Next Article in Journal
Image Processing and Support Vector Machine (SVM) for Classifying Environmental Stress Symptoms of Pepper Seedlings Grown in a Plant Factory
Previous Article in Journal
Occurrence of Polycyclic Aromatic Hydrocarbons (PAHs) in Pyrochar and Hydrochar during Thermal and Hydrothermal Processes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 14
Issue 9
10.3390/agronomy14092042
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detection of Clubroot Disease Resistance in Brassica juncea Germplasm at the Seedling Stage

by
Wenlong Yang
1,*,
Jiangping Song
1,
Xiaohui Zhang
1,
Chu Xu
1,2,
Jiaqi Han
1,2,
Zhijie Li
1,
Yang Wang
1,
Huixia Jia
1 and
Haiping Wang
1,*
1
State Key Laboratory of Vegetable Biobreeding, Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China
2
College of Horticulture, Shanxi Agricultural University, Jinzhong 030801, China
*
Authors to whom correspondence should be addressed.
Agronomy 2024, 14(9), 2042; https://doi.org/10.3390/agronomy14092042
Submission received: 3 July 2024 / Revised: 13 August 2024 / Accepted: 3 September 2024 / Published: 6 September 2024
Browse Figures
Versions Notes

Abstract

:
Infection by the mustard clubroot disease pathogen Plasmodiophora brassicae has a significant negative impact on the quality and yield of Chinese mustard (Brassica juncea). At present, screening resistant resources for breeding programs is the most economical and effective method available to control this disease. In this study, we isolated P. brassicae physiological race 4 from Chinese cabbage and examined 483 mustard germplasm resources (193 leaf mustard, 96 stem mustard, and 194 root mustard) from China and abroad to identify resistance to clubroot disease at the seedling stage through irrigation inoculation with the isolated pathogen. The results showed that there were no immune varieties among the tested mustard germplasm, but that there were differences in resistance to clubroot disease among the three mustard types. More than 90% of leaf and stem mustard resources were susceptible to clubroot disease, whereas 38.66% of root mustard resources showed resistance. In total, we detected 4 highly resistant, 9 resistant, and 83 moderately resistant varieties, of which 4 highly resistant, 8 resistant, and 63 moderately resistant varieties were root mustard resources, whereas only 1 resistant and 5 moderately resistant varieties were stem mustard resources, and 15 moderately resistant varieties were leaf mustard resources. In addition, we used seven molecular markers for clubroot disease resistance in Chinese cabbage to detect stem and root mustard resources. The results showed that the marker CRk was detected in 97.87% of stem mustard and 92.49% of root mustard resources. Six markers (Crr1, Crr2, Crr3, CRa, CRb, and CRc) were detected in 18.09%, 7.45%, 2.13%, 6.38%, 12.77%, and 12.77% of stem mustard germplasms, and four markers (Crr1, Crr2, Crr3, and CRc) were detected in 8.09%, 8.67%, 10.40%, and 8.67% of root mustard germplasms, respectively, suggesting that these markers are not suitable for detecting mustard germplasm resistance to clubroot disease. This study provides a technical reference and material support for the breeding of mustard varieties resistant to clubroot disease.

1. Introduction

Chinese mustard (Brassica juncea (L.) Czern.) is an important cruciferous vegetable crop with 16 recognized varieties that have arisen through natural evolution and artificial selection [1]. Chinese mustard is cultivated throughout China, except in alpine and arid areas, with a production area of more than 1 million hm2, concentrated mainly in southwestern, central, eastern, and southern China [2,3]. However, mustard clubroot disease has recently caused annual losses of 30–50% in major mustard production areas such as Chongqing, Sichuan, Fujian, Zhejiang, Hunan, and Hubei [4,5], seriously threatening the sustainable development of the mustard industry.
Mustard clubroot disease is a soil-borne disease caused by the obligate parasitic microorganism Plasmodiophora brassicae Woron [6]. Typical symptoms include the formation of club-shaped galls on the roots of diseased plants, which impede the absorption of water and nutrients by the plant [7]. P. brassicae has a wide range of hosts, including a variety of cruciferous plants such as cabbage, mustard, radish, kale, cauliflower, and rape [8], among which it is transmitted through soil infested with resting spores, irrigation water, or contact with diseased plants. Resting spores of P. brassicae can survive in soil for more than 15 years, and its prevention and control are very difficult due to its strong infectivity and the long survival of its spores [9]. At present, strategies for the prevention and control of clubroot disease mainly focus on chemical pesticides, field management, and the cultivation of disease-resistant varieties [10,11]. Although chemical agents can kill pathogenic bacteria to some extent, long-term application can easily lead to soil pollution [12]. Field management measures such as quicklime application and crop rotation are costly in terms of both time and labor. Thus, cultivating disease-resistant plant varieties is the most cost-effective way to combat clubroot disease. Screening high-quality resistant varieties, which requires the extensive collection of germplasm resources for disease resistance identification, is the basis of current anti-clubroot disease breeding efforts, as well as resistance physiological and genetic research. In recent years, many studies have screened clubroot-resistant varieties of cabbage and Chinese cabbage at the phenotypic and molecular levels [13,14,15,16,17,18,19,20], and large numbers of cabbage germplasm resources have been accumulated [21,22,23,24,25,26]. However, fewer such studies have been conducted for mustard, and these have mainly focused on the occurrence and prevention of mustard clubroot disease.
In this study, we isolated a physiological race of Plasmodiophora brassicae from Chinese cabbage, and then examined 483 Chinese mustard germplasm resources (193 leaf mustard, 96 stem mustard, and 194 root mustard) from China and abroad to identify resistance to clubroot disease at the seedling stage through irrigation inoculation with the isolated pathogen. The results of this study will lay the foundation for breeding clubroot-resistant mustard varieties.

