Planting Locations with Higher Temperature Produce More Bioactive Compounds and Antioxidant Capacities of Wheat

Abstract

Bioactive compounds such as phenols and phytic acid in wheat contribute to antioxidant capacities. (1) Background: Prior studies drew a general conclusion that the environment affected bioactive compounds greatly, but how the single environmental factor affects these characteristics remains unclear. (2) Methods: We conducted that twenty-eight winter wheat genotypes were grown in replicated trials at seven locations in China for two consecutive years and subdivided the environmental factor into five soil factors and six meteorological factors to evaluate the impact on the antioxidant capabilities and bioactive compounds contents of wheat grains by using principal component analysis (PCA). RT-PCR was used to identify gene expression of bioactive compounds under different conditions. (3) Results: Temperature affects bioactive compounds contents and antioxidant capacities greatly in wheat grains. Accumulation time, daylight length, and daily maximum temperature showed a high correlation with bioactive compounds contents and antioxidant capacities, especially in the vegetative growth phase. The gene TaMIPs related to phytic acid and TaPAL1, TaC3H1, TaC4H, Ta4CL1, and TaCOMT1 related to total phenolics had higher gene expression level with larger temperature differences in wheat grains. (4) Conclusions: The planting locations with higher temperatures and longer daylight length could produce higher contents of bioactive compounds and antioxidant capacities and the cooler temperatures of a planting location might produce wheat grains with lower phytic acid contents in wheat grains.

1. Introduction

Wheat is cultivated globally as major food crop and flour obtained by grinding and has a higher concentration of bioactive compounds than other cereal [1], such as phytic and phenolic acids [2] with small quantities. Bioactive compounds are extranutritional constituents that are associated with a lower risk of chronic diseases such as cardiovascular diseases and esophageal cancer [3,4]. Phytic acid (PA), a primary storage form of phosphorus in many plant tissues, is a natural plant antioxidant, found in most cereal crops at quantities of 1–5 g/100 g in the seeds [5]. Previous studies have demonstrated a beneficial effect of increased dietary phytic acid in human health including anticarcinogenic properties and antioxidant activity. When phytic acid was added to a low-fiber diet, observation of early biomarkers of colon cancer was reduced. Other health promoting effects of phytic acid include reducing the heart disorders by chelation with iron which has been credited with the inhibition of iron-catalyzed OH generation [6]. It forms stable complexes with dietary mineral cations and reduces iron bioavailability. Consequently, diets with high phytic acid content may lead to deficiencies in micronutrients such as iron and zinc [7,8]. Due to its ability to chelate metal ions, the reaction between phytic acid and mineral iron is a double-edged sword, we should choose suitable wheat varieties and planting locations according to different end-uses. To understand the effect the environmental factor has on phytic acid, the gene expression of D-myo-Inositol-3-phosphate (D-Ins(3)P1) synthase (MIPS EC 5.5.1.4) was analyzed, which catalyzed the first step in the phytic acid biosynthetic [9].

Polyphenols, which include phenolic acids and other compounds like flavonoids, have shown potential as anticancer agents due to their specific chemopreventive activity [10] and their antioxidative action. Specifically, phenolic acids can scavenge free radicals by inhibiting lipid peroxidation [11], with efficacies of bio-availabilities that largely depend on the content and nature. All phenolic acids in wheat grains are primarily derived from the phenylpropanoid biosynthetic pathway, which begins with the conversion of phenylalanine to cinnamic acid by phenylalanine ammonia lyase.

At least 31 antioxidants, or groups of compounds, with antioxidant properties can be found in the whole grain of cereals [12] and they contribute to antioxidant capacities of cereals. It is certain that different wheat varieties and planting locations affect the composition of antioxidant compounds of wheat grains. Therefore, there are a large number of reports that investigated the chemical composition and quantification of the compounds in different cereals at various conditions [13,14,15,16,17]. Previous studies indicated that environment has a significant effect on the antioxidant capacities [14,17,18,19], but the environment consist of dozens of factors, we hypothesize that environmental factors might affect the accumulation of bioactive compounds differently. To identify the above hypothesis, we performed a multi-plot demonstration for two years and subdivided the environmental factor into specific soil meteorological factors to evaluate the impact on the bioactive compounds and antioxidant capabilities on vegetative growth and reproductive growth by using principle component analysis (PCA), then real-time(RT-PCR) was used to validate the gene expression profiles of genes which related to bioactive compounds under given conditions. It is hoped that this research will contribute to a deeper understanding on how the environmental factors affect bioactive compounds biosynthesis in wheat grains. The results from our study will move from the general to the details and help to address these research gaps between individual environmental factor and bioactive compounds and guide cultivation practices to suite to different end-use.

