Appropriate Ammonium-Nitrate Ratio Improves Nutrient Accumulation and Fruit Quality in Pepper (Capsicum annuum L.)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material and Growth Condition
2.2. NH4+:NO3− Ratio and Experiment Design
2.3. Dry Matter Determination
2.4. Analysis of Root Morphology
2.5. Determination of N, P, K Contents
2.6. Determination of Nitrate, Vitamin C, Soluble Sugar, Soluble Protein, Total Phenol, and Flavonoid Contents
2.7. Determination of Capsaicin and Dihydrocapsaicin Contents
2.8. The Determination of NR, NiR, GS and GOGAT Activity
2.9. RNA Extraction and Gene Expression Analysis
2.10. Statistical Analysis
3. Results
3.1. Dry Matter Accumulation and Root Morphology
3.2. N, P, and K Accumulation and Distribution Among Organs
3.3. NH4+:NO3− Ratios and Fruit Quality
3.4. Activity of Enzyme and Gene Expression of Nitrogen Metabolism
4. Discussion
4.1. Ammonium-Nitrate Ratios and Plant Growth, N, P, and K Accumulation and Distribution
4.2. Ammonium-Nitrate Ratios and the Quality and Capsaicinoids
4.3. Ammonium-Nitrate Ratios and Nitrogen Metabolism Gene Expression
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Li, H.; Wang, L.; Li, J.; Gao, M.; Zhang, J.; Zhang, J.; Qiu, J.; Deng, J.; Li, C.; Frolking, S. The development of China-DNDC and review of its applications for sustaining Chinese agriculture. Ecol. Model. 2017, 348, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Lu, W.; Zhang, H.; Min, J.; Shi, W. Dissimilatory nitrate reduction to ammonium in a soil under greenhouse vegetable cultivation as affected by organic amendments. J. Soils Sediment. 2015, 15, 1169–1177. [Google Scholar] [CrossRef]
- Kalcsits, L.A.; Guy, R.D. Variation in fluxes estimated from nitrogen isotope discrimination corresponds with independent measures of nitrogen flux in Populus balsamifera L. Plant Cell Environ. 2016, 39, 310–319. [Google Scholar] [CrossRef] [PubMed]
- Lassaletta, L.; Billen, G.; Grizzetti, B.; Anglade, J.; Garnier, J. 50 year trends in nitrogen use efficiency of world cropping systems: The relationship between yield and nitrogen input to cropland. Environ. Res. Lett. 2014, 9, 105011. [Google Scholar] [CrossRef]
- Carlisle, E.; Myers, S.; Raboy, V.; Bloom, A. The effects of inorganic nitrogen form and CO2 concentration on wheat yield and nutrient accumulation and distribution. Front. Plant Sci. 2012, 3, 195. [Google Scholar] [CrossRef] [PubMed]
- Haynes, R.J.; Goh, K.M. Ammonium and nitrate nutrition of plants. Biol. Rev. 2010, 53, 465–510. [Google Scholar] [CrossRef]
- Piwpuan, N.; Zhai, X.; Brix, H. Nitrogen nutrition of Cyperus laevigatus and Phormium tenax: Effects of ammonium versus nitrate on growth, nitrate reductase activity and N uptake kinetics. Aquat. Bot. 2013, 106, 42–51. [Google Scholar] [CrossRef]
- Miller, A.J.; Cramer, M.D. Root nitrogen acquisition and assimilation. Plant Soil 2005, 274, 1–36. [Google Scholar] [CrossRef]
- Fernandez, E.; Galvan, A. Inorganic nitrogen assimilation in Chlamydomonas. J. Exp. Bot. 2007, 58, 2279–2287. [Google Scholar] [CrossRef] [Green Version]
- Martínez-Andújar, C.; Ghanem, M.E.; Albacete, A.; Pérez-Alfocea, F. Response to nitrate/ammonium nutrition of tomato (Solanum lycopersicum L.) plants overexpressing a prokaryotic NH4+—Dependent asparagine synthetase. J. Plant Physiol. 2013, 170, 676–687. [Google Scholar]
- Bock, B.R. Increasing cereal yields with higher ammonium/nitrate ratios: Review of potentials and limitations. Environ. Lett. 1986, 21, 723–758. [Google Scholar] [CrossRef]