2. Materials and Methods

2.1. Materials

A total of 483 mustard resources were used for the detection of clubroot disease resistance (Table S1), of which 193 were leaf mustard (BA001–BA193), 96 were stem mustard (BB001–BB096), and 194 were root mustard (BC001–BC194). All germplasm resources were obtained from the National Mid-term Genebank of Vegetable Germplasm Resources (Beijing, China). Mustard germplasm resources resistant to clubroot disease were screened in a glass house at the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences from August to October 2021. P. brassicae was isolated from root tissues of infected Chinese cabbage collected in Xinye County, Henan Province, China. Prior to pathogen isolation, the roots were washed with tap water and then with sterile water, air-dried, and refrigerated at −20 °C.

2.2. Methods

2.2.1. Identification of the Physiological Race of Plasmodiophora brassicae

There are physiological races 1, 2, 5, 6, 7, 9, 10, 11, 12, and 13 of P. brassicae in China, which infect major Brassica vegetables such as Chinese cabbage, rapeseed, cabbage, etc. Among them, the dominant race is physiological race 4 [23]. To identify whether the physiological race of P. brassicae isolated in this study is physiological race 4, spores and DNA of diseased roots of Chinese cabbage collected from Xinye County, Henan Province were extracted, and polymerase chain reaction (PCR) was conducted using the specific primers Novel342, Novel407, PBRA_007750, PBRA_008439, and PBRA_009348 (Table 1). PCR and gel electrophoresis imaging were performed as previously described [27].

2.2.2. Clubroot Pathogen Inoculation

The clubroot-diseased root tissues of Chinese cabbage were collected from Xinye County, Henan province and homogenized using a plant tissue grinder with an equivalent volume of sterile water as the diluent according to Ma et al. [28]. The resulting homogenates were filtered through four-layer sterile gauze, and the filtrate, which contained the pathogen suspension, was harvested. It was centrifuged at 4000 rpm for 10 min, and the resulting supernatant was discarded. The precipitate was resuspended in distilled water, and this process was conducted three times. After the final centrifugation, the precipitate was further suspended in distilled water and kept at 4 °C. Before inoculation, distilled water was added to adjust the spore concentration to 2 × 108 spores/mL. The inoculum was prepared on the day of inoculation.
Inoculations were conducted twice for each plant; the first inoculation was performed at five days after germinating, and the second inoculation was carried out when the seedlings developed three true leaves (about 15 days after germinating). The resting spore inoculum (5 mL) was pipetted onto the surface of each pot. For each accession, seven to ten plants were inoculated, and three independent biological replicates were carried out in the experiment in a greenhouse at 20–25 °C (daytime, 16 h light)/15–18 °C (nighttime, 8 h dark), and a 70–80% relative humidity.

2.2.3. Identification of Clubroot Disease Resistance in Mustard Germplasm

About 25 days after the second inoculation, the seedlings were pulled up from the pots and cleaned under running tap water. The disease level of the individual plant classification, disease index calculation, and resistance level classification were carried out according to Ma et al. [28]. In brief, the clubroot disease level of individual plants was classified into grades 0, 1, 3, 5, 7, and 9. These individual grades were used to calculate the DI for each accession. Based on three independent biological replicates, the accessions were classified as immune (I, DI = 0), highly resistant (HR, 0 < DI ≤ 5), resistant (R, 5 < DI ≤ 15), moderately resistant (MR, 15 < DI ≤ 30), susceptible (S, 30 < DI ≤ 45), or highly susceptible (HS, DI > 45).

2.2.4. Molecular Marker Detection of Loci Associated to Mustard Clubroot Resistance

Genomic DNA was extracted from mustard leaves using a DNA extraction kit (Tiangen Biochemical Technology, Beijing, China) according to the manufacturer’s instructions. The total PCR reaction volume was 20 μL, including 10 μL of 2× Taq PCR Mix (Tiangen Biochemical Technology), 1 μL each of upstream and downstream primers (10 μM), 2 μL of DNA template (50–100 ng/μL), and 6 μL ddH2O. All procedures for PCR and gel electrophoresis were described previously [29,30,31,32]. Molecular marker primers for Chinese cabbage anti-clubroot loci (Crr1, Crr2, Crr3, CRa, CRb, CRc, and CRk) are listed in Table 2.

2.3. Data Analyses

Disease index values for each mustard germplasm were analyzed using Excel 2019 (Microsoft Corp., Redmond, WA, USA).

3. Results

3.1. Molecular Identification of the Physiological Race of Plasmodiophora brassicae

The physiological race of P. brassicae isolated in this study was identified according to PCR amplification performed with specific primers. Primer PBRA_009348 had no amplification products, whereas primers Novel342, Novel407, PBRA_007750, and PBRA_008439 yielded bands of 249, 549, 638, and 651 bp, respectively (Figure 1), indicating that the isolate was P. brassicae physiological race 4.

3.2. Detection of Seedling Resistance to Clubroot Disease in Mustard Resources

The grading criteria for clubroot disease at the mustard seedling stage are shown in Figure 2A. Phenotypic analysis of the mustard resources showed that 80.12% of the varieties were susceptible, of which 31.88% (154/483) were highly susceptible (HS), and 48.24% (233/483) showed susceptibility (S, Figure 2B, Supplementary Table S1). No immune varieties were detected, but 4 (0.83%), 9 (1.86%), and 83 (17.18%) varieties were found to be highly resistant (HR), resistant (R), and moderately resistant (MR), respectively. Typical disease-resistant and disease-sensitive varieties are shown in Figure 3.

