Analysis of the Control Effect of Bacillus amyloliquefaciens C4 Wettable Powder on Potato Bacterial Wilt Caused by Ralstonia solanacearum

Abstract

Potatoes are one of the most important food crops worldwide, but their growth and development are often seriously threatened by potato bacterial wilt. The wettable powder produced by Bacillus amyloliquefaciens C4 under optimized fermentation conditions effectively inhibits potato bacterial wilt. In this study, lipopeptide antibiotics were identified via PCR and MALDI-TOF-MS, and their antibacterial activity was determined. The optimal formulation of C4 wettable powder was optimized via a single-factor experiment combined with a response surface. The effect of C4 wettable powder on potato bacterial wilt was evaluated. In the antibacterial activity test, surfactin showed better inhibition ability. After determining the optimal liquid fermentation conditions and wettable powder formula, the surfactin activity increased to 540.15 mg/L, and the C4 wettable powder activity reached 69.67 × 10⁸ cfu/g. The results of the pot experiment showed that the best cost-effectiveness was achieved under 500 times dilution and spraying, with a control effect of 79.05 ± 24.79%. The physiological and biochemical results showed that C4 wettable powder could induce rapid defense enzyme responses in leaves and enhance plant resistance to pathogenic bacteria. The results showed that C4 wettable powder effectively controlled potato bacterial wilt, and its application method was determined.

1. Introduction

Potato (Solanum tuberosum L.) is an annual herb of the Solanum genus in Solanaceae Juss. It is a significant food crop globally, with production and consumption ranking third in the world after wheat and rice in 2023 [1]. Potatoes are nutritionally complete, resilient, and less resource-intensive and have high yield potential [2], and their cultivation contributes to maintaining the nutritional structure of the world’s population and is an important livelihood for millions of people [3]. However, potato is often exposed to disease factors that affect potato yield during cultivation [4]. Potato diseases include bacterial wilt caused by Ralstonia solanacearum, late blight caused by Phytophthora infestans, and early blight caused by Alternaria solani [5]. Potato bacterial wilt can significantly reduce the yield and quality of potatoes, and even cause widespread death and crop failure [6]. It is estimated that each year the pathogen causes a loss of about USD 1 billion to the global economy as a result of blight [7]. Multiple strategies have been used to control the disease, including chemical agents, crop rotation, and breeding resistance, but none are fully effective at protecting potatoes from bacterial wilt infection [8]. As an alternative control method, biological agents have attracted ever more attention in modern agricultural systems due to their advantages for environmental protection, the environment, and human health and safety [9].

Biocontrol agents mainly include microorganisms as active ingredients and are used to increase the effectiveness of crop protection products for the efficient control of plant diseases. Formulations are mainly in solid form, such as wettable granules, wettable powders, and wettable dusts [10]. Among them, wettable powders are more widely used to control leaf and stem diseases in plants [11]. Many microbial biocontrol bacteria can be made into wettable powders, and there are about 200 wettable powder products among the registered microbial fungicides. For example, the wettable powder of Bacillus amyloliquefaciens B15 has a good effect on the application of the powder and can prevent and control grape disease, growing on average 70% or more in grape diseases, and achieve an inhibition rate of 77.32% for grapes in cellar storage [12]. The wettable powder of Bacillus thuringiensis SCAU-IFCF01 combined with Bacillus thuringiensis could control Plutella xylostella, significantly reducing Plutella xylostella (L.) (Lepidoptera: Plutellidae)’s life span and fecundity [13]. However, as biocontrol agents are often unstable and can be affected by environmental factors such as time, pH, temperature, pressure, and the amount of water, biocontrol agent activity decreases over time, reducing the effectiveness of plant disease control [14]; inappropriate pH levels reduce their effectiveness by reducing agents’ ability to colonize leaves, while temperature, pressure, and water amount also affect biocontrol agent stability [15,16].

Surfactin, a class of biosurfactants, was discovered by Arima in the fermentation broth of Bacillus subtilis back in 1968 [17], and numerous studies have shown that this lipopeptide not only reduces the surface tension of water, potentially valuable for industrial applications, but also has a certain inhibitory effect on viruses, mycoplasmas, and plant pathogens. It also has stable physical and chemical properties, being resistant to high temperatures and strong acids and alkalis and can spontaneously degrade [18]. Bacillus amyloliquefaciens is widely used as a biocontrol bacterium due to its strong bacterial inhibitory function, broad inhibitory spectrum, diverse antimicrobial metabolites, and good resistance [19]. In recent years, studies have found that Bacillus sp. can spontaneously synthesize surfactin, fengycin, and other substances through the non-ribosomal pathway and that it significantly inhibits many pathogenic bacteria [20,21,22]. Therefore, the development of a wettable powder of Bacillus amyloliquefaciens C4 and its application in agricultural production could effectively prevent and control plant diseases, reduce pesticide residues, reduce environmental pollution, improve the quality of agricultural products, and promote plant growth.

This study investigated the major bioinhibitory activities of Bacillus amyloliqueticus C4 and its role in potato bacterial wilt management. In this study, we used PCR to identify genes responsible for the three lipopeptide antibiotics created using C4 and disk diffusion and MALDI-TOF-MS for the determination of these lipopeptide antibiotics. We also investigated the antibacterial activities of these three lipopeptide antibiotics against the growth of potato bacterial wilt. In addition, fermentation conditions of C4 wettable powder were optimized via a single-factor experiment combined with the response surface method to increase the number of viable bacteria in fermentation broth and reduce fermentation production cost. Pot experiments and other methods were used to evaluate its effect on potato bacterial wilt. We explored the role of C4 wettable powder in potato resistance to bacterial wilt stress, providing insights into bacterial wilt control. The development of C4 wettable powder determined the appropriate dosage parameters and application methods for potato bacterial wilt control and expanded the application scope of this preparation in biological control.