2. Materials and Methods

2.1. Materials

Twenty-eight wheat cultivars with different genetic backgrounds were used in this study (

Table 1. Materials and pedigree.

Name	Pedigree	Name	Pedigree
Shumai969	SHW-L1/SW8188//ChuanYu18/3/Chuanmai42	Shumai51	((10-A/88-1843)/Chuanyu12)//Miannong4/N2401
Chuan27	Chuannong19/R3301	L09-110	SHW-L1/R59//Chuanyu18///Chuanmai42
Chuanmai104	Chuamai42/Chuannong16	Xichang18	9Pin3/Zhengyumai9987
11N21	LB0218/N711//Chuanyu18	Yumai1	Xing’aibai/Deguodunmai
Zhengmai9023	{(Xiaoyan6//Xinong65)/[83(2)3-3/84(14)43]}F3/Shan213	Mianmai37	96EW37/Mianyang90-100
Chuannong16	Chuanyu12//Jing′e57/((Alondra /783-5918)/(983-Caucasus/Fan7))	Liangmai2	Mianyang26//(10-A/88-1643)/Chuanyu12
L11-6706	SHW-L1/SY95-71//700-011689///MY68942	Chuanmai55	SW3243/SW8688
Xichang19	Xichang15(2043-5957)/7739-3-1712//(Qianhuan5/Alangda)/4676-1761	Shumai375	(Mianyang93-7/92R141)F2/Mianyang96-324
Rongmai4	96-2547/133-3	Neimai9	Mianyang26/92R178
Mianmai227	No details	Liangmai3	((10-A/88-1843)/Chuanyu12)/Miannong4//(10-A/Mianyang20)/Chuanyu12
Fan 9048	No details	Fan07217	No details
Chuanmai44	96xia440/guinong21	Changmai26	3461/xichang16
Shumai482	(Mianyang93-7/92R141)F2/Mianyang96-324	Liangmai4	N1491/N1071
Nei3416	No details	Chuanyu20	SW3243//35050/21530

). Shumai969 and Chuanmai104 are synthetic wheat varieties of Triticum turgidum (4×) and Aegilops tauschii (2×), the parents are SHW-L1 and Chuanmai42, respectively. Shumai375 and Shumai482 derived from Dasypyrum villosum (2n = 14, VV) named 92R142. The cultivars had different genetic background and showed wide genetic diversity.

2.2. Field Trials

The field trials were conducted in seven locations with different topography and meteorological conditions (

Table 2. Climate, Geography, and environment of the field sites.

Locations	Climate Type	Landform	Longitude and Latitude	Accumulated Daylight (h)	Average Temperature (°C)	Annual Precipitation (mm)
Renshou	subtropical monsoon	hilly	104°21′ E, 30°06′ N	1196.6	17.4 °C	1009.4
Xichang	tropical plateau monsoon	Plain hinterland	101°46′ E, 27°32′ N	2423.1	17.0 °C	1013.1
Hanyuan	subtropical monsoon	Panxi valley	102°16′ E, 29°05′ N	1475.8	17.9 °C	741.8
Mianyang	subtropical humid monsoon	basin	104°82′ E, 31°38′ N	898.0	16.5 °C	859.9
Ya’an	subtropical monsoon	hilly	102°99′ E, 29°98′ N	1005.0	16.2 °C	2000.0
Wenjiang	subtropical humid monsoon	plain	103°87′ E, 30°74′ N	1104.5	15.9 °C	966.1
Chongzhou	subtropical humid monsoon	plain	103°65′ E, 30°55′ N	1164.5	15.9 °C	1012.4