3.3. Histological Observation of Resistant and Susceptible Mustard Root Cross Sections

To understand the process of infection by P. brassicae, root tissue sections from resistant and susceptible varieties were examined 28 days after inoculation. The results showed that the cortical cells of susceptible varieties were filled with large numbers of dormant sporangia; the number of cortical cells had expanded, squeezing the vascular bundle; and the tissue cell morphology was partially deformed (Figure 4A,B). In contrast, the cortical cells of disease-resistant varieties were normal, and no dormant sporangia were found (Figure 4C,D). A comparison of cortical infection sections of resistant and susceptible mustard varieties after inoculation showed that secondary infection and the production of dormant P. brassicae sporangia were the main reasons for root expansion in the susceptible varieties.

3.4. Geographical Distribution of Mustard Resources with Clubroot Disease Resistance

The geographical distribution of mustard resources with clubroot disease resistance is shown in Figure 5. Sichuan Province had 124 varieties, which was the largest number of resistant resources, accounting for 25.67% of all varieties, followed by Henan Province with 49 accessions (10.14%), Yunnan Province with 38 accessions (7.87%), and Hubei Province with 36 accessions (7.45%); Beijing, Hainan, Ningxia, and Xinjiang Provinces each had only one accession. The four highly resistant resources were collected from Henan, Zhejiang, Shandong, and Heilongjiang Provinces; of the nine resistant resources, three were collected from Liaoning Province, two from Sichuan Province, and four from Yunnan, Jiangsu, Guangdong, and Guangxi Provinces. Among the 83 moderately resistant resources, 24 were collected from Sichuan Province (4.97% of all resources), 10 from Henan Province (2.07%), 8 from Hubei Province (1.66%), 6 from Yunnan Province (1.24%), and 5 from Hebei Province (1.04%); the remainder were collected from 12 different provinces (6.21%). In addition, two resources collected from Russia, and one each from North Korea, Japan, and Thailand were all susceptible varieties.

3.5. Comparison of Clubroot Resistance among Types of Mustard Resources at the Seedling Stage

Mustard germplasm can be divided different types, according to the target edible organ. Among the 483 identified resources, 193 were leaf mustard, 96 were stem mustard, and 194 were root mustard. We detected significant differences in clubroot resistance among the three mustard types (Figure 6), among which root mustard was most resistant, with the proportion of resistant resources reaching 38.66%, including all of the highly resistant resources (four accessions) and eight resistant accessions. Only 6.25% of the resistant resources were stem mustard, with only one resistant accession and five moderately resistant accessions among 96 resources. There were no highly resistant or resistant leaf mustard varieties, and only 15 of 193 leaf mustard resources (7.77%) showing moderate resistance. Stem mustard resources were mainly collected from Fujian, Guizhou, Hubei, Hunan, Jiangxi, Shandong, Sichuan, Zhejiang, and Chongqing Provinces; all of these provinces except for Shandong are located in southern or southwestern China. One resistant accession and three moderately resistant accessions were collected from Sichuan Province, and the remaining two accessions were collected from Fujian and Hunan. In contrast, leaf and root mustard resources were collected from nearly all provinces of China (Figure 5).

3.6. Molecular Detection of Clubroot Resistance in Mustard Resources

Because few studies have investigated clubroot resistance loci in mustard and there is no available molecular marker for its detection, we used seven molecular markers that have been linked to clubroot disease resistance genes in Chinese cabbage (Crr1, Crr2, Crr3, Cra, CRb, CRc, and CRk) to explore resistance mechanisms in the 94 stem and 173 root mustard accessions using PCR amplification (Figure 7, Supplementary Table S2). The results showed that CRk was detected in most germplasms (97.87%), whereas the remaining six genes (Crr1, Crr2, Crr3, Cra, CRb, and CRc) were detected in 18.09%, 7.45%, 2.13%, 6.38%, 12.77%, and 12.77% of stem mustard germplasms, respectively. Thus, CRk may not be related to clubroot resistance in stem mustard resources. Correlation analysis of the seven resistance molecular markers and stem mustard resource disease index values showed that these molecular markers were not significantly correlated with disease resistance in stem mustard, indicating that they may not be suitable for detecting clubroot resistance in stem mustard. In root mustard, Crr1, Crr2, Crr3, and CRc were detected in only a few germplasms, accounting for 8.09%, 8.67%, 10.40%, and 8.67%, respectively, of the total number of accessions. However, CRa, CRb, and CRk were detected in most germplasms (73.41%, 69.94%, and 92.49%, respectively). Correlation analysis of the seven resistance molecular markers and disease index values showed that Crr1, Crr2, Crr3, CRa, and CRk were not significantly correlated with disease index values, whereas CRb and CRc were significantly positively and negatively correlated with disease index values, respectively, indicating that the former is unsuitability for detecting clubroot resistance in root mustard resources, whereas the latter may be suitable.