2. Materials and Methods

2.1. Preparation of Reagents and Microbial Inocula

The experiment employed the Atlantic variety of potatoes provided by the Heilongjiang Academy of Agricultural Sciences. The microbial inoculum (Bacillus amyloliquefaciens C4 and Ralstonia solanacearum; preservation numbers: CGMCC NO.15178 and CGMCC NO.1.12711) was provided and preserved by the Biological Inoculation Research and Development Center of Northeast Agricultural University, Harbin, Heilongjiang, China. The Bacillus amyloliquefaciens C4 used in this study was cultured in 50 mL of LB liquid medium in an SPH-2102C shaker (Shishan Laboratory Equipment Inc., Shanghai, China) for 12 h at 37 °C and constant shaking at 160 rpm. The fermentation broth was prepared and set aside before being centrifuged at 4 °C and 8000 rpm for 15 min, and the resulting supernatant was decontaminated through a 0.22 μm filter membrane (0.22 μm, nylon) and then used for the bacterial inhibition assay. The prepared C4 fermentation broth was adjusted to pH 2.0 by adding 6 mol/L of HCl and stored overnight at 4 °C. Then, the precipitate was obtained via centrifugation at 3200 rpm for 25 min. The precipitate was extracted twice with methanol (the total volume of methanol was 1/10 of the volume of fermentation broth) for 2 h each time, and the methanol extract was combined. The methanol extract was concentrated under reduced pressure and passed through a 0.22 µm filter membrane (0.22 μm, nylon), which resulted in the crude extract of lipopeptide compounds, and stored at −20 °C [23]. Ralstonia solanacearum was grown on PDA and incubated at 28 °C.

2.2. Determination of Antibacterial Effect and Growth

The growth of bacteria was monitored via the bacterial density (OD600) method [24] and the dilution plate method [25]. The biocontrol fermentation broth was collected, and the sterile liquid medium was used as a control. The absorbance at 600 nm was measured via a T6 ultraviolet spectrophotometer (Puxi General Instrument Inc., Beijing, China), and the growth of the C4 strain viable number was recorded from 1 to 24 h.

The inhibitory activities of the Bacillus amyloliquefaciens C4 fermentation broth, supernatant, and crude lipopeptide extract were determined using the LB plate disk diffusion method [23]. The inhibition of bacteria was evaluated as follows: incubation on LB plates for 1 d at 37 °C. Holes with diameters of 5 mm were punched at the edge of the colony and then placed in the center of the LB plate. To test the antibacterial activity of strain C4, LB plates were inoculated with 100 μL of Ralstonia solanacearum to achieve homogeneous spread, and 15 μL each of C4 ferment, supernatant, and lipopeptide extract were pipetted and added to the center of the plate. Each treatment was repeated three times, while 15 μL of water was used as a control treatment. The presence of the inhibitory ring was observed and recorded, and the width of the inhibitory ring in the medium was measured with a digital caliper.

2.3. Analysis of Antibacterial Agents

The iturinC, sfrAA, spaS, and fenD genes are closely related to the biosynthesis of iturin, surfactin, fengycin, and subtilin antimicrobial peptides produced by Bacillus species, respectively. These antimicrobial peptides can effectively inhibit the growth of various pathogenic microorganisms, thereby protecting plant health [20]. Therefore, primer sequences were designed to amplify the iturinC, sfrAA, spaS, and fenD genes (

Table 1. Primers used for PCR detection.

Primer Name	Primer Sequence (5′-3′)	Target Gene
IturinC Forward Primer	GGCTGCTGCAGATGC	iturinC
IturinC Reverse Primer	TCGCAGATAATCGCA
spaS Forward Primer	GGTTTGTTGGATGGA	spaS
spaS Reverse Primer	GCAAGGAGTCAGAGC
srfAA Forward Primer	TCGGGACAGGAAGAC	srfAA
srfAA Reverse Primer	CCACTCAAACGGATA
fenD Forward Primer	GGCCCGTTCTCTAAAT	fenD
fenD Reverse Primer	GTCATGCTGACGAGAGCAAA

), and primers were synthesized by Shanghai Sangong Biological Engineering Co. (Shanghai, China). The template DNA of Bacillus amyloliquefaciens C4 was extracted and amplified via PCR [20]. The synthesis reaction system was as follows: 25.0 μL of 2*PCR mix, 2.0 μL of upstream primer, 2.0 μL of downstream primer, 1.0 μL of template DNA, and 20.0 μL of ddH₂O. The PCR amplification program was as follows: 95 °C for 3 min, 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min for 30 cycles. The extension was extended at 72 °C for 7 min. Sequencing was performed by Jilin Kumai Biotechnology Co. (Jiaohe, China). DNAMAN software v.9.0 (LynnonBiosoft Co., San Ramon, CA, USA) was used to compare sequencing results. The prepared crude extract of Bacillus amyloliquefaciens C4 was then extracted by adding methanol and stirring for 2 h with a SH05-3G magnetic stirrer (Instrument and Equipment Co., Shenzhen, China), and the yellowish-brown substance was obtained via rotary evaporation on a Hei-VAP rotary evaporator (Heidolph Co.; Schwabach, Germany). Antibacterial agents were also determined by Acquity UPLC BEH C18 quadrupole time-of-flight tandem mass spectrometry (Wotesi Co.; Shanghai, China) [23].

The isolation method of lipopeptide antibiotics was used [20]. Surfactins, fengycins, and iturins were prepared in a methanol solution at a concentration of 1 mg/L for the antibacterial test. The antibacterial activity of the drug against Ralstonia solanacearum was observed. The LB plate was inoculated with 100 μL of Ralstonia solanacearum for uniform coating, and 100 μL each of the three lipopeptide antibiotics were dotted at equal distances. 100 μL was added, methanol was used as a control and a blank control was set, and each treatment was repeated in triplicate. The results were observed and recorded after 1 day [20].

2.4. Optimization of Fermentation Conditions for Surfactins

The basic fermentation conditions were as follows: pH 7, inoculated with 3% Bacillus amyloliquefaciens C4 and fermented for 12 h at 37 °C and 160 rpm in a SPH-211B-GZ shaker (Shiping Inc., Shanghai, China). The optimized fermentation conditions were as follows: (1) Initial pH—The initial pH was adjusted to 5, 7, and 9 using a PHS-3C pH meter (Gaozhi Precision Instrument Inc., Shanghai, China), while other fermentation conditions remained unchanged. (2) Cultures were incubated in a DRP-9162 constant temperature incubator (Senxin Biotechnology Inc., Shanghai, China) at 23 °C, 28 °C, and 33 °C, and the other fermentation conditions were unchanged. (3) Speed—The speed was adjusted to 170 rpm, 200 rpm, and 230 rpm using a SPH-211B-GZ shaker (Shiping Inc., Shanghai, China), and the other fermentation conditions were unchanged. (4) Inoculum amount—the inoculum amount of microorganisms was set at 3%, 5%, and 7%, and the other fermentation conditions remained unchanged. Finally, the basic and optimized fermentation conditions were selected to determine the viable Bacillus amyloliquefaciens C4 and surfactin contents. The viable count of Bacillus amyloliquefaciens C4 was determined via the plate colony counting method using solid LB medium. Surfactin quantification was performed via HPLC on an Agilent 1260 HPLC system [22] (Agilent Inc., Santa Clara, CA, USA) coupled to an ultraviolet (UV) detector. Each 20 μL sample was injected into an AdvanceBio Peptide Map column (4.6 × 150 mm, 2.7 microns). The mobile phase consisted of solvent A, acetonitrile with 0.1% TFA, and solvent B, water with 0.1% TFA, using a linear gradient elution program as follows: 0–9 min, 60–93% A; 0–9 min, 40–7% B; 9–20 min, 93–93% A; 9–20 min, 7–7% B. Elution was carried out at a flow rate of 0.84 mL/min. The surfactin content was measured at a wavelength of 210 nm at 35 °C. The peak map of the surfactin standard is shown in Appendix A Figure A1.

