In Vitro Evaluation of CD276-CAR NK-92 Functionality, Migration and Invasion Potential in the Presence of Immune Inhibitory Factors of the Tumor Microenvironment
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Lines and Culturing Conditions
2.2. Flow Cytometry
2.3. Generation of Lentiviral Vectors
2.4. Lentiviral Transduction
2.5. Calcein-Release Cytotoxicity Assay (CRA)
2.6. Real-Time Impedance-Based Live Cell Analysis
2.7. Cytokine Secretion Analysis
2.8. Analysis of CD276-CAR NK-92 Cell-Mediated Cytotoxicity under Hypoxic Conditions
2.9. Testing the Influence of TGFβ on CD276-CAR NK-92 Cells
2.10. Analysis of the Influence of Lactate on CD276-CAR NK-92 Cells
2.11. Generation of Melanoma Supernatants
2.12. Generation of Melanoma 3D Spheroids for the Assessment of CD276-CAR-Mediated Cytotoxicity of NK-92 Cells
2.13. Tracking of NK-92-Mediated Tumor Cell Invasion
2.14. Assessment of NK-92 Migration
2.15. CRISPR/Cas9-Mediated Knock-Out of NKG2A in CD276-CAR NK-92 Cells
2.15.1. SgRNA Design
2.15.2. Assessment of CRISPR/Cas9 In Vitro Cutting of NKG2A Gene
2.15.3. Generation of CRISPR-Mediated Knock-Out of NKG2A Gene in CD276-CAR NK-92 Cells
2.15.4. Assessment of CRISPR-Mediated Modification of NKG2A at Genomic Level in CAR-NK-92 Cells
2.15.5. Measurements of CRISPR-Mediated Knock-Out Score of NKG2A at Protein Level in NK-92 Cells
2.16. Data Analysis
3. Results
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gershenwald, J.E.; Guy, G.P. Stemming the Rising Incidence of Melanoma: Calling Prevention to Action. J. Natl. Cancer Inst. 2016, 108, 381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miller, K.D.; Siegel, R.L.; Khan, R.; Jemal, A. Cancer Statistics. Cancer Rehabil. 2018, 70, 7–30. [Google Scholar] [CrossRef]
- Sandru, A.; Voinea, S.; Panaitescu, E.; Blidaru, A. Survival rates of patients with metastatic malignant melanoma. J. Med. Life 2015, 7, 572–576. [Google Scholar]
- Ott, P.A.; Hodi, F.S.; Robert, C. CTLA-4 and PD-1/PD-L1 Blockade: New Immunotherapeutic Modalities with Durable Clinical Benefit in Melanoma Patients. Clin. Cancer Res. 2013, 19, 5300–5309. [Google Scholar] [CrossRef] [Green Version]
- Koyama, S.; Akbay, E.A.; Li, Y.Y.; Herter-Sprie, G.S.; Buczkowski, K.A.; Richards, W.G.; Gandhi, L.; Redig, A.J.; Rodig, S.J.; Asahina, H.; et al. Adaptive resistance to therapeutic PD-1 blockade is associated with upregulation of alternative immune checkpoints. Nat. Commun. 2016, 7, 10501. [Google Scholar] [CrossRef]
- Pitt, J.M.; Vétizou, M.; Daillère, R.; Roberti, M.P.; Yamazaki, T.; Routy, B.; Lepage, P.; Boneca, I.G.; Chamaillard, M.; Kroemer, G.; et al. Resistance Mechanisms to Immune-Checkpoint Blockade in Cancer: Tumor-Intrinsic and -Extrinsic Factors. Immunity 2016, 44, 1255–1269. [Google Scholar] [CrossRef] [Green Version]
- Kourie, H.R.; Klastersky, J. Immune checkpoint inhibitors side effects and management. Immunotherapy 2016, 8, 799–807. [Google Scholar] [CrossRef]
- Spain, L.; Diem, S.; Larkin, J. Management of toxicities of immune checkpoint inhibitors. Cancer Treat. Rev. 2016, 44, 51–60. [Google Scholar] [CrossRef]
- Lyon, A.R.; Yousaf, N.; Battisti, N.M.L.; Moslehi, J.; Larkin, J. Immune checkpoint inhibitors and cardiovascular toxicity. Lancet Oncol. 2018, 19, e447–e458. [Google Scholar] [CrossRef]
- Sadelain, M.; Brentjens, R.; Rivière, I. The Basic Principles of Chimeric Antigen Receptor Design. Cancer Discov. 2013, 3, 388–398. [Google Scholar] [CrossRef] [Green Version]