4. Discussion

High-quality anti-disease resources are the basis for disease resistance breeding. Thus, the screening, identification, and evaluation of anti-disease resources is a key step in the selection and breeding of mustard vegetables resistant to clubroot disease. Although a number of studies have examined the pathogenesis and comprehensive prevention and treatment of mustard clubroot disease in China in recent years [33,34,35,36,37,38,39,40,41,42,43,44], insufficient studies have identified, evaluated, and screened clubroot-resistant mustard resources. We evaluated 193 leaf mustard, 96 stem mustard, and 194 root mustard resources for clubroot disease resistance at the seedling stage and found only 4 highly resistant and 8 resistant root mustard accessions; 1 resistant stem mustard accession; and 15, 5, and 63 moderately resistant accessions in leaf, stem, and root mustard accessions, respectively. No accessions immune to mustard clubroot disease were found. The proportion of susceptible and high-sensitivity leaf and stem mustard varieties exceeded 90%, whereas that of root mustard was 61.34%, indicating that there were more resistant root mustard resources, and fewer resistant leaf and stem mustard resources. Previous studies have also reported clubroot resistance in mustard germplasm resources [45,46]. As for the geographical distribution of mustard germplasm resources, there is no significant regional specificity in the distribution of mustard resistant varieties. Therefore, the extensive collection of germplasm resources, identifying their disease resistance, and exploring more mustard resources resistant to clubroot disease will be the primary task of future mustard breeding for resistance to clubroot disease.
By slicing the root tissues of susceptible and resistant mustard seedlings, it can be seen under the microscope that the cortical structure of the root system of seedlings infected with P. brassicae is unclear, while the root structure of resistant seedlings is clearly layered. This indicates that in the process of infecting the host root system, P. brassicae not only obtains various nutrients from the root tissue to maintain growth and development, but also secretes certain chemicals that disrupt the normal metabolism of the host, resulting in tumors in the roots, affecting the transport of nutrients and water, and leading to wilting of the aboveground parts or plant death in the later stages of growth.
The genetic mechanism for clubroot disease resistance in cabbage and Chinese cabbage is complex and is generally thought to involve a quantitative genetic trait controlled by multiple genes [6,32]. To date, 29 quantitative trait loci (QTLs) have been found in Chinese cabbage [47], some of which have been developed as molecular markers for the identification of clubroot resistance in Chinese cabbage resources or varieties and have yielded satisfactory results. For example, Zeng et al. [13] used seven known molecular markers (Crr1, Crr2, Crr3, CRa, CRb, CRc, and CRk) to screen 28 resistant Chinese cabbage varieties, among which 27 contained five clubroot resistance loci (Crr2, Crr3, CRa, CRb, and CRk), with CRk found to be ubiquitous among disease-resistant varieties. Wei et al. [20] screened 96 Chinese cabbage cultivars using six molecular markers (CRa, CRb, CRc, Crr1, Crr2, and Crr3); the results showed that 31 cultivars were resistant to P. brassicae race 4, most of which contained CRa and CRb disease resistance loci, whereas a few contained Crr1, Crr2, or Crr3 disease resistance loci. Although dozens of resistant QTL loci have also been localized in cabbage, they were identified based on different populations, and the molecular markers linked to these populations are rarely disclosed, making it difficult to utilize these findings widely. Therefore, the identification of clubroot resistance in cabbage currently relies mainly on manual inoculation identification methods. Mustard vegetables are heterotetraploid plants that contain both A and B genomes, of which the A genome originated from Chinese cabbage and has more clubroot resistance loci; therefore, we used seven clubroot resistance molecular markers from Chinese cabbage, combined with phenotypic analysis, to explore the effectiveness of these molecular markers in mustard. The results showed that CRc may be related to clubroot resistance in root mustard resources, whereas the remaining six markers (Crr1, Crr2, Crr3, CRa, CRb, and CRk) may not, perhaps because differences between the A genomes of mustard and Chinese cabbage make their resistance loci inconsistent. Thus, constructing genetic mapping populations using disease resistant and susceptible varieties, and conducting disease-resistant gene mapping and cloning, is currently an urgent problem that needs to be solved. The genetic mechanism and gene locus of clubroot resistance in mustard resources requires further investigation.

5. Conclusions

Clubroot resistance evaluations were conducted on 483 mustard germplasm resources (including 193 leaf mustard, 96 stem mustard, and 194 root mustard) from China and abroad at seedling stage by using the method of irrigation inoculation with the physiological race 4 of P. brassicae. The results showed that there were differences in resistance to clubroot disease among different types of mustard (i.e., leaf mustard, stem mustard, and root mustard); 38.66% of root mustard resources were resistant to clubroot disease, while less than 10% of leaf and stem mustard accessions were resistant to clubroot disease. In the identified resources, 4 highly resistant, 9 resistant, and 83 moderately resistant accessions were found, of which 4 highly resistant, 8 resistant, and 63 moderately resistant accessions were root mustard; only 1 resistant and 5 moderately resistant accessions were stem mustard; and 15 moderately resistant accessions were leaf mustard. In addition, detection of stem mustard and root mustard resources with seven molecular markers from Chinese cabbage for resistance to clubroot revealed that the markers were not suitable for detecting the resistance of mustard resources to clubroot disease; new molecular markers related to resistance to clubroot in mustard should be explored. This study will provide material support and technical reference for the breeding of mustard varieties resistant to clubroot disease.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy14092042/s1, Table S1: Detailed information on the mustard accessions that were tested in this study; Table S2: Molecular detection of clubroot disease resistance gene loci in stem and root mustard accessions.

Author Contributions

Conceptualization, W.Y. and H.W.; methodology, W.Y. and J.S.; formal analysis, W.Y. and X.Z.; investigation, W.Y., C.X., J.H., Z.L. and Y.W.; resources, W.Y., J.S. and H.J.; data curation, W.Y. and C.X.; writing—original draft preparation, W.Y.; writing—review and editing, W.Y. and H.W.; funding acquisition, H.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by grants from China Agriculture Research System of MOF and MARA (CARS-24-A-01), the Safe Preservation Project of Crop Germplasm Resources of Ministry of Agriculture and Rural Affairs (2024NWB037), and the Science and Technology Innovation Project of Chinese Academy of Agricultural Sciences (CAAS-ASTIP-2024-IVFCAAS).