). Trials were carried out in 2013 and 2014 using a randomized complete block design (RCBD) with three replicates. All the field sites were fertilized with 70 kg ha⁻¹ nitrogen (N), 35 kg ha⁻¹ phosphorus (P), and 35 kg ha⁻¹ potassium (K). Cultivars were planted by hand in a block that was 6.67 m². Blocks were placed 50 cm apart, the spacing between plants was 10 cm, and each row was 30 cm apart, giving a population density of approximately 350,000 plants ha⁻¹. Subsamples of the grains from each replicate were randomly selected at full-ripening stage and threshed for bioactive compounds contents determination.

Vegetative growth stage was measured as the number of days between sowing and heading under normal field conditions. The reproductive stage was calculated between heading time and the harvest date and the rest day of wheat growth was at vegetative stage. Heading time was measured as the time the half spike on each plant emerged from the flag leaf.

Meteorological data was generated at the Agrometeorological Center of the Sichuan Meteorological Bureau and Average temperature (high, low, and overall), annual precipitation amount, and accumulated daylight were recorded for each growing location during the growth period.

2.3. Soil Properties

Soil samples consisted of 5 subsamples that were taken from each of the seven planting locations at depths of 10–20 cm at the beginning of the growing season. Nitrogen content was determined using the semi-micro Kjeldahl method [20]. Phosphorus content was determined using the HClO₄–H₂SO₄ method at 880 nm [21]. Potassium content was determined using a model 410 Flame photometer (Sherwood Scientific Ltd., Cambridge, U.K.) at 769.5 nm. Soil pH was determined by taking 3 consecutive readings on a model SenTix 41 pH meter (WTW, Germany), m (soil): m (water) = 2.5:1 according to the method described by NY/T 1377-2007 [22].

2.4. Determination of Bioactive Compounds Contents and Antioxidant Capacities

Analytical protocols for phytic acid content determination in wheat grains were as described by Guttieri [23]. Total phenolic content was determined using the Folin–Ciocalteu reagent according to the procedure described by Yu [14], using gallic acid as standard. Antioxidant capacities of ABTS•+. DPPH, O²–, –OH were determined as described by Moore [13].

2.5. q-PCR Validation of Phytic Acid and Total Phenolics Genes

In order to assess the effect of temperation on gene expression related to phytic acid and total phenolic of wheat grains during the filling period, the seedlings of Shumai482 were first cultivated in the field in a pot at Wenjiang, with five plants per pot (Φ  =  30 cm), then 10 pots moved to a greenhouse where the photoperiod was in accordance with the local conditions with a temperature range of 22–24 °C during the filling period and humidity maintained at 75%. The other 10 pots were left in the field as control (Wenjiang), the farmland day temperature changed from 18–34 °C. The grains were harvested in 2017 after the pollination at 7, 14, 21, 28, 35 days for Shumai482 at Wenjiang planting locations and greenhouse.

The first step in the phytic acid biosynthetic pathway is catalyzed by the TaMIPS gene. To understand the effect of the TaMIPS gene on phytic acid accumulation at the different environment, the expression of the TaMIPS gene was analyzed. The reference gene ID is AF120146.1. Forward primer sequence is: TACCAATGGGTCGTCAAGCC, and reverse primer sequence is: TGTTTCCTCCCCATCCAACG, with the amplicon size of 100 bp and Tm is 60 °C.

The phenolic acid biosynthesis pathway involves key enzymes phenylalanine ammonia lyase (PAL), coumaric acid 3-hdroxylase (C3H), cinnamic acid 4-hydroxylase (C4H), 4-coumarate CoA ligase (4CL), and caffeic acid/5-hydroxy ferulic acid O-methyltransferase (COMT). Primers for phenolic acid biosynthesis gene, TaPAL1, TaC3H1, TaC4H, Ta4CL1, and TaCOMT1 were used to validate the effect of environmental factors on phenolic acid [24]. Actin was used as reference. The relative expression value was calculated by the ∆∆Ct method.