- Neelapu, S.S.; Locke, F.L.; Bartlett, N.L.; Lekakis, L.J.; Miklos, D.B.; Jacobson, C.A.; Braunschweig, I.; Oluwole, O.O.; Siddiqi, T.; Lin, Y.; et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. N. Engl. J. Med. 2017, 377, 2531–2544. [Google Scholar] [CrossRef]
- Maude, S.L.; Laetsch, T.W.; Buechner, J.; Rives, S.; Boyer, M.; Bittencourt, H.; Bader, P.; Verneris, M.R.; Stefanski, H.E.; Myers, G.D.; et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. N. Engl. J. Med. 2018, 378, 439–448. [Google Scholar] [CrossRef]
- Yáñez, L.; Sánchez-Escamilla, M.; Perales, M.-A. CAR T Cell Toxicity: Current Management and Future Directions. HemaSphere 2019, 3, e186. [Google Scholar] [CrossRef]
- Liu, E.; Marin, D.; Banerjee, P.; Macapinlac, H.A.; Thompson, P.; Basar, R.; Kerbauy, L.N.; Overman, B.; Thall, P.; Kaplan, M.; et al. Use of CAR-Transduced Natural Killer Cells in CD19-Positive Lymphoid Tumors. N. Engl. J. Med. 2020, 382, 545–553. [Google Scholar] [CrossRef]
- Gong, J.H.; Maki, G.; Klingemann, H.G. Characterization of a human cell line (NK-92) with phenotypical and functional characteristics of activated natural killer cells. Leukemia 1994, 8, 652–658. [Google Scholar]
- Burger, M.C.; Zhang, C.; Harter, P.N.; Romanski, A.; Strassheimer, F.; Senft, C.; Tonn, T.; Steinbach, J.P.; Wels, W.S. CAR-Engineered NK Cells for the Treatment of Glioblastoma: Turning Innate Effectors Into Precision Tools for Cancer Immunotherapy. Front. Immunol. 2019, 10, 2683. [Google Scholar] [CrossRef] [Green Version]
- Tam, Y.K.; Martinson, J.A.; Doligosa, K.; Klingemann, H.G. Ex vivo expansion of the highly cytotoxic human natural killer cell line NK-92 under current good manufacturing practice conditions for clinical adoptive cellular immunotherapy. Cytotherapy 2003, 5, 259–272. [Google Scholar]
- Swift, B.E.; Williams, B.A.; Kosaka, Y.; Wang, X.-H.; Medin, J.A.; Viswanathan, S.; Martinez-Lopez, J.; Keating, A. Natural killer cell lines preferentially kill clonogenic multiple myeloma cells and decrease myeloma engraftment in a bioluminescent xenograft mouse model. Haematologica 2012, 97, 1020–1028. [Google Scholar] [CrossRef] [Green Version]
- Tonn, T.; Schwabe, D.; Klingemann, H.G.; Becker, S.; Esser, R.; Koehl, U.; Suttorp, M.; Seifried, E.; Ottmann, O.G.; Bug, G. Treatment of patients with advanced cancer with the natural killer cell line NK-92. Cytotherapy 2013, 15, 1563–1570. [Google Scholar] [CrossRef]
- Boyiadzis, M.; Agha, M.; Redner, R.L.; Sehgal, A.; Im, A.; Hou, J.-Z.; Farah, R.; Dorritie, K.A.; Raptis, A.; Lim, S.H.; et al. Phase 1 clinical trial of adoptive immunotherapy using “off-the-shelf” activated natural killer cells in patients with refractory and relapsed acute myeloid leukemia. Cytotherapy 2017, 19, 1225–1232. [Google Scholar] [CrossRef]
- Williams, B.A.; Law, A.D.; Routy, B.; Denhollander, N.; Gupta, V.; Wang, X.-H.; Chaboureau, A.; Viswanathan, S.; Keating, A. A phase I trial of NK-92 cells for refractory hematological malignancies relapsing after autologous hematopoietic cell transplantation shows safety and evidence of efficacy. Oncotarget 2017, 8, 89256–89268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grote, S.; Chan, K.C.; Baden, C.; Bösmüller, H.; Sulyok, M.; Frauenfeld, L.; Ebinger, M.; Handgretinger, R.; Schleicher, S. CD276 as a novel CAR NK-92 therapeutic target for neuroblastoma. Adv. Cell Gene Ther. 2021, 4, e105. [Google Scholar] [CrossRef]