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Liu, P. Chinese Mustard; China Agricultural Publishing House: Beijing, China, 1996; pp. 24–26. [Google Scholar]
  2. Fan, Y.; Shen, J.; Dong, D. Development status and research prospect of mustard vegetables industry. J. Agric. 2016, 6, 65–71. [Google Scholar]
  3. Wan, Z.; Li, H.; Yao, P.; Liu, X.; Xu, Y.; Fu, T.; Zou, R.; Xu, Y. Progress and prospect of heterosis utilization in mustard (Brassica juncea L.) vegetables. J. Huazhong Agric. Univ. 2018, 37, 115–120. [Google Scholar]
  4. Guo, Y. Pathogenesis characteristics and prevention of Cruciferae clubroot disease. Fujian Agric. 2003, 11, 22. [Google Scholar]
  5. Huang, Y.; Xu, L.; Xiao, C.; Liu, C.; Chen, G. Effects of Plasmodiophora brassicae infection on the contents of zeatin and indoleacetic acid in the roots of tumour stem mustard. China Veg. 2014, 2, 41–44. [Google Scholar]
  6. Diederichsen, E.; Frauen, M.; Linders, E.G.A.; Hatakeyama, K.; Hirai, M. Status and perspectives of clubroot resistance breeding in crucifer crops. J. Plant Growth Regul. 2009, 28, 265–281. [Google Scholar] [CrossRef]
  7. Hwang, S.F.; Strelkov, S.E.; Feng, J.; Gossen, B.D.; Howard, R.J. Plasmodiophora brassicae: A review of an emerging pathogen of the Canadian canola (Brassica napus) crop. Mol. Plant Pathol. 2012, 13, 105–113. [Google Scholar] [CrossRef] [PubMed]
  8. Howard, R.J.; Strelkov, S.E.; Harding, M.W. Clubroot of cruciferous crops–new perspectives on an old disease. Can. J. Plant Pathol. 2010, 32, 43–57. [Google Scholar] [CrossRef]
  9. Sun, B.; Shen, X.; Guo, H.; Zhou, Y. Research progress on clubroot disease and disease resistance breeding of cruciferous plants. China Veg. 2005, 4, 34–37. [Google Scholar]
  10. Zhao, L.; Hui, M.; Dong, J.; Jiang, J.; Cheng, Y.; Zhang, E.; Wang, J. Green integrated control technology of clubroot in cruciferous vegetables. China Veg. 2022, 9, 111–114. [Google Scholar]
  11. Zhang, Y.; Ma, X.; Yu, H.; Dong, Z.; Lei, N.; Yu, X. Research progress on integrated control of clubroot in cruciferous crops. China Veg. 2022, 10, 27–37. [Google Scholar]
  12. He, H.; Si, J. Clubroot disease of cruciferae vegetables and its comprehensive prevention and control technology. J. Chang. Veg. 2017, 14, 1–4. [Google Scholar]
  13. Zeng, L.; Ren, L.; Liu, F.; Chen, W.; Chen, K.; Xu, L.; Fang, X. Reaction and resistant gene loci detection of 28 Chinese cabbage cultivars to different Plasmodiophora brassicae strains. Chin. J. Oil Crop Sci. 2017, 39, 532–539. [Google Scholar]
  14. Wang, L.; Wang, X.; Wu, H.; He, M.; Li, Y. Resistance identification and evaluation of clubroot resistant varieties of Chinese cabbage to Plasmodiophora brassicae. China Veg. 2017, 8, 46–50. [Google Scholar]
  15. Zhu, M.; Zhang, S.; Zhang, H.; Zhang, S.; Li, F.; Wang, X.; Wu, J.; Li, G.; Wei, Y.; Yue, L.; et al. Anti-sources screening and molecular marker identification of Chinese cabbage against clubroot. China Veg. 2018, 3, 40–45. [Google Scholar]
  16. Zhang, S.; Zhang, Q.; Si, C.; Wang, Y.; Yang, Z.; Yang, X. Identification of resistance of Chinese cabbage varieties to Plasmodiophora brassicae. Shandong Agric. Sci. 2018, 50, 98–102+108. [Google Scholar]
  17. Wen, J.; Wang, C.; Hua, D.; Zhang, H.; Xu, Y.; Zhang, B. Reaction and resistant gene loci detection of different Chinese cabbage varieties to different Plasmodiophora brassicae strains. Acta Agric. Boreali-Sin. 2019, 34, 103–109. [Google Scholar]
  18. Li, H.; Dong, J.; Wang, Y.; Xiao, C.; Zhao, L. Resistance identification to Plasmodiophora brassicae and character evaluation of clubroot resistant varieties of Chinese cabbage. Chin. Melon Veg. 2020, 33, 39–43. [Google Scholar]
  19. Ma, X.; Zhang, H.; Zhang, S.; Li, F.; Zhang, S.; Li, G.; Liu, X.; Sun, R. Evaluation on resistance of different Chinese cabbage varieties to clubroot pathogens occurred in different regions. China Veg. 2021, 9, 41–47. [Google Scholar]
  20. Wei, X.; Yuan, Y.; Zhao, Y.; Yang, S.; Wang, Z.; Su, H.; Li, J.; Li, L.; Niu, L.; Zhang, X. Identification and detection of clubroot resistance loci of 96 Chinese cabbage cultivars resistance to Plasmodiophora brassicae. Chin. Melon Veg. 2022, 35, 27–34. [Google Scholar]
  21. Chen, X. Identification of Pathogen of Cabbage Clubroot Disease and Screening of Resistant Materials; Northeast Agricultural University: Harbin, China, 2015. [Google Scholar]