2.6. Statistical Analysis

All data analyses were performed in R (v.3.1.1) (Auckland, New Zealand)and DPS (v.14.5) (Beijing, China) [25]. R program [26] was used to analyze principle component analysis (PCA). Analysis of variance (ANOVA) was performed across locations and years with genotype and environment as random factors to ascertain significance among locations and genotypes, and variance components were estimated by DPS 14.5 [25] to calculate phenotypic coefficient of variation (PCV), the genotypic coefficient of variation (GVC), and heritability [27]. Correlation analyses were performed using a two-tailed Pearson’s correlation test. Statistical significance was set at p < 0.05. The relationship between soil factor, meteorological data and bioactive compounds and antioxidant capacities are represented by mean product. Mean product is usually used to describe the covariance between two variables. It is the estimate of the population covariance and calculated by:

$$MP\mathrm{xy}=\frac{\sum \left(x-\overline{x}\right)\left(y-\overline{y}\right)}{n-1}$$

(1)

3. Results

3.1. Environmental Effect on Grain Bioactive Compounds Contents and Antioxidant Capacities

Phytic acid (PA) content in wheat grains ranged from 20.77–30.11 μg/g in 2014, and from 22.92–31.16 μg/mg in 2015 (

Table 3. Comparison of bioactive compounds contents and antioxidant capacities of 28 wheat cultivars at different sites.

Year	Location	PA (μg/g)	TPC (mg of GAE/g)	ABTS•+ (%)	DPPH (%)	O2– (%)	–OH (%)
2013–2014	WenJiang	20.77cC	2.59cC	63.05cC	57.21aA	9.22aA	4.18cC
	MianYang	27.66bB	2.88bB	72.56aA	45.45dCD	5.05cC	5.65bAB
	Ya’An	29.43aA	2.62cC	68.05bB	47.71cBC	5.85cC	4.46cC
	XiChang	30.11aA	2.09eE	44.35dD	48.14cB	3.90dD	3.54dD
	RenShou	21.27cC	2.32dD	64.18cC	39.6fE	3.83dD	5.46bB
	ChongZhou	16.98dD	2.05eE	45.93dD	42.93eD	5.50cC	2.76eE
	HanYuan	27.85bB	3.31aA	63.33cC	55.2bA	7.72bB	6.15aA
2014–2015	WenJiang	30.50bcA	2.00eD	45.17eD	41.68dC	7.23aA	3.73Ff
	MianYang	29.75cA	2.29cC	45.64eD	47.01bcB	4.46Cc	4.69dD
	Ya’An	29.97cAB	3.02aA	72.1abA	50.77aA	4.02cBC	7.64aA
	XiChang	31.16abB	2.16dC	49.57dC	47.34bB	4.92abAB	4.51cC
	RenShou	24.60eB	2.73bB	60.95cB	46.3bcB	5.20aA	4.86cC
	ChongZhou	22.92fC	2.18dC	73.04aA	45.17cB	4.19bcBC	5.99bB
	HanYuan	26.83dD	2.92aA	70.42bA	46.11bcB	3.59cC	7.57aA

lower-case and up-case letters indicate a significant difference at the 0.05 and 0.01 levels, respectively. PA: phytic acid, TPC: total phenolic content.

), with average concentrations of 23.88 μg/g in 2014 and 28.11 μg/mg in 2015. The Xichang location had the highest mean grain phytic acid content (30.64 μg/g). There was a 1.47-fold difference in mean grain phytic acid between the highest (Xichang) and the lowest (Renshou) location, and a significant difference was observed among seven locations.

Among the seven locations, samples collected from Hanyuan had the highest content of total phenolic content (TPC) across all genotypes. There was a 1.35-fold difference in grain mean total phenol content over two years between the highest (Hanyuan) and the lowest (Xichang) location.

Scavenging capacities of all locations are presented in Table 3. Briefly, ABTS•+ scavenging capacities varied from 46.96% (Xichang) to 70.07% (Ya’an). In addition to Chongzhou and Mianyang locations, ABTS•+ scavenging capacities was significantly different among locations; therefore, planting locations greatly influenced the ABTS•+ scavenging capacities.

The O²– scavenging capacities varied from 4.41% (Xichang) to 7.23% (Wenjiang), and there were significant differences across all locations except between Wenjian and Hanyuan. DPPH scavenging capacities ranged from 42.38% (Renshou) to 50.66% (Hanyuan) (Table 3). Planting locations with similar climate factors were not significantly different, as in Renshou and Chongzhou.

The coefficient of variation in O²– and –OH scavenging capacities between locations was higher than variation in the other antioxidants, suggesting that environment had a larger influence on O²– and scavenging capacities.

Analysis of variance (ANOVA) (

Table 4. ANOVA of genotype, crop years, and growing locations on bioactive compounds contents and antioxidant capacities of wheat.

Characteristics	Y	L	G	L × Y	G × Y	L × G	G × Y × L	G (%)	E (%)	G × E (%)	PCV (%)	GCV (%)	H (%)
PA	1329.51 **	321.252 **	6.20 **	182.67 **	1.61 *	1.31 **	1.17	0.34	89.53	10.07	18.18	3.23	3.45
TPC	18.29 **	2.06	2.67 **	102.44 **	1.45	2.06 **	1.64 **	2.04	15.58	81.12	18.46	2.81	2.33
ABTS•+	2.35	190.58 **	1.54 *	248.28 **	1.34	1.26 *	1.25 *	0.34	43.20	56.18	63.02	0.81	0.02
DPPH	18.92 **	31.60 **	3.86 **	57.36 **	1.68 **	1.61 **	1.36 **	3.32	43.41	52.11	29.88	8.13	7.63
O2–	88.10 **	24.95 **	2.56 **	28.39 **	1.55 *	1.26 *	1.32 **	1.73	76.32	21.06	20.88	6.13	6.30
–OH	83.01 **	100.48 **	2.06 **	80.13 **	1.41	1.51 **	1.40 **	0.76	67.96	30.76	15.77	3.29	4.42

Y: Years; L: Locations; G: Genotype; E = Y + L + L × Y. The corresponding numbers are F-values. PCV: Phenotypic coefficient of variation; GVC: Genotypic coefficient of variation; H: Heritability. PA: Phytic acid; TPC: Total phenolic content. * and ** indicate a significant difference at the 0.05 and 0.01 levels, respectively.

) across the seven sites showed that the bioactive compounds contents and antioxidant capacities in seven locations were significantly different. The results showed that the planting locations influenced DPPH and O²– free radical scavenging capacities of the cultivars. Genotypes variation contributed in limits to the tested characteristics (Table 4, G × E contributed more than 50% to phenotypes, and the environmental variation in total phenolic content, phytic acid, and ABTS•+ contributed the phenotype variation 55.10%, 75.28%, and 66.94%, respectively. The bioactive compounds contents and antioxidant capacities of grains showed significant positive correlation with planting locations and year of planting. Planting locations are more important to produce high nutritional value than varieties.

Principal component (PC) biplot (Figure 1) based on the correlation matrix showing genetic correlation among characteristics of wheat across environments. The results showed that materials from the same site clustered together and demonstrated the effect of the environment on bioactive compounds contents and antioxidant capacities. On the premise of the fixed varieties and planting locations, a comparison between years showed that wheat cultivars varied in their bioactive compounds and antioxidant capacities, which indicated that meteorological factors would affect the accumulation of bioactive compounds contents and antioxidant capacities. The results obtained by AVONA confirmed that the environment contributed largely to phenotype.

3.2. Relationship Between Bioactive Compounds Contents, Antioxidant Capacities, Soil Factors, and Meteorological Conditions

To better understand the effect of specific environmental factors on wheat bioactive compounds contents and antioxidant capacities, we calculated the mean product between single characteristics and single environmental factor by using mean product (

Table 5. Mean product between bioactive compounds contents, antioxidant capacities, and environmental factors.