- Zhang, C.; Oberoi, P.; Oelsner, S.; Waldmann, A.; Lindner, A.; Tonn, T.; Wels, W.S. Chimeric Antigen Receptor-Engineered NK-92 Cells: An Off-the-Shelf Cellular Therapeutic for Targeted Elimination of Cancer Cells and Induction of Protective Antitumor Immunity. Front. Immunol. 2017, 8, 533. [Google Scholar] [CrossRef] [PubMed]
- Hou, B.; Tang, Y.; Li, W.; Zeng, Q.; Chang, D. Efficiency of CAR-T Therapy for Treatment of Solid Tumor in Clinical Trials: A Meta-Analysis. Dis. Markers 2019, 2019, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Z.; Luther, N.; Ibrahim, G.M.; Hawkins, C.; Vibhakar, R.; Handler, M.H.; Souweidane, M.M. B7-H3, a potential therapeutic target, is expressed in diffuse intrinsic pontine glioma. J. Neuro-Oncol. 2013, 111, 257–264. [Google Scholar] [CrossRef] [Green Version]
- Picarda, E.; Ohaegbulam, K.C.; Zang, X. Molecular Pathways: Targeting B7-H3 (CD276) for Human Cancer Immunotherapy. Clin. Cancer Res. 2016, 22, 3425–3431. [Google Scholar] [CrossRef] [Green Version]
- Flem-Karlsen, K.; Tekle, C.; Andersson, Y.; Flatmark, K.; Fodstad, Ø.; Nunes-Xavier, C.E. Immunoregulatory protein B7-H3 promotes growth and decreases sensitivity to therapy in metastatic melanoma cells. Pigment. Cell Melanoma Res. 2017, 30, 467–476. [Google Scholar] [CrossRef] [Green Version]
- Huang, B.; Luo, L.; Wang, J.; He, B.; Feng, R.; Xian, N.; Zhang, Q.; Chen, L.; Huang, G. B7-H3 specific T cells with chimeric antigen receptor and decoy PD-1 receptors eradicate established solid human tumors in mouse models. OncoImmunology 2020, 9, 1684127. [Google Scholar] [CrossRef] [Green Version]
- Zhang, H.; Zhang, J.; Li, C.; Xu, H.; Dong, R.; Chen, C.C.; Hua, W. Survival Association and Cell Cycle Effects of B7H3 in Neuroblastoma. J. Korean Neurosurg. Soc. 2020, 63, 707–716. [Google Scholar] [CrossRef]
- Benzon, B.; Zhao, S.G.; Haffner, M.C.; Takhar, M.; Erho, N.; Yousefi, K.; Hurley, P.; Bishop, J.L.; Tosoian, J.; Ghabili, K.; et al. Correlation of B7-H3 with androgen receptor, immune pathways and poor outcome in prostate cancer: An expression-based analysis. Prostate Cancer Prostatic Dis. 2017, 20, 28–35. [Google Scholar] [CrossRef]
- Zang, X.; Thompson, R.H.; Al-Ahmadie, H.A.; Serio, A.M.; Reuter, V.E.; Eastham, J.A.; Scardino, P.T.; Sharma, P.; Allison, J.P. B7-H3 and B7x are highly expressed in human prostate cancer and associated with disease spread and poor outcome. Proc. Natl. Acad. Sci. USA 2007, 104, 19458–19463. [Google Scholar] [CrossRef] [Green Version]
- Crispen, P.L.; Sheinin, Y.; Roth, T.J.; Lohse, C.M.; Kuntz, S.M.; Frigola, X.; Thompson, R.H.; Boorjian, S.A.; Dong, H.; Leibovich, B.C.; et al. Tumor Cell and Tumor Vasculature Expression of B7-H3 Predict Survival in Clear Cell Renal Cell Carcinoma. Clin. Cancer Res. 2008, 14, 5150–5157. [Google Scholar] [CrossRef] [Green Version]
- Seaman, S.; Zhu, Z.; Saha, S.; Zhang, X.M.; Yang, M.Y.; Hilton, M.B.; Morris, K.; Szot, C.; Morris, H.; Swing, D.A.; et al. Eradication of Tumors through Simultaneous Ablation of CD276/B7-H3-Positive Tumor Cells and Tumor Vasculature. Cancer Cell 2017, 31, 501–515. [Google Scholar] [CrossRef] [Green Version]
- Loo, D.; Alderson, R.F.; Chen, F.Z.; Huang, L.; Zhang, W.; Gorlatov, S.; Burke, S.; Ciccarone, V.; Li, H.; Yang, Y.; et al. Development of an Fc-Enhanced Anti–B7-H3 Monoclonal Antibody with Potent Antitumor Activity. Clin. Cancer Res. 2012, 18, 3834–3845. [Google Scholar] [CrossRef] [Green Version]
