phytosanitary situation in the soil; in fertilized varieties, the number of fungi of this genus was at the control level.

Wheat is affected by a wide variety of pathogens, mainly of fungal origin [42,43]. Meanwhile, during the observation period, an increase in the genus g was observed. Blumeria—1.8%, the growth of which leads to the development of powdery mildew. The majority of the studied genus of soil fungi was found on meadow-chernozemic soil in the control variant (1.2–3.9%). The use of Flavobacterin led to a decrease in them to 0.1–0.2%.

The results we obtained show a high content of Pseudogymnoascus—2.3%. In the root layer of meadow-chernozem soil, during bacterization of seeds, the percentage of mycorrhiza-formers on wheat significantly increased when using Flavobacterin (6.5%) in the variant with Mizorin (4.1%) at the control level (0.2%). This may be due to a sufficient amount of organic matter, cellulose, in this soil. No significant changes in the genus Pseudogymnoascus were detected during bacterization of crop seeds in the rhizosphere of gray forest soil [44].

Representatives of the genus Chloridium in general accounted for 1.3% in the rhizosphere of crops. The stimulating effect on a microscopic soil fungus capable of decomposing cellulose was manifested in the conditions of the southern forest-steppe zone in the variant with Flavobaterin inoculation on oats at 1.1–3.2%, wheat at 0.5–5.3%, with a control level of 0.1–0.8%. In the conditions of the subtaiga zone, on gray forest soil, the effects of the drugs could not be established.

With an infectious load of soil (1.0%), Clonostachys manifests itself as an agent of biological control of phytopathogenic fungi and also has a growth-stimulating effect [45]. In the rhizosphere of wheat on meadow-chernozem soil, a stimulating effect of the drug Mizrin (0.6–10.0%), to a lesser extent Flavobacterin (0.4–3.1%), was observed at a control level of 0.3%. No significant changes from the studied biological products were detected on gray forest soil.

It is necessary to note the significant content of the antagonist of phytopathogens Trihoderma—1.5%. A stimulating effect on this fungus was detected in the rhizosphere of oats on meadow-chernozem soil when using Flavobacterin—2.1–5.7%, with a control level of 0.1–1.2%. In addition to its protective properties, Trihoderma has a direct growth-promoting effect on crops [46]. In the rhizosphere of wheat on gray forest soil, a positive effect of the biological product Flavobacterin on the genus under discussion was also observed—0.6–1.9% at a level of 0.1–0.3% in the control version of the experiment. Thus, a redistribution of taxa occurred, and a larger percentage in the rhizosphere community of inoculated plants was occupied by this fungus.

In the composition of the studied rhizosphere mycobiome, Fusarium accounted for 3.1%. They are pathogens and cause diseases of the roots of grain crops (root rot) [47]. On gray forest soil, the fungicidal effect of drugs in wheat crops was established in the Mizorin variant; the variation ranged from 0.9 to 5.8%, Flavobacterin—1.3–3.6, with a control level of 3.3–6.0%. In other variants of the experiment, no significant changes were revealed.

Mycological study of the root zone of wheat and oat plants showed the development of the genus Fusicola (1.1%). A pronounced effect of the use of the bacterial biological product Flavobacterin was detected in the rhizosphere of crops on gray forest soil; the variation of fungi of this genus was 0.3–0.8% on oats (with a control level of 0.9–1.7%) and on wheat at 0.2–0.4% (with a control level of 0.3–1.1%). The more active manifestation of the fungicidal properties of biological products on gray forest soil is due to soil-climatic differences in zones; in the southern forest-steppe, meadow-chernozem soil is richer in organic matter. On control varieties of wheat, the absolute values of representatives of this genus were higher than on oats, which is associated with the presence of root exudates richer in glucose and fructose.

The teleomorphic stage of Fusarium fungi are micromycetes of the genus Gibberella. In the microbiome, its amount was 6.9%. In the rhizosphere of oats on meadow-chernozem soil, the initial abundance varied from 7.1–26.7%. According to experience options, it is significantly reduced. The situation is similar for wheat on gray forest soil. Bacterization of seeds suppresses the activity of the pathogenic fungus.

When studying the taxonomic composition of soils, the invasive genus of micromycetes Penicillum was identified—0.9%. A genus found throughout the world, its species perform an important role as decomposers of organic materials. The percentage of its content in the rhizosphere of wheat in the studied zones is higher than that of oats. This is due to the fact that spring soft wheat has richer root exudates. In the subtaiga zone, on gray forest soil, the stimulating effect of the drugs was established; when treated with Flavobacterin, the variation was 0.9–3.1%, with Mizorin—1.0–2.2%, with a control value of 0.1–0.3%. On meadow-chernozem soil, no significant impact of seed bacteriation was found, which is understandable because initially, the environment is richer and the nutrition of fungi may not depend on biological products [48,49].

The pathogenic fungus Myrothecium mainly reproduces on woody plant debris. In our experience, its amount was 1.6%. In the rhizosphere of crops in the southern forest-steppe zone, its percentage was higher (0.01–11.2%) than in the subtaiga zone (0.01–6.0%). This may be due to the close location of the experimental site to the forest, from where wood particles were released under the influence of an abiotic factor.

A fairly large percentage of saprophytic fungi of the genus Chaetomium was found in the soil of the experimental plots—4.8%. This is due to the fact that rhizodeposits are actively formed when plant roots die and there is a presence of plant litter—a nutrient substrate for them. The stimulating effect of Flavobacterin in wheat crops was established; on meadow-chernozem soil, the percentage of this genus varied from 4.4 to 10.2% with a control level of 2.6–8.1%; on gray forest soil, the change was from 2.8 to 7.8% with a control level of 1.3–3.7%.

The occurrence of saprotrophs of the genus Podospora in the samples was 2.3%. In all variants, there was a tendency for their growth from the control to the variant with inoculation with Flavobacterin. In the rhizosphere of wheat, the percentage of fungi of this genus was higher than that of oats. No significant change in the amount given by inoculation of fungal seeds was detected. This may be due to the fact that during the growth and development of crops, the amount of dead substrate necessary for the development of fungi of the genus Podospora increased, and their growth did not depend on bacterization of seeds [50].

Pink snow mold on grain crops is caused by a facultative parasite of the genus Microdochium [51]. Its percentage in the rhizosphere of grain crops was 1.2%. A significant fungicidal effect of biological products on wheat has been established. On gray forest soil, when using Mizorin, the variation was 0.1–1.7%, Flavobacterin—0.1–1.2% (with a control level of 0.7–2.8%), and on meadow-chernozem soil, the range of variation in the response from Mizorin was 0.2–1.1%, and Flavobacterin 0.1–1.8% (with a control level of 0.3–3.45). On oats in the southern forest-steppe zone on meadow-chernozem soil, the number of fungi of this genus also decreased due to the use of drugs, amounting to 0.6–1.6% in the Mizorin variant and 0.1–0.8% Flavobacterin (control—0.3–3.4%).

A filamentous fungus capable of producing lipids, a growth regulator, and a decomposer of cellulose and chitin—Mortierella—occupies 6.6% of the rhizosphere. It grows in areas rich in nutrients. That is why, in the rhizosphere of meadow-chernozem soil, biological products showed a stimulating effect; when inoculated with Flavobacterin, an increase of almost two times was noted in comparison with the control [52,53].

Biological preparations activated plant metabolic processes, as a result of which the amount of root exudates (monosaccharides) on which the fungus of the genus Rhizopus feeds increased, which is why its percentage is significant—3.3%. The proliferation of this fungus causes the disease “gray capitate mold” [54]. In our experience, the change from the studied agricultural practice on less fertile gray forest soil is clearly expressed. In the rhizosphere of the control variant of wheat, the variation was 1.3–6.0%, with the use of Mizorin at 0.5–4.7%; for oats, pre-sowing treatment of seeds with this preparation contributed to a decrease in this genus to 0.8–6.4% (with a control level of 1.1–13.8%). In the conditions of the southern forest-steppe, significant changes from the studied method could not be detected.

Thus, based on the analysis of ITS gene sequences, 15 fungal phyla were identified in the soil samples collected in the experiments. In meadow-chernozemic soil—10; in gray forest soil—15. The five dominant phyla of soil fungi were located in the following descending order: Ascomycota (about 70%) > Mortierellomycota (about 7%) > Basidiomycota (about 5%) > Mucoromycota (3%) > Chytridiomycota (1%). The five main genera of fungi inhabiting the rhizosphere of cereals are arranged in descending order: Giberella (6.9%) > Mortierella (6.6%) > Chaetomium (4.8%) > Cladosporium (3.8%) > Rhizopus (3.3%).

The predominantly positive effect of biological products of associative nitrogen fixation on the fungal community of the soil (rhizosphere) of experimental plots located in different soil-climatic zones has been established. During bacterization of seeds, an increase in saprotrophic genera of fungi was observed in relation to the control variants Pseudogymno-ascus, Chloridium, Clonostachys, Trihoderma, etc., and the fungicidal properties of bacterial strains introduced into the soil were actively manifested relative to phytopathogenic fungi of the genera Alternaria, Blumeria, Fusarium, etc.

3.2. Study of the Population of Rhizoctonia solani Kuehn. in the Soil

In our research to establish the population of the pathogen Rhizoctonia solani Kuehn, the method of multiple soil tablets was applied. The population of the chernozem soil Rhizoctonia solani, selected in April (before the start of agronomic work), amounted to 7.7–8.8 propagules/100 g (Figure 7). On average, there were 1.5 (15%) more propagules on gray forest soil than on meadow-chernozem soil.

The onset of favorable conditions for the cultivation of grain crops contributed to the accumulation of moisture in the soil and, as a result, the reproduction of micromycetes (

Table 1. The number of infectious structures of Rhizoctonia solani Kuehn. in the soil (n = 3).

Options		Southern Forest-Steppe (Meadow-Chernozem Soil)			The Average for the Zone	Subtaiga (Grey Forest Soil)			The Average for the Zone
		Tillering	Earing	Filling of Grain		Tillering	Earing	Filling of Grain
Soft spring wheat Omsk 42	Control	12.2	8.6	7.9	9.6	15.6	9.4	9.7	11.6
	Mizorin	17.5	13.4	7.2	12.7	14.6	8.9	9.4	11.0
	Flavobacterin	16.4	11.9	6.9	11.7	14.9	8.9	9.6	11.0
Average		15.4	11.3	7.3	11.3	15.0	9.1	9.6	11.2
Soft spring wheat Tarskaya 12	Control	18.0	11.4	10.1	13.2	16.6	10.6	7.9	11.7
	Mizorin	16.6	14.6	11.0	14.1	23.0	9.0	8.4	13.5
	Flavobacterin	15.0	14.2	9.7	13.0	23.0	9.1	6.8	13.0
Average		16.5	13.4	10.3	13.4	20.9	9.6	7.7	12.7
Soft spring wheat Omsk 44	Control	18.8	14.7	12.9	15.5	16.5	13.7	10.1	13.4
	Mizorin	16.2	14.4	11.0	13.9	15.3	11.3	10.0	12.2
	Flavobacterin	16.2	13.9	10.3	13.5	14.1	10.8	9.8	11.6
Average		17.1	14.3	11.4	14.3	15.3	11.9	10.0	12.4
Durum spring wheat Omsk coral	Control	18.8	12.7	9.0	13.5	13.6	11.9	9.9	11.8
	Mizorin	18.0	11.4	10.1	13.2	14.6	12.6	10.6	12.6
	Flavobacterin	18.6	13.7	12.3	14.9	18.5	14.0	13.3	15.3
Average		18.5	12.6	10.5	13.8	15.6	12.8	11.3	13.2
Barley Omsk 101	Control	15.9	12.1	9.0	12.3	12.2	9.5	8.6	10.1
	Mizorin	13.0	11.4	10.3	11.6	12.5	9.9	8.7	10.4
	Flavobacterin	11.5	10.7	9.4	10.5	11.9	8.9	8.9	9.9
Average		13.5	11.4	9.6	11.5	12.2	9.4	8.7	10.1
Oats Siberian Hercules	Control	10.0	6.9	6.5	7.8	10,3	8.4	10.2	9.6
	Mizorin	11.3	10.7	8.0	10.0	10.7	9.4	9.8	10.0
	Flavobacterin	13.8	10.4	8.8	11.0	10.0	9.8	9.4	9.7
Average		11.7	9.3	7.8	9.6	10.3	9.2	9.8	9.8
Average by experience		15.4	12.1	9.5	12.3	14.9	10.3	9.5	11.6

). Soil sampling in the tillering phase showed the colonization of the rhizosphere of crops from 10.0 (Siberian Hercules—control) to 18.8 propagules (soft spring wheat Omsk 44—control). The largest number of propagules was observed on durum wheat according to experience, both in the control variant and in variants with bacterization of seeds (18.0–18.8 propagules).

During the earing phase, a decrease in the number of Rhizoctonia solani was noted from 6.9 to 14.7 propagules for all variants of bacterization. Weather conditions in the second half of the growing season were also arid, and with a lack of moisture in the rhizosphere of crops, the soil population of the studied fungus decreased to 6.5–12.3 propagules. The number of Rhizoctonia solani in the subtaiga zone during the tillering phase was the largest (23 propagules) in soft spring wheat of the Tarskaya 12 variety on the Mizorin and Flavobacterin variants and the smallest (10.0–10.7 pieces) in the soil under the sowing of oats of the Siberian Hercules variety. On average, according to the variants of bacterization in the earing phase, the population of the rhizosphere with mycobiota ranged from 9.1–9.2 (Omsk 42, Omsk 101, and Siberian Hercules) to 12.8 propagules (Omsk coral). By the end of the crop vegetation (grain filling phase), 10.0–13.3 propagules were observed in the varieties Omsk 44 (control, Mizorin), Omsk coral (Mizorin, Flavobacterin), and Siberian Hercules (control). The effect of pre-sowing bacterization of seeds on Rhizoctonia solani in both study areas could not be identified.

In general, it was found that the soil population of Rhizoctonia solani was detected in each of the studied soil and climatic zones. Considering the southern forest-steppe, it was noted that during the first soil selection, the number of rhizoctonia amounted to 15.4 propagules; in the second selection, a decrease in the fungal microbiota was observed by 3.3 propagules (21%); by the third selection, the downward trend persisted by 2.6 propagules (21%). At the beginning of the vegetation period, soil moisture was sufficient for both seed germination and microbiota reproduction. From the tillering phase to the grain filling, the amount of Rhizoctonia solani decreased by 5.9 (meadow-chernozem soil) and 5.4 propagules (gray forest soil), or by 36–38%, respectively.

The largest number of fungal microbiota on average in the soil and climatic zones of the Omsk region was found in the rhizosphere of the studied wheat varieties (13.1–13.5 propagules), and the smallest number was found in grain crops (9.7–10.8 propagules). According to the results of determining the number of infectious structures of Rhizoctonia solani, it was found that the population above the threshold of harmfulness to a high degree (more than five propagules) was noted in all the studied variants of the experiment.

3.3. In the Population of the Soil with Conidia, the Causative Agent of Ordinary Root Rot of Grain Crops Is Bipolaris sorokiniana Sacc. Shoem. (syn. Helminthosporium Pam., King et Bakke)

The selection of soil samples was carried out in April 2023 before the application of agrotechnological measures (after a steady achievement of the average daily soil temperature above +10 °C) from the depth of the arable layer (0–20 cm). The soil analysis was carried out by the flotation method.

It was found that before the start of spring field work, the total number of Bipolaris sorokiniana conidia in the soil was in the range of 5–25 pcs/g (meadow-chernozem soil) and 15–25 pcs/g (gray forest soil). The population of the soil with viable cells was 1–3 pcs/g, which is below the threshold of harmfulness (PV 20 pcs/g of soil) (

Table 2. The number of cells of Bipolaris sorokiniana fungi in the soil before sowing (n = 3).

Options	The Total Number of Conidia, pcs./g		The Number of Living Conidia, pcs./g		Proportion of Degraded Conidia, %
	Meadow- Chernozem	Grey Forest Soil	Meadow- Chernozem	Grey Forest Soil	Meadow- Chernozem	Grey Forest Soil
Soft spring wheat	10	20	1	3	90.0	85.0
Durum spring wheat	25	15	2	2	92.0	86.7
Barley	5	25	1	2	80.0	92.0
Oats	15	20	1	2	93.3	90.0
Average	13.8	20.0	1.3	2.3	88.8	88.4

).

In dynamics during the growing season of 2023, the total number of Bipolaris sorokiniana conidia in the rhizosphere of cereals ranged between 18.3–38.3 conidia/g (meadow-chernozem soil) and 16.7–30.0 pcs/g (gray forest soil). The population of the soil with live conidia was 1.0–4.7 pcs/g.

The number of Bipolaris sorokiniana varied depending on the drug used. In the conditions of the southern forest-steppe (meadow-chernozem soil), the greatest fungicidal effect was noted in Flavobacterin application variants on wheat of the Omsk 42 variety, durum wheat of the Omsk coral variety, and barley; the decrease in conidia relative to the control was 73%, 35%, and 29%, respectively.

In the subtaiga zone (gray forest soil) as in the southern forest-steppe zone, pre-sowing bacterization of seeds with Flavobacterin led to a decrease in Bipolaris sorokiniana in the rhizosphere of wheat of the Omsk 42 variety by 18% and oats by 27% to control. The use of the drug Mizorin in some variants of the experiment led to an insignificant decrease in the harmful fungus or had no effect at all.

In our soils (meadow-chernozem and gray forest), the process of degradation of Bipolaris sorokiniana conidia was revealed at 85.7–90.7% (meadow-chernozem soil) and 85.6–93.9% (gray forest soil) (

Table 3. Soil population with conidia of the causative agent of common root rot of grain crops, Bipolaris sorokiniana (n = 3).

Options		The Total Number of Conidia, pcs./g		The Number of Living Conidia, pcs./g		Proportion of Degraded Conidia, %
		Meadow- Chernozem	Grey Forest Soil	Meadow- Chernozem	Grey Forest Soil	Meadow- Chernozem	Grey Forest Soil
Soft spring wheat Omsk 42	Control	31.7 ± 3.3	21.7 ± 5.2	3.3 ± 0.7	2.7 ± 0.5	89.7	87.3
	Mizorin	18.3 ± 4.4	18.3 ± 1.3	1.7 ± 0.3	1.7 ± 0.3	90.7	91.1
	Flavobacterin	18.3 ± 1.7	18.3 ± 4.7	2.0 ± 0.8	2.0 ± 0.8	89.4	90.0
Soft spring wheat Tarskaya 12	Control	20.0 ± 2.9	18.3 ± 2.6	2.7 ± 0.5	2.0 ± 0.3	86.9	88.5
	Mizorin	25.0 ± 2.9	16.7 ± 1.3	3.0 ± 0.5	1.0 ± 0.3	88.2	93.9
	Flavobacterin	25.0 ± 2.9	18.3 ± 1.3	3.0 ± 0.5	1.3 ± 0.3	88.2	92.8
Soft spring wheat Omsk 44	Control	21.7 ± 3.3	16.7 ± 1.3	2.7 ± 0.5	2.3 ± 0.3	87.6	85.6
	Mizorin	21.7 ± 4.4	21.7 ± 3.4	2.7 ± 0.5	2.0 ± 0.3	87.8	90.0
	Flavobacterin	21.7 ± 1.7	18.3 ± 1.3	3.0 ± 0.3	2.7 ± 0.3	86.0	85.6
Durum spring wheat Omsk coral	Control	38.3 ± 1.7	21.7 ± 1.3	4.7 ± 0.3	2.7 ± 0.7	87.9	87.7
	Mizorin	33.3 ± 1.7	23.3 ± 2.6	4.3 ± 0.3	2.3 ± 0.7	87.0	90.6
	Flavobacterin	28.3 ± 1.7	21.7 ± 1.3	4.0 ± 0.3	2.0 ± 0.5	85.8	90.7
Barley Omsk 101	Control	30.0 ± 2.9	23.3 ± 1.3	4.0 ± 0.5	2.7 ± 0.3	86.8	88.7
	Mizorin	33.3 ± 3.3	30.0 ± 1.3	3.7 ± 0,5	3.0 ± 0.5	89.2	90.0
	Flavobacterin	23.3 ± 1.7	21.7 ± 3.4	3.3 ± 0.7	2.3 ± 0.3	85.7	87.8
Oats Siberian Hercules	Control	31.7 ± 1.7	23.3 ± 2.6	4.0 ± 0.3	2.7 ± 0.5	87.3	88.9
	Mizorin	31.7 ± 3.3	20.0 ± 2.2	4.0 ± 0.5	2.0 ± 0.5	87.4	90.4
	Flavobacterin	28.3 ± 4.4	18.3 ± 3.4	3.7 ± 0.5	2.0 ± 0.5	86.9	89.3

).

The degradation of micromycete conidia consists in their initial germination under the influence of root secretions of plants, the lysis of mycelium by soil microbiota, and the breakdown of cellular structures, especially after phytosanitary precursors (peas, vico-oat mixture, and corn). The process of conidia degradation causes soil improvement; therefore, its strengthening and formation of suppressive soils are an extremely significant task for the region [55]. Our research focuses on soil resistance to harmful organisms in various soil and climatic conditions of the Omsk region. Soil health depends on a set of factors: temperature, moisture availability, mineral nutrition, immunity of the variety, and protection of seeds and crops. The largest number of Rhizoctonia solani was found in the rhizosphere of the studied wheat varieties (13.1–13.5 propagules), and the smallest number was found in grain crops (9.7–10.8 propagules). From the tillering phase to the grain filling, the amount of fungal microbiota decreased by 5.9 (meadow-chernozem soil) and 5.4 propagules (gray forest soil), or by 36–38%, respectively.

The total number of Bipolaris sorokiniana conidia in the rhizosphere of grain crops ranged between 18.3–38.3 conidia/g (meadow-chernozem soil) and 16.7–30.0 pcs./g (gray forest soil). The population of the soil with live conidia was 1.0–4.7 pcs./g; both the total population of Bipolaris sorokiniana soils and the density of viable conidia were below the threshold of harmfulness (40 conidia/g of soil), allowing us to assume that the phytosanitary situation regarding this pathogen is calm.