	PA	TPC	ABTS	O2–	DPPH	–OH
Soil Factor
P	43.65	−181.87	−454.18	−7443.13	−2557.33	337.46
pH	−0.77	167.01	−153.06	1110.29	51.48	−118.83
Ah.N	3.88	−275.72	−349.72	−5523.01	−1708.46	−1055.98
N	0.30	−73.74	168.84	426.41	−214.60	87.35
TOC	3.40	−186.26	−576.16	−5341.95	−1523.98	279.79
AP	−1.89	54.29	20.48	3530.10	1428.73	−83.55
Meteorological Factor
Rainfall_V	−3.18	215.14	293.44	4891.25	1617.25	−1065.75
Rainfall_R	2.73	−174.39	−190.19	−5379.44	−1394.87	998.47
Rainfall_W	0.33	35.92	−128.60	−608.35	−323.65	−103.87
AT_V	−18.54	979.05	1585.92	31,715.09	10,028.24	82.47
AT_R	−6.82	364.97	680.74	11,504.74	3449.10	982.09
AT_W	−24.39	1200.00	2175.60	42,263.00	13,442.78	550.47
ST_V	−19.17	1013.20	1773.40	31,681.54	10,276.53	393.38
ST_R	−9.05	509.79	568.84	16,263.09	4881.08	158.90
ST_W	−27.26	1454.48	1853.07	47,697.09	15,078.42	779.52
MinT_V	−14.54	894.78	1129.46	22,651.30	7562.76	174.65
MinT_R	−6.65	300.09	456.87	11,855.97	4008.37	−465.74
MinT_W	−21.38	1214.15	1745.38	36,046.72	11,269.89	124.97
MaxT_V	−24.69	1265.95	2147.93	42,482.20	13,441.79	468.24
MaxT_R	−4.81	264.03	511.33	8523.91	2338.24	517.03
MaxT_W	−29.23	1525.45	2385.17	51,043.80	15,858.50	824.05

Soil factors: P, the available phosphate; Ah.N, the Alkaline hydrolysis Nitrogen content; N, the total N; TOC: Total organic carbon; AP, the available P; meteorological factor: AT, the accumulated temperature; ST, the sunshine time; MinT, daily minimum temperature; MaxT, daily maximum temperature; _V: Vegetative stage; _R: Reproductive stage; _W: Whole growth period.

). The results showed that soil factors and meteorological factors affected the bioactive compounds contents and antioxidant capacities of wheat grains in different ways. The analysis showed that meteorological factors such as temperature, sunshine time, and daily maximum temperature of the whole growth period significantly affected bioactive compounds contents as the same results in antioxidant capacities. Among soil factors, alkaline N negatively affected the scavenge hydroxyl radicals (–OH) scavenging capacities of the wheat grains. The soil phosphorus content significantly affected the phytic acid content (p < 0.05), and pH value and total nitrogen in the soil did not affect bioactive compounds contents and antioxidant capacities significantly.

Considering meteorological condition, daily maximum temperature and the daylight length that the vegetative growth phase influenced the total phenolic acid content (p < 0.05). Annual precipitation negatively affected scavenge hydroxyl radicals (–OH) (Table 4) (p < 0.05) and caused a relatively small increase in the content of bioactive compounds and antioxidant capacities. Daily maximum temperature of wheat growth period significantly affected the phytic acid content (p < 0.05).

To assess the effect of single soil and meteorological factors on the antioxidant capacities and antioxidant compounds, a cluster dendrogram was constructed based on the bioactive compounds, antioxidants capacities, and soil and meteorological factors (Figure 2), wherein the environmental factors were clustered into two groups at threshold 40. Interrogation of the dendrogram revealed and the most characteristics related to temperature were clustered together in a group. Another group included two subclasses: Sunshine time, rainfall, and soil factors were clustered into one subclass while the accumulated temperature of growth and the lowest temperature of day were clustered in the second subclass. These results further underpinned that soil and meteorological factors contributed differently to the accumulation of bioactive compounds contents and antioxidant capacities.