- Powderly, J.; Cote, G.M.; Flaherty, K.T.; Szmulewitz, R.Z.; Ribas, A.; Weber, J.S.; Loo, D.; Baughman, J.; Chen, F.; A Moore, P.; et al. Interim results of an ongoing Phase I, dose escalation study of MGA271 (Fc-optimized humanized anti-B7-H3 monoclonal antibody) in patients with refractory B7-H3-expressing neoplasms or neoplasms whose vasculature expresses B7-H3. J. Immunother. Cancer 2015, 3, O8. [Google Scholar] [CrossRef] [Green Version]
- Tang, X.; Zhao, S.; Zhang, Y.; Wang, Y.; Zhang, Z.; Yang, M.; Zhu, Y.; Zhang, G.; Guo, G.; Tong, A.; et al. B7-H3 as a Novel CAR-T Therapeutic Target for Glioblastoma. Mol. Ther. Oncolytics 2019, 14, 279–287. [Google Scholar] [CrossRef] [Green Version]
- Majzner, R.G.; Theruvath, J.L.; Nellan, A.; Heitzeneder, S.; Cui, Y.; Mount, C.W.; Rietberg, S.P.; Linde, M.H.; Xu, P.; Rota, C.; et al. CAR T Cells Targeting B7-H3, a Pan-Cancer Antigen, Demonstrate Potent Preclinical Activity against Pediatric Solid Tumors and Brain Tumors. Clin. Cancer Res. 2019, 25, 2560–2574. [Google Scholar] [CrossRef]
- Du, H.; Hirabayashi, K.; Ahn, S.; Kren, N.P.; Montgomery, S.A.; Wang, X.; Tiruthani, K.; Mirlekar, R.; Michaud, D.; Greene, K.; et al. Antitumor Responses in the Absence of Toxicity in Solid Tumors by Targeting B7-H3 Via Chimeric Antigen Receptor T Cells. SSRN Electron. J. 2018, 35, 221–237.e8. [Google Scholar] [CrossRef]
- Tang, X.; Liu, F.; Liu, Z.; Cao, Y.; Zhang, Z.; Wang, Y.; Huang, J.; Fan, S.; Zhao, S.; Chen, Y.; et al. Bioactivity and safety of B7-H3-targeted chimeric antigen receptor T cells against anaplastic meningioma. Clin. Transl. Immunol. 2020, 9, e1137. [Google Scholar] [CrossRef]
- Zhang, Z.; Jiang, C.; Liu, Z.; Yang, M.; Tang, X.; Wang, Y.; Zheng, M.; Huang, J.; Zhong, K.; Zhao, S.; et al. B7-H3-Targeted CAR-T Cells Exhibit Potent Antitumor Effects on Hematologic and Solid Tumors. Mol. Ther. Oncolytics 2020, 17, 180–189. [Google Scholar] [CrossRef]
- Quail, D.F.; A Joyce, J. Microenvironmental regulation of tumor progression and metastasis. Nat. Med. 2013, 19, 1423–1437. [Google Scholar] [CrossRef]
- Melaiu, O.; Lucarini, V.; Cifaldi, L.; Fruci, D. Influence of the Tumor Microenvironment on NK Cell Function in Solid Tumors. Front. Immunol. 2020, 10, 3038. [Google Scholar] [CrossRef]
- Nayyar, G.; Chu, Y.; Cairo, M.S. Overcoming Resistance to Natural Killer Cell Based Immunotherapies for Solid Tumors. Front. Oncol. 2019, 9, 51. [Google Scholar] [CrossRef] [Green Version]
- Xie, F.; Ling, L.; van Dam, H.; Zhou, F.; Zhang, L. TGF-β signaling in cancer metastasis. Acta Biochim. Biophys. Sin. 2018, 50, 121–132. [Google Scholar] [CrossRef] [Green Version]
- Wu, Y.; Kuang, D.M.; Pan, W.D.; Wan, Y.L.; Lao, X.M.; Wang, D.; Li, X.F.; Zheng, L. Monocyte/macrophage-elicited natural killer cell dysfunction in hepatocellular carcinoma is mediated by CD48/2B4 interactions. Hepatology 2013, 57, 1107–1116. [Google Scholar] [CrossRef]
- Trotta, R.; Col, J.D.; Yu, J.; Ciarlariello, D.; Thomas, B.; Zhang, X.; Allard, J.; Wei, M.; Mao, H.; Byrd, J.C.; et al. TGF-β Utilizes SMAD3 to Inhibit CD16-Mediated IFN-γ Production and Antibody-Dependent Cellular Cytotoxicity in Human NK Cells1. J. Immunol. 2008, 181, 3784–3792. [Google Scholar] [CrossRef] [Green Version]
- Pasero, C.; Gravis, G.; Guerin, M.; Granjeaud, S.; Thomassin-Piana, J.; Rocchi, P.; Paciencia-Gros, M.; Poizat, F.; Bentobji, M.; Azario-Cheillan, F.; et al. Inherent and Tumor-Driven Immune Tolerance in the Prostate Microenvironment Impairs Natural Killer Cell Antitumor Activity. Cancer Res. 2016, 76, 2153–2165. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Castriconi, R.; Cantoni, C.; Della Chiesa, M.; Vitale, M.; Marcenaro, E.; Conte, R.; Biassoni, R.; Bottino, C.; Moretta, L.; Moretta, A. Transforming growth factor β1 inhibits expression of NKP30 and NKG2d receptors: Consequences for the NK-mediated killing of dendritic cells. Proc. Natl. Acad. Sci. USA 2003, 100, 4120–4125. [Google Scholar] [CrossRef] [Green Version]
- Uyttenhove, C.; Pilotte, L.; Théate, I.; Stroobant, V.; Colau, D.; Parmentier, N.; Boon, T.; van den Eynde, B.J. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Nat. Med. 2003, 9, 1269–1274. [Google Scholar] [CrossRef]
- Frumento, G.; Rotondo, R.; Tonetti, M.; Damonte, G.; Benatti, U.; Ferrara, G.B. Tryptophan-derived Catabolites Are Responsible for Inhibition of T and Natural Killer Cell Proliferation Induced by Indoleamine 2,3-Dioxygenase. J. Exp. Med. 2002, 196, 459–468. [Google Scholar] [CrossRef] [Green Version]
- Xie, H.; Hanai, J.-I.; Ren, J.-G.; Kats, L.; Burgess, K.; Bhargava, P.; Signoretti, S.; Billiard, J.; Duffy, K.J.; Grant, A.; et al. Targeting Lactate Dehydrogenase-A Inhibits Tumorigenesis and Tumor Progression in Mouse Models of Lung Cancer and Impacts Tumor-Initiating Cells. Cell Metab. 2014, 19, 795–809. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martínez-Zaguilán, R.; Seftor, E.A.; Seftor, R.E.; Chu, Y.W.; Gillies, R.J.; Hendrix, M.J. Acidic pH enhances the invasive behavior of human melanoma cells. Clin. Exp. Metastasis 1996, 14, 176–186. [Google Scholar] [CrossRef] [PubMed]
- Rofstad, E.K.; Mathiesen, B.; Kindem, K.; Galappathi, K. Acidic Extracellular pH Promotes Experimental Metastasis of Human Melanoma Cells in Athymic Nude Mice. Cancer Res. 2006, 66, 6699–6707. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Petrova, V.; Annicchiarico-Petruzzelli, M.; Melino, G.; Amelio, I. The hypoxic tumour microenvironment. Oncogenesis 2018, 7, 10. [Google Scholar] [CrossRef]
- Sceneay, J.; Chow, M.T.; Chen, A.; Halse, H.M.; Wong, C.S.; Andrews, D.M.; Sloan, E.K.; Parker, B.S.; Bowtell, D.D.; Smyth, M.J.; et al. Primary tumor hypoxia recruits CD11b+/Ly6Cmed/Ly6G+ immune suppressor cells and compromises NK cell cytotoxicity in the premetastatic niche. Cancer Res. 2012, 72, 3906–3911. [Google Scholar] [CrossRef] [Green Version]
- Grote, S.; Mittelstaet, J.; Baden, C.; Chan, K.C.H.; Seitz, C.; Schlegel, P.; Kaiser, A.; Handgretinger, R.; Schleicher, S. Adapter chimeric antigen receptor (AdCAR)-engineered NK-92 cells: An off-the-shelf cellular therapeutic for universal tumor targeting. Oncoimmunology 2020, 9, 1825177. [Google Scholar] [CrossRef]
- Berahovich, R.D.; Lai, N.L.; Wei, Z.; Lanier, L.L.; Schall, T.J. Evidence for NK Cell Subsets Based on Chemokine Receptor Expression. J. Immunol. 2006, 177, 7833–7840. [Google Scholar] [CrossRef]
- Labun, K.; Montague, T.G.; Krause, M.; Cleuren, Y.N.T.; Tjeldnes, H.; Valen, E. CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Res. 2019, 47, W171–W174. [Google Scholar] [CrossRef] [Green Version]
- Lamsfus-Calle, A.; Daniel-Moreno, A.; Antony, J.S.; Epting, T.; Heumos, L.; Baskaran, P.; Admard, J.; Casadei, N.; Latifi, N.; Siegmund, D.M.; et al. Comparative targeting analysis of KLF1, BCL11A, and HBG1/2 in CD34+ HSPCs by CRISPR/Cas9 for the induction of fetal hemoglobin. Sci. Rep. 2020, 10, 10133. [Google Scholar] [CrossRef]
- Enk, A. Dendritic cells in tolerance induction. Immunol. Lett. 2005, 99, 8–11. [Google Scholar] [CrossRef]
- A Clark, D.; Coker, R. Molecules in focus Transforming growth factor-beta (TGF-β). Int. J. Biochem. Cell Biol. 1998, 30, 293–298. [Google Scholar] [CrossRef]
- Umansky, V.; Sevko, A. Melanoma-induced immunosuppression and its neutralization. Semin. Cancer Biol. 2012, 22, 319–326. [Google Scholar] [CrossRef]
- Kusmartsev, S.; Gabrilovich, D.I. Effect of tumor-derived cytokines and growth factors on differentiation and immune suppressive features of myeloid cells in cancer. Cancer Metastasis Rev. 2006, 25, 323–331. [Google Scholar] [CrossRef]
- Dillenburg-Pilla, P.; Patel, V.; Mikelis, C.M.; Zárate-Bladés, C.R.; Doçi, C.L.; Amornphimoltham, P.; Wang, Z.; Martin, D.; Leelahavanichkul, K.; Dorsam, R.T.; et al. SDF-1/CXCL12 induces directional cell migration and spontaneous metastasis via a CXCR4/Gαi/mTORC1 axis. FASEB J. 2015, 29, 1056–1068. [Google Scholar] [CrossRef] [Green Version]
- Singh, T.; Katiyar, S.K. Honokiol Inhibits Non-Small Cell Lung Cancer Cell Migration by Targeting PGE2-Mediated Activation of β-Catenin Signaling. PLoS ONE 2013, 8, e60749. [Google Scholar] [CrossRef] [Green Version]
- Bleul, C.C.; Fuhlbrigge, R.C.; Casasnovas, J.M.; Aiuti, A.; A Springer, T. A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1). J. Exp. Med. 1996, 184, 1101–1109. [Google Scholar] [CrossRef] [Green Version]
- Borst, L.; van der Burg, S.H.; van Hall, T. The NKG2A–HLA-E axis as a novel checkpoint in the tumor microenvironment. Clin. Cancer Res. 2020, 26, 5549–5556. [Google Scholar]
- Platonova, S.; Cherfils-Vicini, J.; Damotte, D.; Crozet, L.; Vieillard, V.; Validire, P.; André, P.; Dieu-Nosjean, M.-C.; Alifano, M.; Régnard, J.-F.; et al. Profound Coordinated Alterations of Intratumoral NK Cell Phenotype and Function in Lung Carcinoma. Cancer Res. 2011, 71, 5412–5422. [Google Scholar] [CrossRef] [Green Version]
- Ruggeri, L.; Urbani, E.; André, P.; Mancusi, A.; Tosti, A.; Topini, F.; Bléry, M.; Animobono, L.; Romagné, F.; Wagtmann, N.; et al. Effects of anti-NKG2A antibody administration on leukemia and normal hematopoietic cells. Haematologica 2015, 101, 626–633. [Google Scholar] [CrossRef] [Green Version]
- Muntasell, A.; Ochoa, M.C.; Cordeiro, L.; Berraondo, P.; de Cerio, A.L.-D.; Cabo, M.; López-Botet, M.; Melero, I. Targeting NK-cell checkpoints for cancer immunotherapy. Curr. Opin. Immunol. 2017, 45, 73–81. [Google Scholar] [CrossRef]
- Kamiya, T.; Seow, S.V.; Wong, D.; Robinson, M.; Campana, D. Blocking expression of inhibitory receptor NKG2A overcomes tumor resistance to NK cells. J. Clin. Investig. 2019, 129, 2094–2106. [Google Scholar] [CrossRef] [Green Version]
- Swetter, S.M.; Tsao, H.; Bichakjian, C.K.; Curiel-Lewandrowski, C.; Elder, D.E.; Gershenwald, J.E.; Guild, V.; Grant-Kels, J.M.; Halpern, A.C.; Johnson, T.M.; et al. Guidelines of care for the management of primary cutaneous melanoma. J. Am. Acad. Dermatol. 2019, 80, 208–250. [Google Scholar] [CrossRef] [Green Version]
- Simon, B.; Uslu, U. CAR-T cell therapy in melanoma: A future success story? Exp. Dermatol. 2018, 27, 1315–1321. [Google Scholar] [CrossRef] [Green Version]
- B7H3 CAR T Cell Immunotherapy for Recurrent/Refractory Solid Tumors in Children and Young Adults. Available online: https://clinicaltrials.gov/ct2/show/NCT04483778 (accessed on 25 January 2021).
- Tekle, C.; Nygren, M.K.; Chen, Y.-W.; Dybsjord, I.; Nesland, J.M.; Maelandsmo, G.M.; Fodstad, Ø. B7-H3 contributes to the metastatic capacity of melanoma cells by modulation of known metastasis-associated genes. Int. J. Cancer 2011, 130, 2282–2290. [Google Scholar] [CrossRef]
- Dong, P.; Xiong, Y.; Yue, J.; Hanley, S.J.B.; Watari, H. B7H3 as a Promoter of Metastasis and Promising Therapeutic Target. Front. Oncol. 2018, 8, 264. [Google Scholar] [CrossRef] [Green Version]
- Flem-Karlsen, K.; Fodstad, Ø.; Nunes-Xavier, C.E. B7-H3 Immune Checkpoint Protein in Human Cancer. Curr. Med. Chem. 2020, 27, 4062–4086. [Google Scholar] [CrossRef]
- Fridman, W.H.; Pagès, F.; Sautès-Fridman, C.; Galon, J. The immune contexture in human tumours: Impact on clinical outcome. Nat. Rev. Cancer 2012, 12, 298–306. [Google Scholar] [CrossRef]
- Schlößer, H.A.; Theurich, S.; Shimabukuro-Vornhagen, A.; Holtick, U.; Stippel, D.L.; Von Bergwelt-Baildon, M. Overcoming tumor-mediated immunosuppression. Immunotherapy 2014, 6, 973–988. [Google Scholar] [CrossRef]
- Kosti, P.; Maher, J.; Arnold, J.N. Perspectives on Chimeric Antigen Receptor T-Cell Immunotherapy for Solid Tumors. Front. Immunol. 2018, 9, 1104. [Google Scholar] [CrossRef] [Green Version]
- Plaza, J.A.; Bonneau, P.; Prieto, V.; Sangueza, M.; MacKinnon, A.; Suster, D.; Bacchi, C.; Estrozi, B.; Kazakov, D.; Kacerovska, D.; et al. Desmoplastic melanoma: An updated immunohistochemical analysis of 40 cases with a proposal for an additional panel of stains for diagnosis. J. Cutan. Pathol. 2016, 43, 313–323. [Google Scholar] [CrossRef]
- Ivey, J.W.; Bonakdar, M.; Kanitkar, A.; Davalos, R.V.; Verbridge, S.S. Improving cancer therapies by targeting the physical and chemical hallmarks of the tumor microenvironment. Cancer Lett. 2016, 380, 330–339. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kato, Y.; Ozawa, S.; Miyamoto, C.; Maehata, Y.; Suzuki, A.; Maeda, T.; Baba, Y. Acidic extracellular microenvironment and cancer. Cancer Cell Int. 2013, 13, 89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Renner, K.; Singer, K.; Koehl, G.E.; Geissler, E.K.; Peter, K.; Siska, P.J.; Kreutz, M. Metabolic Hallmarks of Tumor and Immune Cells in the Tumor Microenvironment. Front. Immunol. 2017, 8, 248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Almeida, F.V.; Douglass, S.M.; Fane, M.E.; Weeraratna, A.T. Bad company: Microenvironmentally mediated resistance to targeted therapy in melanoma. Pigment. Cell Melanoma Res. 2019, 32, 237–247. [Google Scholar] [CrossRef]
- Jarnicki, A.G.; Lysaght, J.; Todryk, S.; Mills, K.H.G. Suppression of Antitumor Immunity by IL-10 and TGF-β-Producing T Cells Infiltrating the Growing Tumor: Influence of Tumor Environment on the Induction of CD4+ and CD8+ Regulatory T Cells. J. Immunol. 2006, 177, 896–904. [Google Scholar] [CrossRef] [Green Version]
- Viel, S.; Marçais, A.; Guimaraes, F.S.-F.; Loftus, R.; Rabilloud, J.; Grau, M.; Degouve, S.; Djebali, S.; Sanlaville, A.; Charrier, E.; et al. TGF-β inhibits the activation and functions of NK cells by repressing the mTOR pathway. Sci. Signal. 2016, 9, ra19. [Google Scholar] [CrossRef]