  22. Sun, C.; Ma, J.; Lei, L.; Jie, J.; Kang, J. Identification of cabbage germplasm resources with resistance to clubroot and sequence analysis of CRa and Crr1a homologous genes from cabbage. J. Plant Genet. Resour. 2016, 17, 1058–1064. [Google Scholar]
  23. Wang, S.; Wu, Q.; Wang, H.; Yu, L.; Li, J.; Ding, W. Identification of Plasmodiophora brassicae Wor. and resistance assessment of Cabbage (Brassica oleracea var. capitata L.) germplasm. J. Plant Genet. Resour. 2016, 17, 1123–1132. [Google Scholar]
  24. Chen, J.; Ren, X.; Song, H.; Li, C.; Yuan, T.; Si, J. Identification of races of Plasmodiophora brassicae from four different regions and resistance identification of new cabbage cross combinations. J. Southwest Univ. Nat. Sci. Ed. 2016, 38, 68–72. [Google Scholar]
  25. Ma, D.; Pang, S.; Ding, Y.; Jian, Y.; Geng, L. Study on clubroot resistance of different Brassica crops. J. Shihezi Univ. Nat. Sci. Ed. 2016, 34, 164–169. [Google Scholar]
  26. Peng, L.; Zhou, L.; Ren, X.; Song, H.; Li, C.; Si, J. Creating new materials with resistance to clubroot disease by Embryo Rescuing cabbage × Chinese cabbage. J. Plant Prot. 2016, 43, 419–426. [Google Scholar]
  27. Zheng, J.; Wang, X.; Li, Q.; Yuan, S.; Wei, S.; Tian, X.; Huang, Y.; Wang, W.; Yang, H. Characterization of five molecular markers for pathotype identification of the clubroot pathogen Plasmodiophora brassicae. Phytopathology 2018, 108, 1486–1492. [Google Scholar] [CrossRef]
  28. Ma, Y.; Wang, H.; Song, J.; Yang, W.; Jia, H.; Agerbirk, N.; Chen, Y.; Li, C.; Piao, Y.; Li, S.; et al. Identification of Clubroot-Resistant Germplasm in a Radish (Raphanus sativus L.) Core Collection. Agronomy 2024, 14, 157. [Google Scholar] [CrossRef]
  29. Si, J.; Li, C.; Song, H.; Ren, X.; Song, M.; Wang, X. Identification and evaluation of resistance of cabbage to clubroot. J. Southwest Univ. Nat. Sci. Ed. 2009, 31, 26–30. [Google Scholar]
  30. Yuan, T. Identification of Resistance to Cabbage Clubroot Disease and Screening of Molecular Markers; Southwest University: Chongqing, China, 2014. [Google Scholar]
  31. Piao, Z.; Ramchiary, N.; Lim, Y.P. Genetics of clubroot resistance in Brassica species. J. Plant Growth Regul. 2009, 28, 252–264. [Google Scholar] [CrossRef]
  32. Liu, S.; Liu, Y.; Yang, X.; Tong, C.; Edwards, D.; Parkin, I.A.; Zhao, M.; Ma, J.; Yu, J.; Huang, S.; et al. The Brassica oleracea genome reveals the asymmetrical evolution of polyploid genomes. Nat. Commun. 2014, 5, 3930. [Google Scholar] [CrossRef]
  33. Chen, Q. Occurrence and control of clubroot disease of winter sown Chaozhou mustard. Jiangxi Plant Prot. 2004, 3, 122–123. [Google Scholar]
  34. Jiang, H.; Peng, Y.; Dong, D.; Yan, Y.; Wu, C.; Wang, X. Relationship between soil pH and clubroot of Brassica juncea var. tumida Tsen & Lee. J. South. Agric. 2017, 48, 1617–1623. [Google Scholar]
  35. Jiang, H.; Peng, Y.; Yan, Y.; Zhang, Y.; Wu, C.; He, B.; Wang, X. Screening, identification and evaluation of antagonistic bacteria against clubroot of mustard. Plant Prot. 2018, 44, 104–110. [Google Scholar]
  36. Leng, R.; Shen, J.; Dong, Z.; Tang, Y.; Zhao, S.; Yao, Q.; Ren, X. Effects of different chemicals and fertilizers on the control of Fuling stem mustard clubroot disease. China Veg. 2012, 19, 31–32. [Google Scholar]
  37. Liu, D.; Ran, M.; Wang, X.; Zhang, Q. Integrated control of clubroot of leaf mustard (Brassica juncea L.) at seedling stage. J. Anhui Agric. Sci. 2015, 43, 77–79. [Google Scholar]
  38. Liu, L.; Ding, W. Comprehensive prevention and treatment of clubroot in Brassica juncea var. tumida Tsen et Lee. Plant Dr. 2018, 31, 38–39. [Google Scholar]
  39. Liu, L.; Dong, P.; Kuang, M.; Li, S.; Yuan, G.; Ding, W. A preliminary analysis of the functional diversity of the microbial communities in healthy and clubroot infected soil rhizosphere planted with Brassica juncea var. tumida Tsen et Lee. Plant Dr. 2020, 33, 33–38. [Google Scholar]
  40. Tang, K.; He, Y.; Shen, M.; Huang, Q.; Wei, Y.; Huang, R.; Zhao, K. Isolation and screening of antagonistic strains of tuber mustard rhizoma and analysis of their growth promoting characteristics. Sichuan Agric. Sci. Technol. 2022, 8, 53–56. [Google Scholar]
  41. Wang, D.; Tan, Y.; Tian, X.; Zhang, C.; Qin, M.; Pan, L. High throughput analysis on change characteristics of rhizosphere soil fungal community during different occurance times of tuber mustard clubroot disease. China Veg. 2016, 5, 33–37. [Google Scholar]