- Urlić, B.; Špika, M.J.; Becker, C.; Kläring, H.P.; Krumbein, A.; Ban, S.G.; Schwarz, D. Effect of NO3 and NH4 concentrations in nutrient solution on yield and nitrate concentration in seasonally grown leaf lettuce. Acta Agric. Scand. Sect. B Soil Plant Sci. 2017, 67, 748–757. [Google Scholar]
- Tabatabaei, S.J.; Fatemi, L.S.; Fallahi, E. Effect of ammonium: nitrate ratio on yield, calcium concentration, and photosynthesis rate in strawberry. J. Plant Nutr. 2006, 29, 1273–1285. [Google Scholar] [CrossRef]
- Chanceiii, W.; Somda, Z.; Mills, H. Effect of nitrogen form during the flowering period on zucchini squash growth and nutrient element uptake. J. Plant Nutr. 1999, 22, 597–607. [Google Scholar] [CrossRef]
- Ruan, J.L.; Sattelmacher, B. Effect of nitrogen form and root-zone pH on growth and nitrogen uptake of tea (Camellia sinensis) plants. Ann. Bot. 2007, 99, 301–310. [Google Scholar] [CrossRef]
- Boczulak, S.A.; Hawkins, B.J.; Roy, R. Temperature effects on nitrogen form uptake by seedling roots of three contrasting conifers. Tree Physiol. 2014, 34, 513–523. [Google Scholar] [CrossRef]
- Wada, S.; Niedz, R.P.; Reed, B.M. Determining nitrate and ammonium requirements for optimal in vitro response of diverse pear species. In Vitro Cell. Dev. Biol. Plant 2015, 51, 19–27. [Google Scholar] [CrossRef]
- Tromp, J.; Ovaa, J.C. Uptake and distribution of nitrogen in young apple trees after application of nitrate or ammonium, with special reference to asparagine and arginine. Physiol. Plant 2010, 45, 23–28. [Google Scholar] [CrossRef]
- Babalar, M.; Sokri, S.M.; Lesani, H.; Asgari, M.A.; Barker, A.V. Effects of nitrate:ammonium ratios on vegetative growth and mineral element composition in leaves of apple. J. Plant Nutr. 2015, 38, 2247–2258. [Google Scholar] [CrossRef]
- Borrero, C.; Trillas, M.I.; Delgado, A.; Avilés, M. Effect of ammonium/nitrate ratio in nutrient solution on control of Fusarium wilt of tomato by Trichoderma asperellum T34. Plant Pathol. 2012, 61, 132–139. [Google Scholar] [CrossRef]
- Horchani, F.; Hajri, R.; Aschismiti, S. Effect of ammonium or nitrate nutrition on photosynthesis, growth, and nitrogen assimilation in tomato plants. J. Plant Nutr. Soil Sci. 2010, 173, 610–617. [Google Scholar] [CrossRef]
- Kronzucker, H.J.; Glass, A.D.M.; Siddiqi, M.Y.; Kirk, G.J.D. Comparative kinetic analysis of ammonium and nitrate acquisition by tropical lowland rice: implications for rice cultivation and yield potential. New Phytol. 2010, 145, 471–476. [Google Scholar] [CrossRef]
- Guo, S.; Gui, C.; Yi, Z.; Shen, Q. Ammonium nutrition increases photosynthesis rate under water stress at early development stage of rice (Oryza sativa L.). Plant Soil 2007, 296, 115–124. [Google Scholar] [CrossRef]
- Zhang, Y.; Lv, H.; Wang, D.; Deng, J.; Song, W.; Makeen, K.; Shen, Q.; Xu, G. Partial nitrate nutrition amends photosynthetic characteristics in rice (Oryza sativa L. var. japonica) differing in nitrogen use efficiency. Plant Growth Regul. 2011, 63, 235–242. [Google Scholar] [CrossRef]
- Helali, S.M.R.; Nebli, H.; Kaddour, R.; Mahmoudi, H.; Lachaâl, M.; Ouerghi, Z. Influence of nitrate—Ammonium ratio on growth and nutrition of Arabidopsis thaliana. Plant Soil 2010, 336, 65–74. [Google Scholar] [CrossRef]
- Masakapalli, S.K.; Kruger, N.J.; Ratcliffe, R.G. The metabolic flux phenotype of heterotrophic Arabidopsis cells reveals a complex response to changes in nitrogen supply. Plant J. 2013, 74, 569–582. [Google Scholar] [CrossRef]