2.5. Screening Methods for Carriers and Additives of Biocontrol Agents

The carriers, additives, and adjuvants that we used in experiments are listed in

Table 2. The carriers, additives, and mixing ratios used in this study.

Name	Materials to Be Selected	Mixing Ratio
Carrier	Calcium carbonate, talc powder, kaolinite, diatomite, and precipitated silica	5% (w/v)
Wetting agent	Sodium dodecyl benzene sulfonate, saponin powder, and sodium diisobutyl naphthalenesulfonate	250 μg/mL
Dispersant	Sodium lignosulfonate, sodium tripolyphosphate, sodium carboxymethyl cellulose, and polyvinyl alcohol	1500 μg/mL
Protectants	Humic acid, methylcellulose, and xanthan gum	50 μg/mL

. First, 0.1 mL samples of each diluted 10⁸ solution of the biocontrol bacteria fermentation broth were spread on the medium containing various carriers and additives. The mixing ratios are listed in Table 2. Each treatment was repeated three times using LB medium as a control. Cells were incubated at 37 °C for 12 h, and the number of colonies in each medium was recorded. To determine the proportion of each component, the number of viable bacteria was determined.

2.6. Selection of Single-Factor Experiments and the Box–Behnken Design

Kaolin, sodium dodecyl benzene sulfonate, sodium lignin sulfonate, and humic acid were selected as additives for further investigation, and the one-factor experimental setup is shown in Appendix A 

Table A1. Single factor test design table.

Factor	Level (%)
	1	2	3	4	5	6
KA	0	10	15	20	25	30
SDBS	0	4	6	8	10	12
SL	0	3	5	7	9	11
HA	0	2	4	6	8	10

. Then, the effects of various adjuvants on the number of viable bacteria in the powder prepared via mixing with the fermentation broth of strain C4 were tested.

Using the single-factor test, three factors were identified that significantly influenced the viability of the strains. The Box–Behnken design (BBD) was used to further optimize the three main factors affecting the viable number of bacteria: sodium dodecyl benzene sulfonate (A), sodium lignosulfonate (B), and humic acid (C). Three factors and three levels (−1, 0, 1) were investigated. The experimental design included 12 factorial points and three central points. Data were adjusted using Design-Expert 12.0 (Stat-Ease Inc., Minneapolis, MN, USA) at a significance level of p < 0.05.

2.7. RSM Analysis and Model Validation

The response surface plots of the quadratic polynomial models were obtained by changing one of the independent variables within the experimental range and keeping the others constant at the center to understand the effect of the independent variable on the dependent variable. RSM edge analysis was performed using Design-Expert 12.0 statistical software (StatEase Inc., Minneapolis, MN, USA) to predict the number of maximum viable bacteria. After the optimal fermentation parameters were predicted, fermentation verification experiments were carried out using the optimized medium.

2.8. Preparation, Quality Testing, and Analysis of the Biocontrol Effect of Wettable Powder

The preparation process of the biocontrol bacteria was as follows: the fermentation broth of Bacillus amyloliquefaciens C4 was mixed with the selected carrier, wetting agent, dispersant, and protective agent at the optimized ratio simultaneously, and the wettable powder of Bacillus amyloliquefaciens C4 was prepared via spray drying with stirring. We adjusted the pH of the C4 wettable powder of Bacillus amyloliquefaciens to 7 and then FD-15-T-1000A crushed it (Trade Inc., Shengzhou, China) to a ZS-400 95% sieve (ZhenXing Inc., Guangzhou, China) of 45 µm for the final preparation for quality testing. The treatment’s effect on bacterial activity was determined by recording colony numbers via colony counting on plates. LB solid medium was selected to detect bacteria in the samples using the plate colony counting method. The total number of visible colonies was counted to determine the number of microbial contaminants. Test indicators: pH, fineness, wet time, suspension rate, storage stability, and desiccation loss. For more information, please refer to the standard issued by the International Cooperative Council for Pesticide Analysis [26].

We diluted the wettable powder 300, 500, and 1000 times and set it aside. Potato leaves with similar morphological sizes were selected and grown as test tube seedlings for 30 days after 3 weeks of incubation. Defatted cotton wool was moistened with distilled water, wrapped around the petiole, and placed in a Petri dish with filter paper. The original bacterial solution and C4 wettable powder at different dilutions were aspirated separately, with the control serving as the H₂O treatment, and 30 μL of each sample was aspirated and evenly applied to the leaf surface. Petri dishes were placed in a light incubator with parameters of 20 °C, 16 h of light, and 8 h of darkness and removed after 1 day of BSG-400 incubation (Brosun Medical Biology Inc., Shanghai, China). The leaves were then inoculated with 20 µL of Ralstonia solanacearum and returned to the light incubator for BSG-400 incubation (Brosun Medical Biology Inc., Shanghai, China). After 6 days, leaves were removed for observation, and photographs were taken to record and measure the diameters of the lesions.

Pot experiments were carried out in the greenhouse of Northeast Agricultural University. C4 bacterial solution with a bacterial concentration of 48.55 × 10⁸ cfu/mL was prepared in advance. Five treatments were set up, including Bacillus amyloliquefaciens C4 as the experimental group. C4 wettable powder diluted 300, 500, and 1000 times in distilled water was used as the experimental group. Water treatment served as a blank control, and assessments were performed in triplicate. A total of 150 potato plants were selected and divided into 50 groups. There were 3 repeats in each group: (1) First, 100 mL of pathogen solution was sprayed on the leaves. (2) After 15 days, the leaves were sprayed with C4 strain and different concentrations of wettable powder. The incidence, disease index, and control effect were observed after 30 days [24].

2.9. Determination of Physiological Indices Related to the Disease Resistance of Bacillus amyloliquefaciens C4 Wettable Powder

Potato leaves were incubated in vitro at 28 °C under a 16/8 h light cycle. Potato leaves were inoculated with 20 μL of the Ralstonia solanacearum bacterial suspension (OD600 = 0.8) to diffuse Ralstonia solanacearum into potato leaves’ veins. At the same time, potato leaves were sprayed with C4 and C4 wettable powder. We used C4 as a control. Potato leaves were sampled at 1, 2, 3, and 4 days after pathogen treatment. Next, 0.1 g of tissue from each group was flash-frozen and stored in a refrigerator at −80 °C for later use. Subsequently, SOD, POD, and PAL enzyme activities and MDA contents were determined using kits [25].

2.10. Statistical Analysis

All the experiments were replicated three times for repeatability. One-way analysis of variance (ANOVA) was used for all the analyses of growth curve determination, optimized surfactin fermentation conditions, wettable powder selection, potato leaf biocontrol, pot experiments, and physiological index data using SPSS 26.0 software (SPSS Inc., Chicago, IL, USA). Growth curve determination, optimized surfactin fermentation conditions, the selection of wettable powders, the biocontrol of potato leaves, pot experiments, and physiological indices are presented as means and standard errors. The difference was statistically significant (p < 0.05).

3. Results

3.1. Studies on the Antibacterial Activity and Growth of Bacillus amyloliquefaciens C4

The growth of the strain C4 is shown in Figure 1a. The growth phase of C4 was from 1 to 4 h, and the concentration of C4 was 1.4 × 10⁶–2.7 × 10⁷ cfu/mL (OD₆₀₀ = 0.105–0.385). The logarithmic growth phase of C4 extended from 4 to 12 h, and the concentration of C4 was 2.7 × 10⁷–36.31 × 10⁸ cfu/mL (OD₆₀₀ = 0.385–1.779). From 12 to 24 h, the number of viable bacteria remained stable with the increase in culture time, and the concentration of bacteria was 36.31 × 10⁸–37.53 × 10⁸ cfu/mL (OD₆₀₀ = 1.779–1.830). Therefore, 12 h was the optimal fermentation time (Figure 1a). The inhibitory effect of C4 fermentation broth, supernatant, and crude extract of lipopeptide cultured in LB medium on Ralstonia solanacearum was investigated. The disk diffusion method was used to detect Bacillus amyloliquefaciens C4 inhibition (Figure 1b). The experiments’ results were as follows: the zone of inhibition of C4 fermentation broth on the growth of Ralstonia solanacearum was 11.6 ± 0.37 mm, the diameter of the zone of inhibition of C4 supernatant was 11.58 ± 0.09 mm, and the zone of inhibition of C4 lipopeptide crude extract on Ralstonia solanacearum was 11.7 ± 0.33 mm (

Table 3. Antibacterial effect of Bacillus amyloliquefaciens C4 on Ralstonia solanacearum.

Treatment	Diameter of Inhibition Zone (mm)
Fermentation broth (A)	11.6 ± 0.37
Supernatant fluid (B)	11.58 ± 0.09
Crude extract of lipopeptide (C)	11.7 ± 0.33

). Although the results showed that there was no significant difference in antibacterial effect between the C4 fermentation broth, supernatant, and lipopeptide crude extract (Figure 1b), To further explore and obtain more accurate antibacterial active substances, we selected lipopeptide crude extract as the object of the follow-up study to achieve a better antibacterial effect.

3.2. Study on Antibacterial Active Ingredients

The results of the PCR amplification of the iturinC, sfrAA, and fenD synthesis genes of Bacillus amyloliquefaciens C4 are shown in Figure 2. Bacillus amyloliquefaciens C4 showed bands at about 391 bp, 196 bp, and 246 bp, respectively, which indicated that the iturinC, sfrAA, and fenD synthesis genes could be amplified, and the gene sequences were 100% similar, whereas spaS were absent (

Table A2. iturinC, SrfAA, and fenD gene sequences.

Gene Name	Gene Sequences
>iturinC (CP029466.1)	TTATTCCAGTTTGCTATGGGTGAAGACTTGATTGACATAAAGTT ATGTTTTAATGAACAAGTCTATGATCGTCAGTATATGATGCAGG TGCTCGGACATTTAAACCGGCTATTTTCTGTCATATTATTTCAGC CTGAGCTCCCCCTCGGTCAAGTGAATATTTTGCCAGAATCGGAG ACACATTCACTTCTCGTTGACAATCAAACTGCGAAAACTGAATA TCCGCGGGATAAGACGGTTTATCAGTTATTCGAAGAACAGATG AAACGAACACCGGATCAAGCAGCCGTTATTTACGGAGAAAAGC AATTCACATATCGTCAGCTCAATGAACGTGCCAATCAATTAGCC CGAACGTTAAGGAAAAAGGGGGTAAAGACGGATCGGCTCA
>SrfAA (MK570509.1)	ACAGGAAGACATCATCGTGGGAACACCGTCAGCGGGAAGAAA TCACTCCGATACCGAGGGGCTTATCGGGATGTTTGTCAACACG CTTGCGCTGCGAAGCTCCGTGAAGCAGGATCAGACATTTGCCG GCTTGTTAGGTCATGTGCGCAAGCAGGTGCTGGATGCGTTTTCT CATCAGGATTATCCGTTTGAGTGG
>fenD (CP044132.1)	AATCCATGTTTCTCTGAAGCTCTGCGACGCGGCGTTTTACAAAA CGTTCCTTCTCATGCTCATCGCCTTCCATTTCTAATATGGTCAGG CTGTAAAGCTGCTCATCTGCGAGGTCAGCCGGTCTGTTGAAGA GGAGAAGACCTTTCTCTTCGTCTTTTTTGCAGACAATGCGCAAG GCATCATGATGAACGGTAATGGCTTTTAACGTTTTCCTCAGAGC CTCTTCATCTATTGAATTTGCTCTCG

). This result suggests that surfactins, iturins, and fengycins might exist in the genome of Bacillus amyloliquefaciens C4, and lipopeptide antibiotics might be produced by the C4 strain.