  42. Wang, X.; Gao, M.; Peng, H.; Zhang, J. Study on controlling of clubroot of tumour mustard (Brassica juncea var. tumida Tsen et Lee). J. Chang. Veg. 2003, 5, 38–39. [Google Scholar]
  43. Wang, X.; Peng, H.; Gao, M.; Han, H.; Zhang, J.; Xiao, C. Preliminary identification of the pathogen of root tumour of stem mustard and factors influencing the incidence of the disease. J. Southwest Agric. 2002, 4, 75–78. [Google Scholar]
  44. Xiao, C.; Guo, X.; Han, H.; Peng, H. Identification of the pathogen for clubroot on diseased stem mustard in Fuling, Chongqing and its major characteristics. J. Southwest Agric. Univ. 2002, 6, 539–541. [Google Scholar]
  45. Hasan, M.J.; Strelkov, S.E.; Howard, R.J.; Rahman, H. Screening of Brassica germplasm for resistance to Plasmodiophora brassicae pathotypes prevalent in Canada for broadening diversity in clubroot resistance. Can. J. Plant Sci. 2012, 92, 501–515. [Google Scholar] [CrossRef]
  46. Sharma, P.; Siddiqui, S.A.; Rai, P.K.; Meena, P.D.; Kumar, J.; Chauhan, J.S. Evaluation of Brassica germplasm for field resistance against clubroot (Plasmodiophora brassicae Woron). Arch. Phytopathol. Plant Prot. 2012, 45, 356–359. [Google Scholar] [CrossRef]
  47. Wei, X.; Li, J.; Zhang, X.; Zhao, Y.; Nath, U.K.; Mao, L.; Xie, Z.; Yang, S.; Shi, G.; Wang, Z.; et al. Fine mapping and functional analysis of major QTL, CRq for clubroot resistance in Chinese cabbage (Brassica rapa ssp. pekinensis). Agronomy 2022, 12, 1172. [Google Scholar] [CrossRef]
Agronomy 14 02042 g001
Figure 1. The specific primers Novel342, Novel407, PBRA_007750, PBRA_008439, and PBRA_009348 were used to identify the pathotype 4 of P. brassicae. Lane M: DNA marker; from top to bottom, the size of band was 4500, 3000, 2000, 1200, 800, 500, and 200 bp, respectively; lanes 1–3 represent swollen root tissues from Xinye county, Henan province; lanes 4–8 are swollen roots of 5 mustard materials; and lane 9 is blank control.
Figure 1. The specific primers Novel342, Novel407, PBRA_007750, PBRA_008439, and PBRA_009348 were used to identify the pathotype 4 of P. brassicae. Lane M: DNA marker; from top to bottom, the size of band was 4500, 3000, 2000, 1200, 800, 500, and 200 bp, respectively; lanes 1–3 represent swollen root tissues from Xinye county, Henan province; lanes 4–8 are swollen roots of 5 mustard materials; and lane 9 is blank control.
Agronomy 14 02042 g001
Agronomy 14 02042 g002
Figure 2. Types and frequency of resistance to clubroot disease in mustard resources. (A). Criteria for disease classification, grade 0, 1, 3, 5, 7, and 9; (B). Resistance level and frequency. HR: high-resistant; R: resistant; MR: moderate-resistant; S: susceptible; HS: highly susceptible.
Figure 2. Types and frequency of resistance to clubroot disease in mustard resources. (A). Criteria for disease classification, grade 0, 1, 3, 5, 7, and 9; (B). Resistance level and frequency. HR: high-resistant; R: resistant; MR: moderate-resistant; S: susceptible; HS: highly susceptible.
Agronomy 14 02042 g002
Agronomy 14 02042 g003
Figure 3. Typical disease resistant and susceptible mustard resources. BC002, BC044, and BC074 are disease-resistant resources; BA022, BA034, and BA164 are susceptible resources.
Figure 3. Typical disease resistant and susceptible mustard resources. BC002, BC044, and BC074 are disease-resistant resources; BA022, BA034, and BA164 are susceptible resources.
Agronomy 14 02042 g003
Agronomy 14 02042 g004
Figure 4. Dissections of cortex of mustard susceptible (A,B) and resistant (C,D) materials after infection by P. brassicae. The scale of (A,C) is 500 μm; the scale of (B,D) is 50 μm; RSP: resting sporangia.
Figure 4. Dissections of cortex of mustard susceptible (A,B) and resistant (C,D) materials after infection by P. brassicae. The scale of (A,C) is 500 μm; the scale of (B,D) is 50 μm; RSP: resting sporangia.
Agronomy 14 02042 g004
Agronomy 14 02042 g005
Figure 5. Types and quantities of resistance to clubroot disease of mustard resources from different original places. HR: high-resistant; R: resistant; MR: moderate-resistant; S: susceptible; HS: highly susceptible.
Figure 5. Types and quantities of resistance to clubroot disease of mustard resources from different original places. HR: high-resistant; R: resistant; MR: moderate-resistant; S: susceptible; HS: highly susceptible.