3.3. q-PCR Validation of Phytic Acid and Total Phenolics Genes

Expression analysis through quantitative real-time PCR revealed that the expression levels of TaMIPS cDNA at different temperatures condition during grain development. A contrast was observed between smaller and larger temperature difference of TaMIPS expression (Figure 3), and the expression levels were significantly higher in the larger temperature difference planting locations (Field) than in the lower temperature difference planting location (Greenhouse) during the filling period. TaMIPS showed constitutive expression of grains and gradually decreased after 14 DAA. Phytic acid accumulation followed the same trend, higher temperature during the grain filling significantly increased the phytic acid content in Shumai969, so the temperature of planting locations greatly determined the phytic acid content.

The next section of the experiment was concerned with total phenolics, TaPAL1 was relatively highly expressed both at the early development stage (7 DAA) and at the later stage (35 DAA) compared to the middle stage and TaC3H1 had the highest expression at 35 DAA. Ta4CL1 had the highest value of 7 DAA and decreased to increasing grain development. TaCOMT1 had opposite trend with Ta4CL1, showed by an increase in grains development. The gene expression level and total phenolic content of field were higher than greenhouse. Together, these results provide important insights that higher temperature is beneficial to the accumulation of bioactive compounds.

4. Discussion

4.1. Genotypic Variation Effect on Grain Bioactive Compounds Contents and Antioxidant Capacities

Previous studies have only used a small number of genotypes to investigate the contribution to bioactive compounds contents and antioxidant capacities, but a cultivated varieties pool is not enough, and it would be necessary to use wider wheat genetic resources in the production process. Twenty-eight wheat varieties with various genetic backgrounds were used in this study. It is noteworthy that synthetic hexaploid wheat cultivars Shumai969 and Chuanmai104 can grow in different places to produce antioxidant capacities, confirming previously published data [28]. Thus, synthetic hexaploid wheat may have potential to be used as genetic resource in nutritional wheat breeding. The interactions between genotypes and subdivided environmental factors showed that different genotypes responded differently to specific environmental factors.

4.2. Temperature Effect On Grain Bioactive Compounds Contents and Antioxidant Capacities

Recently, studies showed ancient wheat species differ little from modern wheat species and oilseed species in the contents of most secondary metabolites - [29,30] and environment determined the antioxidant capacity of wheat grains [13,31]. We reached an absolute consensus on the previous results that the genotypes did not show significant differences in wheat cultivars, so we had to pay more attention to environment.

Prior investigations have proven that the environment had a large impact on bioactive compounds contents and antioxidant capacities of most wheat cultivars [13]. In this experiment, we expanded the results and got more detailed evidence by subdividing the environment factors in detail, such as soil pH and N content, sunshine time, rainfall, and so on, and the growth period was divided into vegetative growth and reproductive growth as well to evaluate the effect of specific environmental factors on wheat nutritional quality. Amongst these factors, temperature during grain filling may regulate phytic acid, total phenolic content, and antioxidant capacities. Wheat cultivars planted in Xichang, Renshou, and Hanyuan with higher temperatures and light intensity had a higher phenolic content and antioxidant capacities as well. The results indicate that elevated growing temperatures significantly enhanced the bioactive compounds contents and antioxidant capacities of wheat and the finding might be a general phenomenon. The contents of the major bioactive compounds pseudohypericin and hypericin of St. John’s wort was higher at 30 °C than at 25 °C [32] and delaying sowing dates, which leads to higher temperatures, affects the accumulation of unsaturated fatty in safflower and phytosterols and phytostanols [33,34]. The diurnal cycle was also previously reported to affect the content of secondary metabolites such as phytic acid in wheat [35]. The environmental changes directly affected grain components, such as protein, starch, and bioactive compounds contents as well showing that these secondary metabolites affect the activity of enzymes are related to temperature.

The most obvious finding to emerge from the analysis demonstrate that higher temperatures in seed maturation lead to higher accumulation of bioactive compounds in wheat grains compared to seeds that mature with cooler temperatures during maturation. This corresponds with phenotypic results and a previous study [36] indicating phytic acid is affected by temperature. These results are relevant to aim at lowering or increasing the PA content according to different end-uses. Higher phytic acid wheat grains could be produced in the rising temperature regime and used for the food industry to produce antioxidant. Cooler planting locations would be suitable for producing low phytic acid wheat.