Lipopeptides extracted from Bacillus amyloliquefaciens C4 were identified and analyzed via quadrupole time-of-flight tandem mass spectrometry, and their molecular weights were accurately determined. The results are shown in Appendix A Figure A2. An isolate of three lipopeptide antibiotics secreted by Bacillus amyloliquefaciens C4 was subjected to matrix-assisted dissociation mass spectrometry, and the characteristic peaks corresponding to the three antibiotics produced by C4 are shown in

Table 4. Calculated mass values of surfactins, fengycins, and iturin A in culture lipopeptide extracts from C4.

Lipopeptides		Retention Time (min)	Mass Value (M + H+)
Surfactins	Surfactin A (C13)	15.755	1008.6572
	Surfactin B (C14)	15.861	1022.6754
	Surfactin C (C15)	16.325	1036.6852
	Surfactin C (C16)	17.230	1050.7072
Fengycins	Fengycin B (C16)	11.180	1463.8037
	Fengycin C (C17)	11.262	1477.8188
	Fengycin D (C18)	11.730	1491.8331
Iturin A	IturinA (C13)	15.848	1030.6416
	IturinA (C14)	16.732	1044.6548
	IturinA (C15)	17.549	1058.6685
	IturinA (C16)	18.005	1072.6885

. The peaks of 70–100% methanol-water eluate were in the range of m/z = 1 008.6572, 1022.6754, 1036.6852, and 1050.7072 Da, belonging to the proton adduct peaks of C13-C16 surfactins (Table 4 and Appendix A Figure A2a–d). The signal bands of 70% methanol water eluate were at m/z = 1463.9, 1477.9, 1491.9, and 1505.9 Da, corresponding to fengycins of C14, C16, and C8 (Table 4 and Appendix A Figure A2e,f). The peak values (m/z) of 70–100% methanol water eluent of Bacillus amyloliquefaciens C4 were 1030.6416, 1044.6548, 1058.6685, and 1072.6885 Da, respectively, with a difference of 14 Da. They were the homologues of fatty acid chains with a methylene (-CH2-) difference. They belong to the proton addition peak of iturin A of C13, C14, C15, and C16 (Table 4 and Appendix A Figure A2g–j). For the analysis of lipopeptide mass spectrum peaks, refer to VATER et al. [27].

3.3. Optimization of the Culture Conditions for Surfactin

The antibacterial activities of the three lipopeptide antibiotics against Ralstonia solanacearum are shown in Figure 3a. The results showed that surfactins were the most effective among the three lipopeptide antibiotics (Figure 3a). The activity of fengycins was second. However, iturins showed the smallest inhibitory effect on Ralstonia solanacearum (

Table 5. Antibacterial activity of lipopeptide antibiotics against Ralstonia solanacearum.

Lipopeptide Antibiotics	Diameter of Inhibition Zone (mm)
surfactins	13.95 ± 0.23
fengycins	12.87 ± 0.05
iturins	11.75 ± 0.16

). The results of this study showed that surfactins were secreted in high quantities and had a strong antibacterial effect on C4 strains. Therefore, the content of surfactin was chosen in this study. The R value of the range analysis table (Appendix A 

Table A3. Statistical results of orthogonal experiment on optimization of fermentation and culture conditions.

Ordinal Numbers	Test Factors				Bacterial Count (×108 CFU.mL−1)
	pH	Temperature (°C)	Speed (r.min−1)	Inoculum (%)
1	5	23	170	3	51.67 ± 3.86
2	5	28	200	5	49 ± 4.32
3	5	33	230	7	39.33 ± 0.94
4	5	23	170	5	48.37 ± 2.98
5	5	28	200	7	50.63 ± 3.07
6	5	33	230	3	37.29 ± 1.03
7	7	23	200	7	59.33 ± 2.49
8	7	28	230	3	55.33 ± 7.58
9	7	33	170	5	35 ± 1.41
10	7	23	230	3	51.09 ± 1.32
11	7	28	170	5	48.31 ± 0.36
12	7	33	200	7	40.07 ± 2.09
13	9	23	230	5	38.67 ± 1.25
14	9	28	170	7	46 ± 1.63
15	9	33	200	3	57.67 ± 4.50
16	9	23	230	7	40.87 ± 0.92
17	9	28	200	5	44.31 ± 1.83
18	9	33	170	3	51.27 ± 3.33
k1	46.04	48.33	46.77	50.72
k2	48.19	48.93	50.17	43.92
k3	46.47	43.44	43.76	46.04
R	2.15	5.49	6.41	6.80

) and the F value of the variance analysis table (Appendix A 

Table A4. Variance analysis table of orthogonal test.

	Sum of Squares	Degree of Freedom	Mean Square	F	P
pH (A)	15.446	2	7.723	0.290	0.755
Temperature (B)	246.970	2	123.485	4.643	0.041
Speed (C)	252.482	2	126.241	4.747	0.039
Inoculum (D)	379.063	2	189.532	7.126	0.014

) showed that the order of factors affecting the C4 fermentation of Bacillus amyloliquefaciens was as follows: inoculum > speed > temperature > pH. Analysis of variance showed that inoculum, speed, and temperature significantly affected the number of viable bacteria (Appendix A Table A4). The pH had no significant effect on the increase in the number of viable bacteria (Appendix A Table A4). According to the range analysis in Appendix A Table A4, the optimal fermentation conditions were a pH of 7.0, a temperature of 28 °C, a rotational speed of 200 rpm, and an inoculum volume of 3%. Under these optimized conditions, the number of viable bacteria reached 73.33 × 10⁸ cfu/mL (Appendix A Table A3 and Table A4). The activity of surfactin after optimization was increased 1.45 times compared with that before optimization, and the content of surfactin after optimization was 540.138 mg/L, which was significantly different from that before optimization (CK) (Figure 3b, Appendix A Figure A3 and Figure A4).

3.4. Screening of Carriers and Adjuvants for C4 Wettable Powders

In Figure 4a, it is shown that each vector had a distinct effect on the activity of the biocontrol bacteria; kaolin (KA) had the smallest effect on biocontrol activity, and the viable number of bacteria was 92.3 × 10⁸ cfu/mL. In addition, the wetting agent had an apparent effect on the activity of the biocontrol bacteria. Indeed, the wetting effect of sodium dodecyl benzene sulfonate was greater than those of saponin powder and sodium diisobutyl benzene sulfonate (SDBS), and the number of viable bacteria was 43.6 × 10⁸ cfu/mL (Figure 4b). Therefore, SDBS was chosen as the wetting agent. Moreover, the dispersant significantly affected the activity of biocontrol bacteria. Among the dispersing agents, sodium lignosulfonate (SL) had the smallest effect on the activity of biocontrol bacteria, with a viable number of 50 × 10⁸ cfu/mL, while sodium tripolyphosphate inhibited the activity (Figure 4c). Therefore, we chose SL as the dispersing agent. In Figure 5d, all three protectants have obvious effects on biocontrol activity. Xanthan gum (XG) and methylcellulose (MC) showed significant inhibitory effects, and the viable counts were 70.3 × 10⁸ cfu/mL and 70 × 10⁸ cfu/mL, respectively. Humic acid (HA) had the smallest effect on the activity of the biocontrol bacteria, with a viable bacterial count of 91.6 × 10⁸ cfu/mL. Thus, it was chosen as a protective agent (Figure 4d). Analysis of variance (ANOVA) showed that each component had a great effect on the activities of the bacterial preparations (Figure 4).