Agronomy 14 02042 g005
Agronomy 14 02042 g006
Figure 6. Resistance to clubroot disease of different types of mustard resources. (A). Number of materials with different resistance levels. (B). Proportion of materials with different resistance levels in different types of mustard. HR: high-resistant; R: resistant; MR: moderate-resistant; S: susceptible; HS: highly susceptible.
Figure 6. Resistance to clubroot disease of different types of mustard resources. (A). Number of materials with different resistance levels. (B). Proportion of materials with different resistance levels in different types of mustard. HR: high-resistant; R: resistant; MR: moderate-resistant; S: susceptible; HS: highly susceptible.
Agronomy 14 02042 g006
Agronomy 14 02042 g007
Figure 7. Molecular detection of disease resistance gene loci in mustard. CRaR, CRcR, and CRkR represent molecular markers associated to resistant gene loci, and CRaS, CRcS, and CRkS represent molecular markers associated to susceptible gene loci. Lane M: DNA marker; lanes 2, 4, 5, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, and 23 represent BC086, BC087, BC076, BC088, BC077, BC089, BC078, BC090, BC079, BC091, BC080, BC092, BC081, BC082, BC093, BC083, BC094, and BC085, respectively (Table S2); lanes 1, 3, 6, 7, 18, and 24 represent the other 6 tested root mustard germplasm resources.
Figure 7. Molecular detection of disease resistance gene loci in mustard. CRaR, CRcR, and CRkR represent molecular markers associated to resistant gene loci, and CRaS, CRcS, and CRkS represent molecular markers associated to susceptible gene loci. Lane M: DNA marker; lanes 2, 4, 5, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19, 20, 21, 22, and 23 represent BC086, BC087, BC076, BC088, BC077, BC089, BC078, BC090, BC079, BC091, BC080, BC092, BC081, BC082, BC093, BC083, BC094, and BC085, respectively (Table S2); lanes 1, 3, 6, 7, 18, and 24 represent the other 6 tested root mustard germplasm resources.
Agronomy 14 02042 g007
Table 1. Specific primers used for detection of Plasmodiophora brassicae races.
Table 1. Specific primers used for detection of Plasmodiophora brassicae races.
Primer NamePrimer Sequences (5′ → 3′)Product Size (bp)
Novel342-FTCCTCTTGAACCGACACTGC249
Novel342-RCTTCTCTCGCACTAGCCAGG
Novel407-FATTGCGTTGCTGAACTGCTG549
Novel407-RGTGCCCAATAGCAATCGCAG
PBRA_007750-FFCTTCGTGCTGACCGATTCCT638
PBRA_007750-RATAATGCTCTGCGTCAGCCA
PBRA_008439-FTCGGCGACCTGAGCGAGAA651
PBRA_008439-RTCAACATGCGCATAGTAC
PBRA_009348-FCACTGCTATCGTCTCCCTGG509
PBRA_009348-RRCCTGCAATGTTTCGCTGCAA
Table 2. Primers used for detection of clubroot-resistant gene loci.
Table 2. Primers used for detection of clubroot-resistant gene loci.
LociPrimer NamePrimer Sequences (5′ → 3′)Product Size (bp)Reference
Crr1BRMS088FTATCGGTACTGATTCGCTCTTCAACR263/S233[29]
BRMS088RATCGGTTGTTATTTGAGAGCAGATT
Crr2BRMS096FAGTCGAGATCTCGTTCGTGTCTCCCR220/S189[29]
BRMS096RTGAAGAAGGATTGAAGCTGTTGTTG
Crr3OPC11-2FGTAACTTGGTACAGAACAGCATAGR1300/S1000[30]
OPC11-2RACTTGTCTAATGAATGATGATGG
CRaSC2930TFTAGACCTTTTTTTTGTCTTTTTTTTTACR800[31]
SC2930QFCAGACTAGACTTTTTGTCATTTAGAS800
SC2930RCTAAGGCCATAGAAATCAGGTC
CRbKB-FAGAGCAGAGTGAAACCAGAACTR254/S194[32]
KB-RGTTTCAGTTCAGTCAGGTTTTTGCAG
CRcB50-C9FGATTCAATGCATTTCTCTCGATR800[31]
B50-6RFAATGCATTTTCGCTCAACCS800
B50RCGTATTATATCTCTTTCTCCATCCC
CRkHC688-4FTCTCTGTATTGCGTTGACTG
HC688-6RATATGTTGAAGCCTATGTCTR1000[31]
HC688-7RAAATATATGTGAAGTCTTATGATCS1000
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, W.; Song, J.; Zhang, X.; Xu, C.; Han, J.; Li, Z.; Wang, Y.; Jia, H.; Wang, H. Detection of Clubroot Disease Resistance in Brassica juncea Germplasm at the Seedling Stage. Agronomy 2024, 14, 2042. https://doi.org/10.3390/agronomy14092042

AMA Style

Yang W, Song J, Zhang X, Xu C, Han J, Li Z, Wang Y, Jia H, Wang H. Detection of Clubroot Disease Resistance in Brassica juncea Germplasm at the Seedling Stage. Agronomy. 2024; 14(9):2042. https://doi.org/10.3390/agronomy14092042

Chicago/Turabian Style

Yang, Wenlong, Jiangping Song, Xiaohui Zhang, Chu Xu, Jiaqi Han, Zhijie Li, Yang Wang, Huixia Jia, and Haiping Wang. 2024. "Detection of Clubroot Disease Resistance in Brassica juncea Germplasm at the Seedling Stage" Agronomy 14, no. 9: 2042. https://doi.org/10.3390/agronomy14092042

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop