Chitosan-PVA and Copper Nanoparticles Improve Growth and Overexpress the SOD and JA Genes in Tomato Plants under Salt Stress
Abstract
:1. Introduction
2. Materials and Methods
2.1. Synthesis of Cs-PVA and Cu NPs Absorption
2.2. Plant Growth Conditions and Sampling
2.3. Real-Time Reverse Transcriptase PCR
2.4. Data Analysis
3. Results and Discussion
3.1. Cs-PVA and Cu NPs Improve the Growth of Plants under Salt Stress
3.2. SOD Gene Expression Is Promoted in Response to Cs-PVA + Cu NPs and Cs-PVA
3.3. Expression of PR1 and JA Genes in Response to Cs-PVA + Cu NPs and Cs-PVA
3.4. Cs-PVA and Cs-PVA + Cu NPs Induce SOD Gene Expression in Plants under Salt Stress
3.5. Cs-PVA and Cs-PVA + Cu NPs Induce JA Gene Expression in Plants under Salt Stress
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Parihar, P.; Singh, S.; Singh, R.; Singh, V.P.; Prasad, S.M. Effect of salinity stress on plants and its tolerance strategies: A review. Environ. Sci. Pollut. Res. 2015, 22, 4056–4075. [Google Scholar] [CrossRef] [PubMed]
- Deinlein, U.; Stephan, A.B.; Horie, T.; Luo, W.; Xu, G.; Schroeder, J.I. Plant salt-tolerance mechanisms. Trends Plant Sci. 2014, 19, 371–379. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, Y.; Dong, W.; Zhang, N.; Ai, X.; Wang, M.; Huang, Z.; Xiao, L.; Xia, G. A wheat allene oxide cyclase gene enhances salinity tolerance via jasmonate signaling. Plant Physiol. 2013, 164, 1068–1076. [Google Scholar] [CrossRef] [PubMed]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef] [PubMed]
- Aruna, A.; Karthick Raja Namasivayam, S.; Allen Roy, E. Comparative evaluation of non target toxic effect of free and polymer coated chemogenic metallic nanoparticles against Vigna mungo. Int. J. Pharma Bio Sci. 2015, 6, B461–B467. [Google Scholar]
- Hernández-Fuentes, A.; López-Vargas, E.; Pinedo-Espinoza, J.; Campos-Montiel, R.; Valdés-Reyna, J.; Juárez-Maldonado, A. Postharvest behavior of bioactive compounds in tomato fruits treated with Cu nanoparticles and NaCl stress. Appl. Sci. 2017, 7, 980. [Google Scholar] [CrossRef]
- Hernández-Hernández, H.; Benavides-Mendoza, A.; Ortega-Ortiz, H.; Hernández-Fuentes, A.D.; Juárez-Maldonado, A. Cu Nanoparticles in chitosan-PVA hydrogels as promoters of growth, productivity and fruit quality in tomato. Emirates J. Food Agric. 2017, 29, 573–580. [Google Scholar]
- Hernández-Hernández, H.; González-Morales, S.; Benavides-Mendoza, A.; Ortega-Ortiz, H.; Cadenas-Pliego, G.; Juárez-Maldonado, A. Effects of chitosan–PVA and Cu nanoparticles on the growth and antioxidant capacity of tomato under saline stress. Molecules 2018, 23, 178. [Google Scholar] [CrossRef] [PubMed]
- Juárez-Maldonado, A.; Ortega-Ortíz, H.; Pérez-Labrada, F.; Cadenas-Pliego, G.; Benavides-Mendoza, A. Cu nanoparticles absorbed on chitosan hydrogels positively alter morphological, production, and quality characteristics of tomato. J. Appl. Bot. Food Qual. 2016, 89, 183–189. [Google Scholar]
- Pinedo-Guerrero, Z.H.; Hernández-Fuentes, A.D.; Ortega-Ortiz, H.; Benavides-Mendoza, A.; Cadenas-Pliego, G.; Juárez-Maldonado, A. Cu nanoparticles in hydrogels of chitosan-PVA affects the characteristics of post-harvest and bioactive compounds of jalapeño pepper. Molecules 2017, 22, 926. [Google Scholar] [CrossRef] [PubMed]