- Marino, D.; Ariz, I.; Lasa, B.; Santamaría, E.; Fernández-Irigoyen, J.; González-Murua, C.; Aparicio Tejo, P.M. Quantitative proteomics reveals the importance of nitrogen source to control glucosinolate metabolism in Arabidopsis thaliana and Brassica oleracea. J. Exp. Bot. 2016, 67, 3313–3323. [Google Scholar] [CrossRef]
- Hu, L.; Yu, J.; Liao, W.; Zhang, G.; Xie, J.; Lv, J.; Xiao, X.; Yang, B.; Zhou, R.; Bu, R. Moderate ammonium:nitrate alleviates low light intensity stress in mini Chinese cabbage seedling by regulating root architecture and photosynthesis. Sci. Hortic. 2015, 186, 143–153. [Google Scholar] [CrossRef]
- Liu, G.; Du, Q.; Li, J. Interactive effects of nitrate-ammonium ratios and temperatures on growth, photosynthesis, and nitrogen metabolism of tomato seedlings. Sci. Hortic. 2017, 214, 41–50. [Google Scholar] [CrossRef] [Green Version]
- Maksimova, V.; Gudeva, L.K.; Gulaboski, R.; Nieber, K. Co-extracted bioactive compounds in Capsicum fruit extracts prevents the cytotoxic effects of capsaicin on B104 neuroblastoma cells. Revista Brasileira Farmacognosia 2016, 26, 744–750. [Google Scholar] [CrossRef]
- Robbins, W. Clinical applications of capsaicinoids. Clin. J. Pain 2000, 16, 86–89. [Google Scholar] [CrossRef]
- Marti, H.; Mills, H. Nutrient uptake and yield of sweet pepper as affected by stage of development and N form. J. Plant Nutr. 1991, 14, 1165–1175. [Google Scholar] [CrossRef]
- Kołton, A.; Wojciechowska, R.; Leja, M. The effect of various light conditions and different nitrogen forms on nitrogen metabolism in pepper fruits. Folia Hortic. 2012, 24, 153–160. [Google Scholar] [CrossRef] [Green Version]
- Hoagland, D.R.; Arnon, D.I. The water-culture method for growing plants without soil. Calif. Agric. Exp. Stn. Circ. 1950, 347, 357–359. [Google Scholar]
- Cruz, J.L.; Alves, A.A.C.; Lecain, D.R.; Ellis, D.D.; Morgan, J.A. Effect of elevated CO2 concentration and nitrate: Ammonium ratios on gas exchange and growth of cassava (Manihot esculenta Crantz). Plant Soil 2014, 374, 33–43. [Google Scholar] [CrossRef]
- Hu, L.; Liao, W.; Dawuda, M.M.; Yu, J.; Lv, J. Appropriate NH4+:NO3− ratio improves low light tolerance of mini Chinese cabbage seedlings. BMC Plant Biol. 2017, 17, 22. [Google Scholar] [CrossRef] [PubMed]
- Galliher, T.L. Comparison of Dumas and Kjeldahl methods with automatic analyzers on agricultural samples under routine rapid analysis conditions. Commun. Soil Sci. Plant Anal. 2001, 32, 2007–2019. [Google Scholar]
- Konieczynski, P.; Wesolowski, M. Total phosphorus and its extractable form in plant drugs. Interrelation with selected micro- and macroelements. Food Chem. 2007, 103, 210–216. [Google Scholar] [CrossRef]
- Neaă, G.; Hoza, G.; Teodorescu, R.I.; Basarabă, A.; Petcuci, A.; Sima, R. Phosphorus, potassium and nitrate contents in fruit of pickling cucumbers grown in a high tunnel. Notulae Botanicae Horti Agrobotanici Cluj-Napoca 2016, 44, 541–547. [Google Scholar]
- Cataldo, D.; Haroon, M.F.; Schäder, E.; Youngs, V. Rapid colorimetric determination of nitrate in plant tissue by nitrification of salicylic acid. Commun. Soil Sci. Plant Anal. 1975, 6, 71–80. [Google Scholar] [CrossRef]
- Arya, S.P.; Mahajan, M.; Jain, P. Non-spectrophotometric methods for the determination of vitamin C. Anal. Chim. Acta 2000, 417, 1–14. [Google Scholar] [CrossRef]
- Grandy, A.S.; Erich, M.S.; Porter, G.A. Suitability of the anthrone–sulfuric acid reagent for determining water soluble carbohydrates in soil water extracts. Soil Biol. Biochem. 2000, 32, 725–727. [Google Scholar] [CrossRef]
- Sedmak, J.J.; Grossberg, S.E. A rapid, sensitive, and versatile assay for protein using Coomassie brilliant blue G250. Anal. Biochem. 1977, 79, 544–552. [Google Scholar] [CrossRef]
- Vlaic, R.A.; Muresan, V.; Muresan, A.E.; Muresan, C.C.; Paucean, A.; Mitre, V.; Chis, S.M.; Muste, S. The Changes of polyphenols, flavonoids, anthocyanins and chlorophyll content in plum peels during growth phases: From Fructification to Ripening. Notulae Botanicae Horti Agrobotanici 2017, 46, 148. [Google Scholar] [CrossRef]
- Barbero, G.F.; Liazid, A.; Palma, M.; Barroso, C.G. Fast determination of capsaicinoids from peppers by high-performance liquid chromatography using a reversed phase monolithic column. Food Chem. 2008, 107, 1276–1282. [Google Scholar] [CrossRef]
- Reilly, C.A.; Crouch, D.J.; Yost, G.S.; Reilly, C.A.; Crouch, D.J.; Yost, G.S. Quantitative analysis of capsaicinoids in fresh peppers, oleoresin capsicum and pepper spray products. J. Forensic Sci. 2001, 46, 502–509. [Google Scholar] [CrossRef] [PubMed]
- Foyer, C.H.; Valadier, M.H.; Migge, A.; Becker, T.W. Drought-induced effects on nitrate reductase activity and mRNA and on the coordination of nitrogen and carbon metabolism in maize leaves. Plant Physiol. 1998, 117, 283–292. [Google Scholar] [CrossRef]
- Rockel, P.; Strube, F.; Rockel, A.; Wildt, J.; Kaiser, W.M. Regulation of nitric oxide (NO) production by plant nitrate reductase in vivo and in vitro. J. Exp. Bot. 2002, 53, 103–110. [Google Scholar] [CrossRef]
- Rizwan, M.; Mostofa, M.G.; Ahmad, M.Z.; Zhou, Y.; Adeel, M.; Mehmood, S.; Ahmad, M.A.; Javed, R.; Imtiaz, M.; Aziz, O. Hydrogen sulfide enhances rice tolerance to nickel through the prevention of chloroplast damage and the improvement of nitrogen metabolism under excessive nickel. Plant Physiol. Biochem. 2019, 138, 100–111. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Cao, H.; Ge, Y.; Liu, D.; Cao, Q.; Chang, S.X.; Chang, J.; Song, X.; Lin, X. Nitrate/ammonium ratios affect ryegrass growth and nitrogen accumulation in a hydroponic system. J. Plant Nutr. 2011, 34, 206–216. [Google Scholar] [CrossRef]
- Bloom, A.J.; Meyerhoff, P.A.; Taylor, A.R.; Rost, T.L. Root development and absorption of ammonium and nitrate from the rhizosphere. J. Plant Growth Regul. 2002, 21, 416–431. [Google Scholar] [CrossRef]
- Liu, H.; Yang, H.; Zheng, J.; Jia, D.; Wang, J.; Li, Y.; Huang, G. Irrigation scheduling strategies based on soil matric potential on yield and fruit quality of mulched-drip irrigated chili pepper in northwest China. Agric. Water Manag. 2012, 115, 232–241. [Google Scholar] [CrossRef]
- Drew, M.C.; Webb, J.; Saker, L.R. Regulation of K+ uptake and transport to the xylem in barley roots; K+ distribution determined by electron probe X-ray microanalysis of frozen-hydrated cells. J. Exp. Bot. 1990, 41, 815–825. [Google Scholar] [CrossRef]
- Lu, Y.X.; Li, C.J.; Zhang, F.S. Transpiration, potassium uptake and flow in tobacco as affected by nitrogen forms and nutrient levels. Ann. Bot. 2005, 95, 991–998. [Google Scholar] [CrossRef]
- Traore, A.; Maranville, J. Effect of nitrate/ammonium ratio on biomass production, nitrogen accumulation, and use efficiency in sorghums of different origin. J. Plant Nutr. 1999, 22, 813–825. [Google Scholar] [CrossRef]
- Na, L.; Li, Z.; Meng, X.; Ara, N.; Yang, J.; Zhang, M. Effect of nitrate/ammonium ratios on growth, root morphology and nutrient elements uptake of watermelon (Citrullus Lanatus) seedlings. J. Plant Nutr. 2014, 37, 1859–1872. [Google Scholar] [CrossRef]
- Shaviv, A.; Hagin, J. Interaction of ammonium and nitrate nutrition with potassium in wheat. Fertil. Res. 1988, 17, 137–146. [Google Scholar] [CrossRef]
- Becker, J.; Silvia Plaza Maria, B.; Teresa, M. Empirical models of potassium uptake by dieffenbachia amoena ‘Tropic Snow’ under different nitrogen sources. HortScience 2009, 44, 483–486. [Google Scholar] [CrossRef]
- Yoneyama, T.; Matsumaru, T.; Usui, K. Engelaar Wmhg: Discrimination of nitrogen isotopes during absorption of ammonium and nitrate at different nitrogen concentrations by rice (Oryza sativa L.) plants. Plant Cell Environ. 2001, 24, 133–139. [Google Scholar] [CrossRef]
- Sokri, S.M.; Babalar, M.; Barker, A.V.; Lesani, H.; Asgari, M.A. Fruit quality and nitrogen, potassium, and calcium content of apple as influenced by nitrate: Ammonium ratios in tree nutrition. J. Plant Nutr. 2015, 38, 1619–1627. [Google Scholar] [CrossRef]
- Tu, B.; Liu, C.; Tian, B.; Zhang, Q.; Liu, X.; Herbert, S.J. Reduced abscisic acid content is responsible for enhanced sucrose accumulation by potassium nutrition in vegetable soybean seeds. J. Plant Res. 2017, 130, 551–558. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Zhang, N.S.; Zhao, J.J.; Guo, Y.P.; Zhao, Z.Y.; Mei, L.X. Potassium fertilization improves apple fruit (Malus domestica Borkh. Cv. Fuji) development by regulating trehalose metabolism. J. Hortic. Sci. Biotechnol. 2017, 92, 1–11. [Google Scholar] [CrossRef]
- Xu, G.; Kafkafi, U.; Wolf, S.; Sugimoto, Y. Mother plant nutrition and growing condition affect amino and fatty acid compositions of hybrid sweet pepper seeds. J. Plant Nutr. 2002, 25, 1645–1665. [Google Scholar] [CrossRef]
- Gurung, T.; Techawongstien, S.; Suriharn, B.; Techawongstien, S. Stability analysis of yield and capsaicinoids content in chili (Capsicum spp.) grown across six environments. Euphytica 2012, 187, 11–18. [Google Scholar] [CrossRef]
- Das, S.; Teja, K.C.; Duary, B.; Agrawal, P.K.; Bhattacharya, S.S. Impact of nutrient management, soil type and location on the accumulation of capsaicin in Capsicum chinense (Jacq.): One of the hottest chili in the world. Sci. Hortic. 2016, 213, 354–366. [Google Scholar] [CrossRef]
- Kim, S.; Park, M.; Yeom, S.I.; Kim, Y.M.; Lee, J.M.; Lee, H.A.; Seo, E.; Choi, J.; Cheong, K.; Kim, K.T.; et al. Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species. Nat. Genet. 2014, 46, 270–278. [Google Scholar] [CrossRef]
- Mazourek, M.; Pujar, A.; Borovsky, Y.; Paran, I.; Mueller, L.; Jahn, M.M. A dynamic interface for capsaicinoid systems biology. Plant Physiol. 2009, 150, 1806–1821. [Google Scholar] [CrossRef]
- Sagi, M.; Dovrat, A.; Kipnis, T.; Lips, H. Nitrate reductase, phosphoenolpyruvate carboxylase, and glutamine synthetase in annual ryegrass as affected by salinity and nitrogen. J. Plant Nutr. 1998, 21, 707–723. [Google Scholar] [CrossRef]
- Jampeetong, A.; Brix, H. Nitrogen nutrition of Salvinia natans: Effects of inorganic nitrogen form on growth, morphology, nitrate reductase activity and uptake kinetics of ammonium and nitrate. Aquat. Bot. 2009, 90, 67–73. [Google Scholar] [CrossRef]
- Konnerup, D.; Brix, H. Nitrogen nutrition of Canna indica: Effects of ammonium versus nitrate on growth, biomass allocation, photosynthesis, nitrate reductase activity and N uptake rates. Aquat. Bot. 2010, 92, 142–148. [Google Scholar] [CrossRef]
- Vincentz, M.; Moureaux, T.; Leydecker, M.T.; Vaucheret, H.; Caboche, M. Regulation of nitrate and nitrite reductase expression in Nicotiana plumbaginifolia leaves by nitrogen and carbon metabolites. Plant J. 2010, 3, 315–324. [Google Scholar] [CrossRef] [PubMed]
- Cruz, C.; Bio, A.F.M.; Domínguez-Valdivia, M.D.; Aparicio-Tejo, P.M.; Lamsfus, C.; Martins-Loução, M.A. How does glutamine synthetase activity determine plant tolerance to ammonium? Planta 2006, 223, 1068–1080. [Google Scholar] [CrossRef] [PubMed]
- Glass, A.D.; Britto, D.T.; Kaiser, B.N.; Kinghorn, J.R.; Kronzucker, H.J.; Kumar, A.; Okamoto, M.; Rawat, S.; Siddiqi, M.Y.; Unkles, S.E. The regulation of nitrate and ammonium transport systems in plants. J. Exp. Bot. 2002, 53, 855–864. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mihaljević, S.; Radić, S.; Bauer, N.; Garić, R.; Mihaljević, B.; Horvat, G.; Leljak-Levanić, D.; Jelaska, S. Ammonium-related metabolic changes affect somatic embryogenesis in pumpkin (Cucurbita pepo L.). J. Plant Physiol. 2011, 168, 1943–1951. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Zhou, J.; Duan, Z. Effects of elevated CO2 concentration on growth and water usage of tomato seedlings under different ammonium/nitrate ratios. J. Environ. Sci. 2007, 19, 1100–1107. [Google Scholar] [CrossRef]
- Shen, H.; Yang, H.; Guo, T. Influence of arbuscular mycorrhizal fungi and ammonium: Nitrate ratios on growth and pungency of spring onion plants. J. Plant Nutr. 2011, 34, 743–752. [Google Scholar] [CrossRef]
- Choi, S.T.; Park, D.S.; Hong, K.P. Status of nitrogenous and carbohydrate compounds as affected by nitrogen fertigation rates in young persimmon trees. Sci. Hortic. 2011, 130, 354–356. [Google Scholar] [CrossRef]
- Lea, U.S.; Marie-Thérèse, L.; Isabelle, Q.; Christian, M.; Cathrine, L. Posttranslational regulation of nitrate reductase strongly affects the levels of free amino acids and nitrate, whereas transcriptional regulation has only minor influence. Plant Physiol. 2006, 140, 1085–1094. [Google Scholar] [CrossRef]
- Zhong, F.; Wang, S.; Lin, J.; Roan, S.F.; Lin, B.; Zhou, X.; Chen, I.Z.; Lin, Y.; Jie, P.; Shuang, W. Characterization of nitrate assimilation in Lactuca sativa L. under different nitrogen sources. Plant Growth Regul. 2018, 86, 1–10. [Google Scholar] [CrossRef]
Substrate | Available N (mg kg−1) | Available P (mg kg−1) | Available K (mg kg−1) | EC (us cm−1) | Bulk Density (g cm−3) | pH |
---|---|---|---|---|---|---|
Vermiculite: quartz sand = 3:1 | 1.63 | 8.02 | 9.00 | 116.90 | 0.95 | 6.79 |
Treatments | NH4+:NO3− | Elements Concentration (mmol L−1) | pH | EC (μs/cm) | |||||
---|---|---|---|---|---|---|---|---|---|
N | P | K | Ca | Mg | |||||
NH4+—N | NO3−—N | ||||||||
T1 | 0:100 | 0 | 10 | 1 | 6 | 2.5 | 1 | 6.8 | 892 |
T2 | 12.5:82.5 | 1.25 | 8.25 | 1 | 6 | 2.5 | 1 | 6.7 | 884 |
T3 | 25:75 | 2.5 | 7.5 | 1 | 6 | 2.5 | 1 | 6.7 | 899 |
T4 | 37.5:62.5 | 3.75 | 6.25 | 1 | 6 | 2.5 | 1 | 6.6 | 881 |
T5 | 50:50 | 5 | 5 | 1 | 6 | 2.5 | 1 | 6.7 | 898 |
Gene Name | Sequence (5’–3’) | Accession Number | Amplicon (bp) |
---|---|---|---|
NR-1 | F:TGACGCTGAACTTGCAAACG | XM_016714485.1 | 151 bp |
R:CCTCAACGTGTAAGGTCGCT | |||
NR-2 | F:GATGACGACGACACGTCGAG | XM_016714486.1 | 129 bp |
R:AGCGGTTCCTTCGTCTCTTG | |||
NIR | F:TCAGAATCAGCTCGTGGCTT | AF065616.1 | 172 bp |
R:GCATCGTGGAATGTCACACA | |||
GS-1 | F:TGAAGCTCTTGCTGCCCAAA | NM_001324595.1 | 154 bp |