3.5. Selection of Carrier and Additive Amounts of Wettable Powder

Figure 5 shows that different addition amounts of carrier and auxiliary agents had certain effects on the viable count of strain C4. With the addition of kaolin increasing, the biocontrol activity increased first and then decreased. The biocontrol bacteria showed high activity and significant differences when the addition amount was 20%, as the number of viable bacteria was 47.6 × 10⁸ cfu/g (Figure 5a). In addition, the biocontrol activity was best when using 6% sodium dodecyl benzene sulfonate, and the viable number of bacteria was 52.3 × 10⁸ cfu/g. As the amount added increased, excessive sodium dodecyl benzene sulfonate inhibited biocontrol activity (Figure 5b). Among them, with 5% the addition of sodium lignosulfonate, the biocontrol activity reached the highest value, the number of viable bacteria was 63.3 × 10⁸ cfu/g, and the difference was significant (Figure 5c). When the amount of humic acid was 2–6%, the biocontrol activity showed an upward trend. When the amount of addition was 6%, the activity of biocontrol bacteria was least affected, the number of viable bacteria was 60 × 10⁸ cfu/g, and there was a significant difference (Figure 5d). Therefore, the optimal ratio of carrier and assistant is 20% kaolin, 6% sodium dodecyl benzene sulfonate, 5% sodium lignin sulfonate, and 6% humic acid.

3.6. The Influencing Factors of RSM Were Optimized

Based on the BBD method, the optimal conditions for sodium dodecyl benzene sulfonate, sodium lignin sulfonate, and humic acid were further optimized and analyzed, and the results are detailed in Appendix A 

Table A5. Response surface test factor level table.

Test Factors	Level
	−1	0	1
A (Sodium dodecyl benzene sulfonate)	5	6	7
B (Sodium lignosulfonate)	4	5	6
C (Humic acid)	5	6	7

. The optimization experiment was designed by using Design Expert software v.13.0 and the BBD matrix, which involved 17 experimental points of 3 factors at 3 levels of −1, 0, and +1, and the center point of each experiment was repeated three times to ensure data reliability (Appendix A 

Table A6. Response surface test design and results table.

Ordinal Numbers	A (Sodium Dodecyl Benzene Sulfonate)	B (Sodium Lignosulfonate)	C (Humic Acid)	Bacterial Count (×108 CFU.g−1)
1	−1	−1	0	55.33
2	0	0	0	66.67
3	0	0	0	65.33
4	1	1	0	52.33
5	1	−1	0	57.67
6	0	0	0	66.33
7	−1	1	0	52
8	0	1	−1	56
9	0	0	0	68
10	1	0	1	50
11	0	−1	−1	60
12	0	0	0	67.33
13	−1	0	1	51.67
14	−1	0	−1	52.67
15	0	−1	1	58.33
16	0	1	1	51.33
17	1	0	−1	58

). A second-order response surface model (Y = 66.73 + 0.79 A − 2.46 B − 1.92 C − 0.50 AB − 1.75 AC − 0.75 BC − 7.86 A² − 4.53 B² − 5.78 C²) with linear, quadratic, and interaction terms was established via regression analysis to predict the effects of the three additives on the biocontrol activities. The coefficient estimation and significance test of this model indicated that the effects of A, B, and C were all statistically obvious, with p values of 0.0433, 0.0001, and 0.0086, respectively, thus confirming these factors’ significant influence on biocontrol activity. The statistical evaluation index of the model (p < 0.0001) indicated that it was highly reliable. In addition, the regression coefficient R² of the model was 0.9910, highly consistent with the adjusted R² (Adj R² = 0.9795), further verifying the model’s accuracy. Finally, the terms A, B, C, AB, BC, A², B², and C² in the model were confirmed to be significant terms, indicating that these factors and their interactions have important effects on biocontrol activity (Appendix A 

Table A7. Response surface analysis of variance table.

Source	Sum of Variance	Degree of Freedom	Mean Square	F-Value	p-Value	Significance
Model	639.49	9	71.05	86.02	<0.0001	**
A-Sodium dodecyl benzene sulfonate	5.01	1	5.01	6.06	0.0433	*
B-Sodium lignosulfonate	48.36	1	48.36	58.55	0.0001	**
C-Humic acid	29.41	1	29.41	35.61	0.0006	**
AB	1.01	1	1.01	1.22	0.3054
AC	12.25	1	12.25	14.83	0.0063	**
BC	2.25	1	2.25	2.72	0.1428
A2	260.44	1	260.44	315.30	<0.0001	**
B2	86.59	1	86.59	104.82	<0.0001	**
C2	140.78	1	140.78	170.43	<0.0001	**
Residual	5.78	7	0.83
Lack of Fit	1.69	3	0.56	0.55	0.6753
Pure Error	4.10	4	1.02
Total	645.27	16

Note: * The difference is significant (p < 0.05); ** The difference is extremely significant (p < 0.01).

).

Three significant influencing factors, namely sodium dodecyl benzene sulfonate, sodium lignin sulfonate, and humic acid, were analyzed via RSM, and a mathematical model was established to determine the composition of the optimal wettable powder. The results of RSM showed that these three factors could effectively describe the response of bacterial agent activity. By constructing two-dimensional contour plots and three-dimensional response surface plots, we further confirmed that the bactericide activity was mainly affected by different combinations of two parameters: sodium dodecyl benzene sulfonate and sodium lignosulfonate (Figure 6a,b), sodium dodecyl benzene sulfonate and humic acid (Figure 6c,d), and sodium lignosulfonate and humic acid (Figure 6e,f). In contrast, the other factor remained at the 0 level (Appendix A Table A5). According to RSM optimization, the optimal combination of three factors was as follows: sodium dodecyl benzene sulfonate (A) addition was 6.08%, sodium lignosulfonate (B) addition was 4.74%, and humic acid (C) addition was 5.84%. Considering the actual preparation in the factory, the amounts of wettable powder additives were set to 6% sodium dodecyl benzene sulfonate, 5% sodium lignin sulfonate, and 6% humic acid, respectively. The carrier addition was 20% kaolin. The actual viable count of the powder prepared under this fermentation condition was 69.67 × 10⁸ cfu/g, not significantly different from the predicted result (67.24 × 10⁸ cfu/g).

3.7. Wettable Powder Quality Test and Biocontrol Effect of Potato Leaves

The quality test results are shown in

Table 6. Wettable powder quality testing.

Project	Standard	Actual Value
Frequency of microbial contamination (%)	≤3	0.16
PH	5.5–8.5	7.72
Fineness (%)	≥80	91.79
Moisture content (%)	≤4	2.54
Suspension rate (%)	≥70	75.17
Wetting time (s)	≤180	95.19
Drying loss (%)	≤6	1.09
Storage stability (%)	≥80	82.57

. The wetting time was 95.19 s (≤180 s), and the suspension rate was 75.17% (>70%). The microbial pollution frequency was 0.16%. The pH was 7.72, and the fineness was 91.79%. The drying loss was 1.09%, and the storage stability was 82.57%.

The biocontrol effect of C4 wettable powder on potato bacterial wilt was studied at different concentrations and dilutions (1:300, 1:500, and 1:1000) and a control (water treatment) in potato leaf biocontrol experiments (Figure 7) and pot experiments (

Table 7. Pot experiment on control of potato bacterial wilt by Bacillus amyloliquefaciens C4 wettable powder.

Treatment	Incidence Rate (%)	Disease Index	Control Efficacy (%)
Control (Water treatment)	83.05 ± 7.15 a	28.89 ± 33.63 a
C4	17.69 ± 12.09 b	7.78 ± 8.27 b	73.08 ± 28.61 a
C4 wettable powder (1:300)	8.82 ± 10.25 b	5 ± 6.45 b	82.7 ± 22.31 a
C4 wettable powder (1:500)	12.13 ± 10.85 b	6.12 ± 7.29 b	79.05 ± 24.79 a
C4 wettable powder (1:1000)	13.89 ± 10.99 b	6.67 ± 8.36 b	76.9 ± 28.95 a

Data with different lowercase letters indicate significant differences at the 0.05 level.

). After 6 days of treatment on potato leaves, there was no significant difference between the bacterial agent treatment group and the bacterial liquid treatment group after 500 times dilution, and the control effect of the bacterial agent on bacterial wilt reached 42.31% (Figure 7b). Compared with CK, the plaque diameter of the original bacterial solution was the smallest (0.74 cm) (Figure 7a). Compared with the 300-fold and 500-fold dilution groups, the 1000-fold dilution group had the largest plaque area (1.62 cm) (Figure 7a), possibly due to the increase in excipients in the bacterial agent affecting the biocontrol activity. A comparison of leaf symptoms in the pot experiment is shown in Appendix A Figure A5. Morbidity surveys were conducted at the onset of symptoms and when the disease was stable. The incidence of potato bacterial wilt in the control area was 83.05 ± 7.15%. The incidence of C4 wettable powder (1:300) was 8.82 ± 10.25%, and the biological control effect was 82.7 ± 22.31%. The incidence of C4 wettable powder (1:500) was 12.13 ± 10.85%, and the biological control effect was 79.05 ± 24.79%. Therefore, in the absence of significant differences between the results of 1:300 and 1:500 dilutions, a 500-fold dilution concentration is recommended to provide a cost-effective control, as an approximately 40% smaller biocontrol dose was required to provide the same effect. In addition, C4 wettable powder and C4 have the same control effect, and there is no significant difference in the prevention and control of potato bacterial wilt.

3.8. The Measurement of Physiological Indicators

The effect of the C4 wettable powder on the antioxidant enzyme activity of potato plants was discussed. The experiment measured the activity of SOD, POD, MDA, and PAL in the leaves of potato. The SOD activity of potato leaves treated with C4 wettable powder showed a trend of first increasing and then decreasing; it reached a peak of 371 U/g on day 3 (Figure 6a). However, the POD activity of potato leaves treated with C4 wetted powder generally showed an upward trend, and POD activity was the highest at day 4, being 108 U/g (Figure 6b). PAL activity decreased and then bloomed (Figure 8c). Notably, the activities of all three enzymes were increased in the leaves of potatoes treated with Bacillus amyloliquefaciens C4 wettable powder. In terms of MDA content, there was little difference between the two at the initial stage. However, on the second day, the content of MDA in the leaves of potatoes treated with the C4 wet-able powder of Bacillus amyloliquefaciens increased dramatically (Figure 8d), and its MDA activity reached about 92 U/g, while the leaves of potatoes without the C4 wettable powder of Bacillus amyloliquefaciens did not show such a situation. The results showed that the C4 wettable powder could induce high SOD, POD, and PAL activities.

4. Discussion

The potential use of Bacillus amyloliquefaciens as a biocontrol strain is widely recognized due to its potent antimicrobial activity and strong synthesis of antimicrobial metabolites [28]. Zhou et al.’s study showed that Bacillus amyloliquefaciens HN plays a role in biological control and has achieved significant results in reducing cucumber (Cucumis sativus) and tomato (Lycopersicon esculentum) diseases [29]. An et al. found that bacteriocin CAMT2, the antibacterial active ingredient in the fermentation product of Bacillus amyloliquefaciens ZJHD3-06, can effectively prevent the occurrence of spoilage bacteria in food [30]. In this study, the C4 fermentation broth and crude lipopeptide extracts were found to have good inhibitory activities against potato bacterial wilt through the measurement of antibacterial activities. It is speculated that the strong antibacterial activity may be due to the inhibitory effect of the C4 strain on the growth of potato bacterial wilt caused by producing antibacterial metabolites [31,32]. Further PCR and quadrupole time-of-flight tandem mass spectrometry analyses confirmed that the C4 strain contained surfactin A, B, and C; iturin A and its homologues; and fengycin A and B, with surfactin being the major active component. This finding is similar to the study by Sarwara and Zhang et al., who used Bacillus species to produce antimicrobial lipopeptides [33,34], illustrating the important role of lipopeptide antibiotics such as surfactin in Bacillus spp. Therefore, surfactin produced by Bacillus amyloliquefaciens C4 can inhibit the growth of Ralstonia solanacearum and play a crucial role in the control of potato bacterial wilt.

Living microbial preparations are one of the focuses of current biopesticide research, but the screening and optimization of biocontrol preparations should consider the biocompatibility, wettability, pH value, and suspension rate of each preparation component and strain [35]. The suspension rate and wetting time of wettable powder are very important for biological bacteria agents, which can increase the contact between active ingredients and pathogens and improve the control effect [24]. In this study, Bacillus amyloliformis C4 wettable powder significantly increased the suspension rate while shortening the wetting time and did not affect the strain activity, indicating that it was more efficient at preventing and treating pathogens in practice. This study also further confirmed the research results of Zeng et al. [24], who found that kaolin greatly improved the biocontrol activity of bacteria and that diverse carrier materials had differences in the biocompatibility of strains, among which kaolin had significantly better advantages than white carbon black. It is worth noting that diatomite as a carrier inhibits the germination rate of spores [36]. This indicates that, although most carriers are inert materials, different strains have different adaptations to carriers, and the biocompatibility of the same carrier to different strains also varies, so the test of biocompatibility is vital. It is easy to be affected by ultraviolet rays during the use of microbial agents, and the addition of stabilizer is conducive to maintaining the stability of bacterial cell content [37]. Therefore, humic acid (6%) was introduced as a UV protective agent in this study to improve the survival rate of the strain under UV irradiation and enhance the control effect of the preparation.

As the dominant form of microbial pesticides, microbial wettable powder plays a key role in plant disease prevention [38]. For example, Ranjbar et al. successfully used Trichoderma wettable powder to control apple ulcer [39], and Qiao et al. used Bacillus subtilis PTS-394 wettable powder to effectively control pepper root rot [23]. The wettable powder of Bacillus amyloliquefaciens C4 was effective at the control of potato bacterial wilt, and its control rate was 79.05 ± 24.79%. However, traditional microbial wettable powder often faces problems such as poor dispersion and insufficient suspension stability [40], which limit its application effect. To solve these problems, a novel microbial wettable powder with significantly improved performance was developed through the optimization of th fermentation process using surfactin produced in the fermentation broth of Bacillus amyloliquefaciens C4. This not only effectively solved the problems of poor dispersion and insufficient suspension stability [40] but also ensured the uniform distribution and higher coverage rate of wettable powder during spraying through the functional characteristics of surfactin, thus enhancing the biological activity of biocontrol bacteria and its practical effect in plant disease prevention and control [41]. However, biocontrol agents have potential side effects and are affected by environmental conditions such as temperature, humidity, and light, which may reduce the activity and stability of biocontrol agents under adverse environmental conditions, thereby affecting their control efficacy [42]. However, in this study, the surfactin produced by Bacillus amyloliquefaciens C4 itself was used as an additive of biological origin. This not only reduced the environmental risk of the product but also led to high biodegradability, strong environmental compatibility, superior stability under extreme conditions, and the utilization of renewable raw materials [17], highly consistent with the development concept of modern green agriculture.

Bacillus and antimicrobial lipopeptides play a momentous role in inducing plant defense-related enzymes (such as SOD, POD, and PAL) [43]. For example, Bacillus subtilis can effectively resist the infestation of Ralstonia solanacearum by increasing the activities of POD, SOD, and CAT in tomato and systematically enhance the broad-spectrum disease resistance of tomato leaves by using the salicylate (SA) dependent signaling pathway [44,45]. This process is accompanied by a significant increase in plant defense enzyme activities. This implies a positive correlation between enhanced enzyme activity and broad-spectrum resistance. In this vein, Bacillus amyloliquefaciens C4 wettable powder also promotes POD, SOD, and CAT activities and significantly reduces the ROS level induced by Ralstonia solanacearum in potato leaves, effectively alleviating oxidative toxicity and promoting disease resistance in potato. On this basis, we speculate that the control effect of potato bacterial wilt may not only lie in the antagonistic effect of lipopeptides but also play a role by inducing the plant immune system. It has been shown that surfactin and fengycin can induce systemic resistance in plants [23,46]. The results of this study show that Bacillus amyloliquefaciens C4 wettable powder can be used as a biological agent to control potato bacterial wilt, and it is expected to play a role in promoting plant growth and improving crop stress resistance, showing its wider application value.

Conducting field experiments is an important way to further confirm the practical application effect of microbial wettable powder in a pot experiment. For example, the Bacillus subtilis PTS-394 wettable powder developed by Qiao et al. [23] and the Bacillus wettable powder developed by Zhang et al. [47] both demonstrated efficacy in controlling plant diseases through pot and field experiments. In this study, only a C4 wettable powder was initially developed, and in the indoor pot experiment, the C4 wettable powder diluted 500 times had the best cost-effectiveness, and the control effect reached 79.05% ± 24.79%. However, to comprehensively evaluate its practical application effect in the natural environment, it is necessary to further verify the practical application of C4 wettable powder through field experiments, as well as to explore its biological control and growth promotion functions, determining its application value in agricultural disease control and crop growth promotion and yield improvement.

5. Conclusions

In this study, the fermentation broth of Bacillus amyloliquefaciens C4 had a good antibacterial effect on Ralstonia solanacearum. The active ingredients of the three lipopeptides were further identified via PCR and MALDI-TOF-MS. Surfactins are lipopeptide antibiotics that effectively inhibit Ralstonia solanacearum. Subsequently, we used single-factor experiments combined with an orthogonal design to optimize the growth conditions of the C4 strain and the fermentation conditions of surfactin. The results of our study indicated that the cultivation temperature was 28 °C, the culture speed was 200 rpm, the initial pH was 7.0, and the inoculum was 3% in the medium, suitable for the production of surfactin using strain C4. In addition, the stability of the biological agent was further ensured via the screening and optimization of the carrier and additive amount of Bacillus amyloliquefaciens C4 wettable powder. Under this fermentation condition, the powder prepared via mixing various additives had a viable bacterial count of 69.67 × 10⁸ cfu/g and exhibited high suspension, storability, and stability. At the same time, the results of the pot experiment showed that C4 wettable powder had a high cost-effectiveness and good control effect for 500 times dilution, and the control effect reached 79.05% ± 24.79%. In addition, C4 enhanced the activities of SOD, POD, and PAL; activated the antioxidant system; and increased the disease resistance of Bacillus amyloliquefaciens plants. In conclusion, Bacillus amyloliquefaciens C4 wettable powder has a good control effect on potato bacterial wilt and is a potential biocontrol agent.