- Guibal, E.; Vincent, T.; Navarro, R. Metal ion biosorption on chitosan for the synthesis of advanced materials. J. Mater. Sci. 2014, 49, 5505–5518. [Google Scholar] [CrossRef]
- Ali, A.; Muhammad, M.T.M.; Sijam, K.; Siddiqui, Y. Effect of chitosan coatings on the physicochemical characteristics of Eksotika II papaya (Carica papaya L.) fruit during cold storage. Food Chem. 2011, 124, 620–626. [Google Scholar] [CrossRef] [Green Version]
- Zou, P.; Li, K.; Liu, S.; Xing, R.; Qin, Y.; Yu, H.; Zhou, M.; Li, P. Effect of chitooligosaccharides with different degrees of acetylation on wheat seedlings under salt stress. Carbohydr. Polym. 2015, 126, 62–69. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.N.; Mobin, M.; Abbas, Z.K.; AlMutairi, K.A.; Siddiqui, Z.H. Role of nanomaterials in plants under challenging environments. Plant Physiol. Biochem. 2017, 110, 194–209. [Google Scholar] [CrossRef] [PubMed]
- Steiner, A.A. A universal method for preparing nutrient solutions of a certain desired composition. Plant Soil 1961, 15, 134–154. [Google Scholar] [CrossRef] [Green Version]
- Cui, X.; Tao, X.; Xie, Y.; Fauquet, C.M.; Zhou, X. A DNAβ associated with Tomato Yellow Leaf Curl China Virus is required for symptom induction. J. Virol. 2004, 78, 13966–13974. [Google Scholar] [CrossRef] [PubMed]
- Rossi, L.; Zhang, W.; Lombardini, L.; Ma, X. The impact of cerium oxide nanoparticles on the salt stress responses of Brassica napus L. Environ. Pollut. 2016, 219, 28–36. [Google Scholar] [CrossRef] [PubMed]
- Choudhary, R.C.; Kumaraswamy, R.V.; Kumari, S.; Sharma, S.S.; Pal, A.; Raliya, R.; Biswas, P.; Saharan, V. Cu-chitosan nanoparticle boost defense responses and plant growth in maize (Zea mays L.). Sci. Rep. 2017, 7, 9754. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Liu, J.; Zhou, L.; Pan, G.; Li, Z.; Zaidi, S.H.R.; Cheng, F. Senescence-specific change in ROS scavenging enzyme activities and regulation of various SOD isozymes to ROS levels in psf mutant rice leaves. Plant Physiol. Biochem. 2016, 109, 248–261. [Google Scholar] [CrossRef] [PubMed]
- Malerba, M.; Cerana, R. Recent advances of chitosan applications in plants. Polymers 2018, 10, 118. [Google Scholar] [CrossRef]
- Chandra, S.; Chakraborty, N.; Dasgupta, A.; Sarkar, J.; Panda, K.; Acharya, K. Chitosan nanoparticles: A positive modulator of innate immune responses in plants. Sci. Rep. 2015, 5, 15195. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choudhary, D.K.; Prakash, A.; Johri, B.N. Induced systemic resistance (ISR) in plants: Mechanism of action. Indian J. Microbiol. 2007, 47, 289–297. [Google Scholar] [CrossRef] [PubMed]
- Fu, Z.Q.; Dong, X. Systemic acquired resistance: Turning local infection into global defense. Annu. Rev. Plant Biol. 2013, 64, 839–863. [Google Scholar] [CrossRef] [PubMed]
- Shoresh, M.; Harman, G.E.; Mastouri, F. Induced Systemic Resistance and Plant Responses to Fungal Biocontrol Agents. Annu. Rev. Phytopathol. 2010, 48, 21–43. [Google Scholar] [CrossRef] [PubMed]