R:TGGCTCCTTTACAAGATTTTCCCA | |||
GS-2 | F:GGAAGGGACACAGAGAAGGC | XM_016717075.1 | 160 bp |
R:AACAAGCGATCCTTCGAGCA | |||
GAGOOT-1 | F:TGACCGTGCTGTATGTGGTC | NM_001324694.1 | 104 bp |
R:GCCCAGCACTCCCAGTAAAT | |||
GAGOOT-2 | F:GATGGGGTTCCTTGGTCCTG | XM_016700960 | 143 bp |
R:GTCCCCTACGACAGTCTCCT | |||
Actin | F:GTCCTTCCATCGTCCACAGG | XM_016722297.1 | 133 bp |
R:GAAGGGCAAAGGTTCACAACA |
Variables | DAT | T1 | T2 | T3 | T4 | T5 |
---|---|---|---|---|---|---|
Total root length (cm plant−1) | 30 | 2082.43 ± 84.37 f | 2383.06 ± 69.03 f | 2654.37 ± 154.07 f | 2689.63 ± 96.74 f | 2268.78 ± 144.23 f |
60 | 4568.28 ± 391.46 e | 4744.46 ± 174.55 e | 6140.96 ± 445.39 cd | 5220.4 ± 293.51 de | 4751.35 ± 137.36 e | |
90 | 6160.58 ± 32.65 cd | 6730.50 ± 125.78 bc | 7844.17 ± 226.66 ab | 7584.07 ± 192.30 abc | 6977.53 ± 273.40 bc | |
120 | 6607.17 ± 276.91 bcd | 8000.54 ± 983.60 ab | 8693.94 ± 410.14 a | 8080.38 ± 355.26 ab | 6581.64 ± 555.74 bcd | |
Surface area (cm2 plant−1) | 30 | 302.15 ± 15.53 h | 371.34 ± 23.75 gh | 413.98 ± 40.98 fgh | 402.97 ± 29.89 fgh | 360.13 ± 30.11 gh |
60 | 488.71 ± 51.03 efg | 502.04 ± 20.69 efg | 644.10 ± 52.44 de | 564.17 ± 22.88 ef | 503.08 ± 13.88 efg | |
90 | 625.91 ± 27.89 de | 749.46 ± 36.28 cd | 959.95 ± 69.43 b | 844.14 ± 25.39 bc | 758.00 ± 37.51 cd | |
120 | 859.78 ± 24.74 bc | 990.17 ± 26.35 b | 1141.94 ± 30.81 a | 1008.91 ± 41.10 b | 881.55 ± 104.36 bc | |
Volume (cm3 plant−1) | 30 | 3.59 ± 0.16 i | 4.62 ± 0.10 i | 5.16 ± 0.23 i | 4.82 ± 0.42 i | 4.56 ± 0.18 i |
60 | 9.38 ± 0.49 hi | 12.01 ± 0.58 gh | 18.31 ± 1.18 ef | 14.01 ± 0.59 fgh | 12.93 ± 0.46 fgh | |
90 | 13.76± 1.12 fgh | 19.53 ± 0.85 de | 27.97 ± 1.55 b | 27.27 ± 1.29 bc | 17.31 ± 0.60 efg | |
120 | 21.89 ± 1.77 cde | 26.32 ± 3.77 bc | 33.44 ± 0.53 a | 29.14 ± 2.54 b | 23.78 ± 2.70 bcd | |
Tips (plant−1) | 30 | 1605.00 ± 106.64 g | 1673.25 ± 128.78 g | 1724.00 ± 70.62 g | 2248.67 ± 185.87 g | 1359.25 ± 77.53 g |
60 | 3875.83 ± 88.27 f | 4145.83 ± 321.47 ef | 5656.67 ± 294.22 cde | 4880.00 ± 436.42 def | 4168.33 ± 277.24 ef | |
90 | 5074.17 ± 555.98 def | 6135.83 ± 567.11 bcd | 7592.50 ± 255.80 ab | 7040.00 ± 861.57 abc | 5529.17 ± 291.68 cde | |
120 | 5952.33 ± 255.48 bcd | 7123.00 ± 551.53 abc | 7866.83 ± 651.60 a | 7442.83 ± 224.39 ab | 6570.83 ± 248.04 abcd |
Elements | Treatments | Percent Distribution (%) of Nutrients in the Organ | |||
---|---|---|---|---|---|
Root | Stem | Leaf | Fruit | ||
N | T1 | 8.69 ± 0.27 b | 17.85 ± 0.73 a | 23.19 ± 0.36 a | 50.27 ± 0.45 a |
T2 | 9.69 ± 0.42 a | 18.31 ± 0.48 a | 20.16 ± 0.87 b | 51.83 ± 1.46 a | |
T3 | 10.00 ± 0.11 a | 18.77 ± 0.24 a | 19.08 ± 0.54 b | 52.18 ± 1.26 a | |
T4 | 9.31 ± 0.02 ab | 19.45 ± 0.38 a | 21.93 ± 0.45 ab | 49.32 ± 2.29 a | |
T5 | 10.11 ± 0.22 a | 18.95 ± 0.74 a | 19.69 ±1.59 b | 51.24 ± 2.00 a | |
P | T1 | 12.78 ± 0.12 c | 21.22 ±3.32 a | 17.93 ± 1.12 a | 48.13 ± 1.48 c |
T2 | 15.02 ± 0.92 ab | 15.78 ± 0.94 ab | 14.70 ± 1.56 ab | 54.50 ± 0.9 ab | |
T3 | 13.67 ± 0.37 bc | 18.21 ± 0.35 ab | 14.14 ± 0.63 ab | 53.97 ± 0.58 ab | |
T4 | 13.66 ± 1.01 bc | 21.42 ± 1.50 a | 16.8 ± 2.67 ab | 51.46 ± 1.8 bc | |
T5 | 16.11 ± 0.34 a | 14.12 ± 0.89 b | 12.23 ± 1.42 b | 57.49 ± 1.49 a | |
K | T1 | 9.80 ± 0.26 b | 27.85 ± 1.01 a | 21.66 ± 0.24 a | 40.69 ± 1.02 b |
T2 | 10.96 ± 0.22 ab | 25.79 ± 1.32 ab | 22.36 ± 0.17 a | 40.89 ± 1.25 b | |
T3 | 10.75 ± 0.89 b | 22.37 ± 0.83 b | 20.72 ± 1.43 ab | 46.15 ± 1.36 a | |
T4 | 10.43 ± 0.23 b | 28.65 ± 0.24 a | 20.81 ± 1.47 ab | 40.12 ± 1.57 b | |