Temperature variations on the vegetative growth stage were related to a higher content of bioactive compounds contents and antioxidant capacities were confirmed, but the temperature of the reproductive stage had a smaller coefficient than the vegetative stage and had less influence on bioactive compounds contents and antioxidant capacities. Daily maximum and minimum temperature and longer daylight length play a vital role on the accumulation of bioactive compounds and have a positive effect on ABTS•+, TPC, and DPPH scavenging capacities, which means a large temperature difference is conducive to the accumulation of bioactive compounds, and the daylight length of the growth stage have the same function, so we speculate that bioactive compounds contents or precursors may be synthesized during the vegetative growth stage. Grain P was translocated from the vegetation after anthesis and was gradually synthesized into phytic acid at maturation.

4.3. Other Factors Effect on Grain Bioactive Compounds Contents and Antioxidant Capacities

Other factors such as the pH value of soil played a secondary or supplementary role to antioxidant capacities of wheat grains. Soil and meteorological had a different effect on phytic acid and total phenolic content and antioxidant capacities. A possible explanation for the result may be wheat uses P from phytate and uptake from soil, so soil factors such as the P content are directly linked to phytic acid. This finding broadly supports the research of other studies in this area linking wheat grain P content with P concentration in soil. TPC content and antioxidant capacities had a weaker relationship with the soil factor than maybe with meteorological factors. Other secondary metabolites are related to temperature, which affects the activity of enzymes in metabolic pathways.

Daylight length quality influences the biosynthesis and accumulation of wheat grains, as well as the decay development during storage in vegetable [37]. Light environment in early growth stages induced long-term photoacclimation and increased the content of phytochemical, and then enhanced the antioxidant capacities and phenolics acid [38]. Therefore, light condition should be considered to produce phytochemical-rich wheat grains.

This observation may support the hypothesis that environmental factors greatly affect the bioactive compounds and antioxidant capacities. It is important to the wheat producer to consider environmental factors when planting wheat cultivars for enhanced antioxidant capacities. Special consideration should be given to the temperature of the vegetative growth stage and the choice of suitable planting locations with a large daily temperature difference and longer daylight length to produce more nutritional wheat grains.

4.4. Gene Expression and Bioactive Compounds Accumulation

From the phenotypic data, we obtained that the phytic acid and total phenolic content vary depending on the temperature greatly. Some key genes in these metabolic pathways were chosen to validate the gene expression at different temperatures.

It is now well established from a variety of studies that the suggested MIPS plays a key role in phytic acid biosynthesis in developing rice, maize, and soybean seeds, regulating the MIPS gene in soybean may represent a method for altering phytic acid accumulation [39]. The observed positive correlation between temperature and phytic acid content validated the hypothesis that temperature regulated the accumulation of phytic acid.

Phenolic acids in plants are primarily derived from the phenylpropanoid biosynthetic pathway. PAL, C₃H, C₄H, 4CL, and COMT are the major enzymes in the phenolic acid biosynthesis pathway and contribute to the production of different phenolic acid compounds [24]. In the current study, we found that the expression of the involved genes, phytic acid, and phenolic acids biosynthesis varied during wheat grain development at the different temperature condition. The gene expression had a positive relationship between temperature and the contents of bioactive compounds. This finding broadly supports the research of other studies in this area linking phenolic acid biosynthesis genes with phenolic acid accumulation [24] and confirms that the temperature of planting location is important to bioactive compounds and antioxidant capacities.

5. Conclusions

Bioactive compounds contents and antioxidant capacities were measured at seven typical locations in China for two consecutive years. The following conclusions can be drawn from the present study that environment accounted for much of the variation in phenotype. The principal component analysis showed that temperature was the most important factors for bioactive compounds contents and antioxidant capacities, the planting locations with higher temperatures and longer hours of sunshine could produce wheat grains with higher contents of bioactive compounds contents and antioxidant capacities. The gene expression level of the key gene of phytic acid and phenols content also identified that temperature regulated the accumulation of two bioactive substances. Taken phenotypic data and gene expression level together, these findings suggest the role of temperature in promoting the content of phytic acid and phenolic acid and antioxidant capacities, and guide to produce wheat grains according to different end-use.