- Wasternack, C.; Hause, B. Jasmonates: Biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Ann. Bot. 2013, 111, 1021–1058. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z. Molecular basis for jasmonate and ethylene signal interactions in Arabidopsis. J. Exp. Bot. 2014, 65, 5743–5748. [Google Scholar] [CrossRef] [PubMed]
- Fragnire, C.; Serrano, M.; Abou-Mansour, E.; Métraux, J.P.; L’Haridon, F. Salicylic acid and its location in response to biotic and abiotic stress. FEBS Lett. 2011, 585, 1847–1852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jia, X.; Meng, Q.; Zeng, H.; Wang, W.; Yin, H. Chitosan oligosaccharide induces resistance to Tobacco mosaic virus in Arabidopsis via the salicylic acid-mediated signalling pathway. Sci. Rep. 2016, 6, 26144. [Google Scholar] [CrossRef] [PubMed]
- Doares, S.H.; Syrovets, T.; Weiler, E.W.; Ryan, C.A. Oligogalacturonides and chitosan activate plant defensive genes through the octadecanoid pathway. Proc. Natl. Acad. Sci. USA 1995, 92, 4095–4098. [Google Scholar] [CrossRef] [PubMed]
- Jiang, F.; Shen, Y.; Ma, C.; Zhang, X.; Cao, W.; Rui, Y. Effects of TiO2 nanoparticles on wheat (Triticum aestivum L.) seedlings cultivated under super-elevated and normal CO2 conditions. PLoS ONE 2017, 12, e0178088. [Google Scholar] [CrossRef] [PubMed]
- Kaushik, D.; Roychoudhury, A. Reactive oxygen species (ROS) and response of antioxidants as ROS-scavengers during environmental stress in plants. Front. Environ. Sci. 2014, 2, 53. [Google Scholar]
- Zou, P.; Li, K.; Liu, S.; He, X.; Zhang, X.; Xing, R.; Li, P. Effect of sulfated chitooligosaccharides on wheat seedlings (Triticum aestivum L.) under salt stress. J. Agric. Food Chem. 2016, 64, 2815–2821. [Google Scholar] [CrossRef] [PubMed]
- Alharby, H.F.; Metwali, E.M.R.; Fuller, M.P.; Aldhebiani, A.Y. The alteration of mRNA expression of SOD and GPX genes, and proteins in tomato (Lycopersicon esculentum Mill) under stress of NaCl and/or ZnO nanoparticles. Saudi J. Biol. Sci. 2016, 23, 773–781. [Google Scholar] [CrossRef] [PubMed]
- Das, D.; Nath, B.C.; Phukon, P.; Dolui, S.K. Synthesis and evaluation of antioxidant and antibacterial behavior of CuO nanoparticles. Colloids Surf. B Biointerfaces 2013, 101, 430–433. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, S.; More, P.; Nitnavare, R.; Jagtap, S.; Chippalkatti, R.; Derle, A.; Kitture, R.; Asok, A.; Kale, S.; Singh, S.; et al. Antidiabetic and antioxidant properties of copper nanoparticles synthesized by medicinal plant Dioscorea bulbifera. J. Nanomed. Nanotechnol. 2015, S6, 007. [Google Scholar]
- Wu, H.; Shabala, L.; Shabala, S.; Giraldo, J.P. Hydroxyl radical scavenging by cerium oxide nanoparticles improves Arabidopsis salinity tolerance by enhancing leaf mesophyll potassium retention. Environ. Sci. Nano 2018, 5, 1567–1583. [Google Scholar] [CrossRef]
- Abdel Latef, A.A.H.; Srivastava, A.K.; El-sadek, M.S.A.; Kordrostami, M.; Tran, L.-S.P. Titanium dioxide nanoparticles improve growth and enhance tolerance of broad bean plants under saline soil conditions. Land Degrad. Dev. 2018, 29, 1065–1073. [Google Scholar] [CrossRef]
- Farhangi-Abriz, S.; Torabian, S. Nano-silicon alters antioxidant activities of soybean seedlings under salt toxicity. Protoplasma 2018, 255, 953–962. [Google Scholar] [CrossRef] [PubMed]