4. Discussion

The fundamental scientific task is research in the direction of studying microflora at the genetic level, which allows us to display the real taxonomic diversity of living microorganisms living in the soil. The studied indicators are widely used to assess the productivity of ecosystems, the effectiveness of the use of microbial strains, as well as to analyze the activity of soil microbiocenosis. The research of the Laboratory of Microbiology of the Omsk ASC Federal State Budgetary Scientific Institution in field experiments in previous years established the positive effect of complex biological preparations on the biological activity of meadow-chernozem soil under crops [56,57]. Similar results on the activation of soil processes in the rhizosphere of crops were obtained in the studies of Russian and foreign scientists when treated with various natural biologics [58].

As for the data obtained on the metagenomic analysis of the rhizosphere and the revealed zonal features of representatives of phylum and genera of fungi, in the studies of colleagues conducted in the Yamalo-Nenets Autonomous Okrug, the Republic of Bashkortostan, Yakutia, and quarries of the Leningrad Region, a similar picture was obtained: when analyzing the soil of the taiga subzone, a gradual increase in the number of fungi was found (mainly in the upper parts profile) during the development of the soil formation process [59,60]. An indicator of optimization of potential soil fertility is considered to be an increase in the reserves of organic matter in the soil (humus formation); optimization of effective fertility is the rate of mineralization of organic residues. Both processes are related to the activity of the soil microflora. In our studies, it was found that the highest coefficient of potential microbiological transformation of organic matter into humus reserves in meadow-chernozem soil was in the rhizosphere of oats when using Mizorin and Omsk 44 wheat, on gray forest soil on Omsk coral wheat when treating seeds with Flavobacterin, and in the Mizorin variant on oats. The activity of microbial decomposition of inhumified organic substances (dead biomass of plant, animal, and microbial origin) in the studied soils was <1. Novosibirsk colleagues revealed differences in the activity of the processes taking place depending on the type of soil. It was determined that in long-term phytomeliorated salt pans, the rate of microbial decomposition of organic matter in comparison with the original virgin soil is slightly reduced, and the rate of microbiological humus formation is increased [61].

When studying the effect of biologics on the number of Rhizoctonia in the rhizosphere of cereals, no significant difference was found between the variants (the differences between the variants are within the error of experience). Yakimenko V.N., Malyuga A.A. (2014). After conducting experiments in the forest-steppe of Western Siberia (Novosibirsk region), it was found that unilateral application of nitrogen fertilizers with depleted potash stock of the soil contributes to a sharp increase in the population of fungi, including pathogenic ones. Optimization of the soil potash state ensures a significant reduction in the number of fungi in the soil of the agrocenosis [62]. According to Hannibal F.B. et al. (2022, 2023), fungal diseases cultivated in Russia, namely, rhizoctonic root rot, affect plants from a low to moderate degree [63,64]. Analysis of soil population with conidia of the causative agent of common root rot revealed the process of degradation of conidia. Bipolaris sorokiniana Toropova E. Yu. et al. (2013) note that in the conditions of the Kurgan region, the minimum number of conidia (87–109 conidia/g of soil) was noted in dry years [55]. In our soils (meadow-chernozem and gray forest), the number of pathogen conidia was 85.7–90.7% (meadow-chernozem soil) and 85.6–93.9% (gray forest soil).

5. Conclusions

As a result of the performed research, we have clarified the taxonomic diversity of soils in the southern forest-steppe and subtaiga zones of Western Siberia. Based on the analysis of ITS gene sequences in the soil (rhizosphere), 15 phylum of fungi common to soil microbial communities were identified. In general, the taxonomic composition of microbial phylum corresponds to that in moderately moist soils of the temperate zone. The differences between soils are due to differences between taxa of lower rank than phylum: in meadow-chernozem soil—10, and in gray forest—15. Representatives of Ascomycota dominated—70%, followed by Mortierellomycota (about 7%), Basidiomycota (on average 5%), Mucoromycota (3%) and Chytridiomycota (1%). Five main genera of fungi inhabiting the rhizosphere of cereals: Giberella (6.9%), Mortierella (6.6%), Chaetomium (4.8%), Cladosporium (3.8%), and Phizopus (3.3%) have been identified. During seed inoculation, the growth of saprotrophic fungal genera was observed in relation to control variants—Pseudogymnoascus, Chloridium, Clonostachys, Trihoderma, etc.—and the fungicidal properties of bacterial strains introduced into the soil relative to phytopathogenic fungi of the genera Alternaria, Blumeria, Fusarium, etc. were actively manifested.