T5 | 12.36 ± 0.37 a | 27.53 ± 1.78 a | 17.79 ± 1.32 b | 42.32 ± 1.11 ab |
Variables | Stages | T1 | T2 | T3 | T4 | T5 |
---|---|---|---|---|---|---|
Nitrate (mg g−1 FW) | Mature green stage | 0.51 ± 0.02 bcd | 0.46 ± 0.02 de | 0.44 ± 0.02 e | 0.42 ± 0.01 e | 0.43 ± 0.01 e |
Ripening stage | 0.57 ± 0.02 ab | 0.558 ± 0.03 abc | 0.48 ± 0.02 de | 0.43 ± 0.03 e | 0.45 ± 0.01 e | |
Red stage | 0.60 ± 0.01 a | 0.59 ± 0.01 a | 0.51 ± 0.03 bcd | 0.49 ± 0.01 cde | 0.45 ± 0.01 de | |
Vitamin C (mg g−1 FW) | Mature green stage | 0.46 ± 0.02 ef | 0.55 ± 0.02 ab | 0.57 ± 0.02 a | 0.50 ± 0.02 bcd | 0.51 ± 0.02 bcd |
Ripening stage | 0.43 ± 0.01 fg | 0.55 ± 0.03 bcde | 0.59 ± 0.02 abc | 0.53 ± 0.01 cde | 0.51 ± 0.00 de | |
Red stage | 0.41 ± 0.01 fg | 0.43 ± 0.01 fg | 0.51 ± 0.02 de | 0.40 ± 0.02 fg | 0.40 ± 0.01 g | |
Soluble sugar (mg g−1 FW) | Mature green stage | 23.40 ± 0.25 cde | 23.15 ± 0.16 de | 25.70 ± 1.04 abc | 22.11 ± 0.33 e | 22.21 ± 1.03 e |
Ripening stage | 22.01 ± 0.48 e | 22.75 ± 0.21 de | 25.03 ± 0.40 bcd | 21.77 ± 0.29 e | 21.50 ± 0.84 e | |
Red stage | 24.01 ± 0.69 bcde | 26.09 ± 0.22 ab | 27.37 ± 0.34 a | 25.11 ± 0.30 bcd | 23.84 ± 0.35 bcde | |
Soluble protein (mg g−1 FW) | Mature green stage | 1.01 ± 0.04 c | 1.00 ± 0.09 c | 1.13 ± 0.02 c | 0.94 ± 0.03 c | 0.93 ± 0.01 c |
Ripening stage | 1.09 ± 0.04 c | 1.10 ± 0.06 c | 1.33 ± 0.10 bc | 1.10 ± 0.08 c | 1.03 ± 0.09 c | |
Red stage | 1.23 ± 0.09 bc | 1.55 ± 0.08 ab | 1.69 ± 0.10 a | 1.20 ± 0.08 bc | 1.35 ± 0.24 bc | |
Total phenols (mg g−1 FW) | Mature green stage | 39.39 ± 2.31 bcd | 41.99 ± 0.85 bc | 53.67 ± 3.67 a | 43.16 ± 0.84 b | 42.86 ± 1.61 b |
Ripening stage | 31.44 ± 3.01 d | 35.96 ± 2.09 bcd | 41.34 ± 0.42 bc | 36.36 ± 1.09 bcd | 34.83 ± 1.11 bcd | |
Red stage | 32.72 ± 1.02 cd | 35.32 ± 2.50 bcd | 43.67 ± 2.36 b | 36.48 ± 2.62 bcd | 36.19 ± 1.74 bcd | |
Flavonoid (mg g−1 FW) | Mature green stage | 23.37 ± 0.88 bc | 27.92 ± 0.28 a | 27.57 ± 0.69 a | 21.89 ± 1.03 bcd | 19.83 ± 1.43 cde |
Ripening stage | 20.65 ± 0.82 cde | 24.92 ± 0.61 ab | 24.57 ± 0.94 ab | 21.27 ± 0.49 bcd | 18.16 ± 0.88 de | |
Red stage | 19.31 ± 0.95 cde | 21.58 ± 0.27 bcd | 23.23 ± 0.99 bc | 19.94 ± 1.23 cde | 17.16 ± 0.69 e | |
Dry weight (g fruit−1 DW) | Mature green stage | 1.37 ± 0.12 f | 1.3 ± 0.06 f | 2.17 ± 0.06 bcd | 1.85 ± 0.04 de | 1.57 ± 0.07 ef |
Ripening stage | 1.83 ± 0.02 de | 1.88 ± 0.07 de | 2.23 ± 0.03 bc | 2.13 ± 0.09 cd | 1.83 ± 0.06 de | |
Red stage | 2.03 ± 0.03 cd | 2.43 ± 0.15 b | 2.87 ± 0.03 a | 2.80 ± 0.10 a | 2.10 ± 0.10 cd |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, J.; Lv, J.; Dawuda, M.M.; Xie, J.; Yu, J.; Li, J.; Zhang, X.; Tang, C.; Wang, C.; Gan, Y. Appropriate Ammonium-Nitrate Ratio Improves Nutrient Accumulation and Fruit Quality in Pepper (Capsicum annuum L.). Agronomy 2019, 9, 683. https://doi.org/10.3390/agronomy9110683
Zhang J, Lv J, Dawuda MM, Xie J, Yu J, Li J, Zhang X, Tang C, Wang C, Gan Y. Appropriate Ammonium-Nitrate Ratio Improves Nutrient Accumulation and Fruit Quality in Pepper (Capsicum annuum L.). Agronomy. 2019; 9(11):683. https://doi.org/10.3390/agronomy9110683
Chicago/Turabian StyleZhang, Jing, Jian Lv, Mohammed Mujitaba Dawuda, Jianming Xie, Jihua Yu, Jing Li, Xiaodan Zhang, Chaonan Tang, Cheng Wang, and Yantai Gan. 2019. "Appropriate Ammonium-Nitrate Ratio Improves Nutrient Accumulation and Fruit Quality in Pepper (Capsicum annuum L.)" Agronomy 9, no. 11: 683. https://doi.org/10.3390/agronomy9110683