- Nelson, B.; Johnson, M.; Walker, M.; Riley, K.; Sims, C. Antioxidant cerium oxide nanoparticles in biology and medicine. Antioxidants 2016, 5, 15. [Google Scholar] [CrossRef] [PubMed]
- Xue, Y.; Luan, Q.; Yang, D.; Yao, X.; Zhou, K. Direct evidence for hydroxyl radical scavenging activity of cerium oxide nanoparticles. J. Phys. Chem. C 2011, 115, 4433–4438. [Google Scholar] [CrossRef]
- Pichyangkura, R.; Chadchawan, S. Biostimulant activity of chitosan in horticulture. Sci. Hortic. 2015, 196, 49–65. [Google Scholar] [CrossRef]
Title 1 | Forward Primer 5′-3′ | Reverse Primer 5′-3′ |
---|---|---|
ACT | CCCAGGCACACAGGTGTTAT | CAGGAGCAACTCGAAGCTCA |
PR1 | AAGTAGTCTGGCGCAACTCA | GTCCGATCCAGTTGCCTACA |
JA | TGGTTCGTCGACTTCGTCAT | CTCGGCCTTGAGAGAGTTCA |
SOD | TGATGGGCCAACTACGGTTAA | AAAATGGGCTCCTGTAGACATACAT |
GPX | AGGAGCCTGGAAACATTGAAGA | CCATTCACGTCAACCTTGTCA |
CAT | CCCTCTAAGTATCGCCCATCAA | TTGTACACAGGACCACCAGCAT |
Measuring | Stress | Treatment | Plant Height (cm) | Stem Diameter (mm) | Number of Leaves | Number of Clusters |
---|---|---|---|---|---|---|
28 DAT | Without Stress | T0 | 49.19 ± 0.61 a | 7.51 ± 0.11 b | 10.13 ± 0.13 a | nd |
Cs | 48.38 ± 0.79 a | 7.68 ± 0.14 ab | 10.13 ± 0.15 a | nd | ||
nCu-Cs | 47.69 ± 0.38 a | 7.87 ± 0.11 a | 10.44 ± 0.13 a | nd | ||
NaCl | NaCl | 38.16 ± 0.79 b | 6.31 ± 0.12 b | 9.44 ± 0.13 b | nd | |
Cs NaCl | 42.19 ± 0.85 a | 6.87 ± 0.15 a | 9.69 ± 0.15 ab | nd | ||
nCu-Cs NaCl | 41.44 ± 0.83 a | 6.66 ± 0.12 ab | 9.94 ± 0.14 a | nd | ||
42 DAT | Without Stress | T0 | 96.75 ± 1.46 a | 11.42 ± 0.20 ab | 15.06 ± 0.14 a | 2.63 ± 0.13 a |
Cs | 95.56 ± 1.41 a | 10.94 ± 0.20 b | 14.81 ± 0.19 a | 2.69 ± 0.12 a | ||
nCu-Cs | 95.44 ± 1.21 a | 11.74 ± 0.26 a | 15.13 ± 0.13 a | 2.75 ± 0.11 a | ||
NaCl | NaCl | 76.50 ± 1.27 b | 9.27 ± 0.15 b | 13.56 ± 0.16 a | 2.56 ± 0.13 a | |
Cs NaCl | 81.81 ± 0.98 a | 9.79 ± 0.22 a | 13.81 ± 0.16 a | 2.56 ± 0.13 a | ||
nCu-Cs NaCl | 79.00 ± 1.39 ab | 9.57 ± 0.17 ab | 13.75 ± 0.14 a | 2.69 ± 0.12 a |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hernández-Hernández, H.; Juárez-Maldonado, A.; Benavides-Mendoza, A.; Ortega-Ortiz, H.; Cadenas-Pliego, G.; Sánchez-Aspeytia, D.; González-Morales, S. Chitosan-PVA and Copper Nanoparticles Improve Growth and Overexpress the SOD and JA Genes in Tomato Plants under Salt Stress. Agronomy 2018, 8, 175. https://doi.org/10.3390/agronomy8090175
Hernández-Hernández H, Juárez-Maldonado A, Benavides-Mendoza A, Ortega-Ortiz H, Cadenas-Pliego G, Sánchez-Aspeytia D, González-Morales S. Chitosan-PVA and Copper Nanoparticles Improve Growth and Overexpress the SOD and JA Genes in Tomato Plants under Salt Stress. Agronomy. 2018; 8(9):175. https://doi.org/10.3390/agronomy8090175
Chicago/Turabian StyleHernández-Hernández, Hipólito, Antonio Juárez-Maldonado, Adalberto Benavides-Mendoza, Hortensia Ortega-Ortiz, Gregorio Cadenas-Pliego, David Sánchez-Aspeytia, and Susana González-Morales. 2018. "Chitosan-PVA and Copper Nanoparticles Improve Growth and Overexpress the SOD and JA Genes in Tomato Plants under Salt Stress" Agronomy 8, no. 9: 175. https://doi.org/10.3390/agronomy8090175