The study of the effect of complex biologics on the number of Rhizoctonia solani in the rhizosphere of cereals showed that there were no significant differences between the fertilized variants of the experiment and the control. The biopreparation Flavobacterin had the greatest fungicidal effect on the amount of Bipolaris sorokiniana in the rhizosphere.

The use of complex biologics stimulates the growth of agronomically valuable biota, has a positive effect on the fungal community of the rhizosphere of crops, and contributes to the strengthening of the role of biological nitrogen in the agrocenosis.

In the southern forest-steppe zone (meadow-chernozem soil), the rhizosphere biota of wheat was most responsive to pre-sowing seed treatment with Flavobacterin; microorganisms under barley and oats did not respond to the studied agricultural practice. The most responsive was the root microbiota of soft wheat Omskaya 44 and durum wheat Omskaya coral; the growth relative to the control was 31 and 28% (treatment with Mizorin) and 42 and 46% (treatment with Flavobacterin). In the subtaiga zone (gray forest soil), a significantly larger total amount of rhizosphere biota was revealed in comparison with the meadow-chernozem soil. The activity of root microorganisms of wheat also increased to the greatest extent in the Flavobacterin variants; however, in contrast to the southern forest-steppe zone, a significant positive effect of the Mizorin drug on the microbial cenosis of gray forest soil was established. The increase in the number of microorganisms when using Mizorin on the soft wheat variety Omskaya 44 was 28%, Flavobacterin on soft wheat Tarskaya was 12–51%, and on the durum wheat variety Omskaya coral was 134% compared to the control. The use of Mizorin on barley increased the number of microorganisms in the rhizosphere by more than two times and Flavobacterin by 87% compared to the control.

On average, during the growing season of 2023, nitrogen immobilization processes predominated in the rhizosphere. The intensity of transformation of organic matter depended on environmental conditions: temperature, amount of precipitation, and, accordingly, soil moisture, as well as the input of plant litter into the soil, which influenced the studied factors, strengthening or weakening their effect. The highest transformation coefficient of organic matter on meadow-chernozem soil was observed in the Mizorin variant in the rhizosphere of oats (103.29) and Omskaya 44 wheat (53.99), and, on gray forest soil, on wheat in the Flavobacterin variant on the Omsk coral variety (149.07), in the Mizorin variant on oats (63.19).

Based on the analysis of ITS gene sequences in the soil (rhizosphere), 15 fungal phyla were identified (in the meadow-chernozemic soil—10 and in the gray forest soil—15). Representatives of Ascomycota dominated—70%, followed by Mortierellomycota (about 7%), Basidiomycota (on average 5%), Mucoromycota (3%) and Chytridiomycota (1%). Five main genera of fungi inhabiting the rhizosphere of cereals were identified: Giberella (6.9%), Mortierella (6.6%), Chaetomium (4.8%), Cladosporium (3.8%), and Rhizopus (3.3%).

When inoculating seeds, growth of saprotrophic genera of fungi was observed in relation to the control variants—Pseudogymnoascus, Chloridium, Clonostachys, Trihoderma, etc.—and the fungicidal properties of bacterial strains introduced into the soil were actively manifested relative to phytopathogenic fungi of the genera Alternaria, Blumeria, Fusarium, etc.

The use of complex biologics stimulates the growth of agronomically valuable biota, has a positive effect on the fungal community of the rhizosphere of crops, and contributes to the strengthening of the role of biological nitrogen in agrocenosis (by activating the process of associative nitrogen fixation).