- Husain, Z.; Huang, Y.; Seth, P.; Sukhatme, V.P. Tumor-Derived Lactate Modifies Antitumor Immune Response: Effect on Myeloid-Derived Suppressor Cells and NK Cells. J. Immunol. 2013, 191, 1486–1495. [Google Scholar] [CrossRef]
- Harmon, C.; Robinson, M.W.; Hand, F.; AlMuaili, D.; Mentor, K.; Houlihan, D.D.; Hoti, E.; Lynch, L.; Geoghegan, J.; O’Farrelly, C. Lactate-Mediated Acidification of Tumor Microenvironment Induces Apoptosis of Liver-Resident NK Cells in Colorectal Liver Metastasis. Cancer Immunol. Res. 2018, 7, 335–346. [Google Scholar] [CrossRef] [Green Version]
- Shiga, K.; Hara, M.; Nagasaki, T.; Sato, T.; Takahashi, H.; Takeyama, H. Cancer-Associated Fibroblasts: Their Characteristics and Their Roles in Tumor Growth. Cancers 2015, 7, 2443–2458. [Google Scholar] [CrossRef]
- Hutchenreuther, J.; Vincent, K.; Norley, C.; Racanelli, M.; Gruber, S.B.; Johnson, T.M.; Fullen, D.R.; Raskin, L.; Perbal, B.; Holdsworth, D.W.; et al. Activation of cancer-associated fibroblasts is required for tumor neovascularization in a murine model of melanoma. Matrix Biol. 2018, 74, 52–61. [Google Scholar] [CrossRef]
- Solocinski, K.; Padget, M.R.; Fabian, K.P.; Wolfson, B.; Cecchi, F.; Hembrough, T.; Benz, S.C.; Rabizadeh, S.; Soon-Shiong, P.; Schlom, J.; et al. Overcoming hypoxia-induced functional suppression of NK cells. J. Immunother. Cancer 2019, 8, e000246. [Google Scholar] [CrossRef]
Name | Nucleotide Sequence |
---|---|
NKG2A-1 | GAAGCTCATTGTTGGGATCC |
NKG2A-2 | TTGAAGGTTTAATTCCGCAT |
NKG2A-3 | ACTGGAGTTCTTCGAAGTAC |
NKG2A-4 | AGGCAGCAACGAAAACCTAA |
NKG2A-5 | GGTCTGAGTAGATTACTCCT |
Primer | Nucleotide Sequence |
---|---|
Forward 1 | TACTCGTTCTCCACCTCACC |
Reverse 1 | TAACGTGAAAATTCCCCTTGTAATC |
Forward 2 | ATTTACCAGCCCATGAAGATGT |
Reverse 2 | TCCATGAAAAGCAAAAACTGAA |
CD48 | CD50 | CD54 | CD58 | CD95 | CD102 | CD112 | CD155 | CD261 | CD262 | |
---|---|---|---|---|---|---|---|---|---|---|
FM-3 | 1.50 | 1.49 | 22.71 | 34.67 | 3.08 | 1.28 | 9.17 | 56.28 | 0.97 | 9.65 |
Mel-Juso | 1.38 | 1.48 | 9.40 | 55.23 | 0.93 | 1.26 | 15.70 | 80.10 | 2.79 | 6.23 |
WM115 | 1.49 | 1.65 | 1.98 | 144.49 | 3.45 | 1.21 | 5.46 | 22.80 | 1.63 | 9.40 |
HLA-ABC | HLA-DR | HLA-E | HLA-G | MICA/B | ULBP1 | ULBP2/5/6 | ULBP3 | ULBP4 | ||
FM-3 | 34.24 | 14.53 | 4.89 | 20.68 | 11.37 | 0.49 | 2.52 | 0.48 | 1.20 | |
Mel-Juso | 30.86 | 33.69 | 7.11 | 22.73 | 21.45 | 0.58 | 7.03 | 0.78 | 0.20 | |
WM115 | 87.21 | 44.80 | 8.07 | 21.88 | 3.12 | 0.66 | 2.43 | 0.52 | 0.42 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Grote, S.; Ureña-Bailén, G.; Chan, K.C.-H.; Baden, C.; Mezger, M.; Handgretinger, R.; Schleicher, S. In Vitro Evaluation of CD276-CAR NK-92 Functionality, Migration and Invasion Potential in the Presence of Immune Inhibitory Factors of the Tumor Microenvironment. Cells 2021, 10, 1020. https://doi.org/10.3390/cells10051020
Grote S, Ureña-Bailén G, Chan KC-H, Baden C, Mezger M, Handgretinger R, Schleicher S. In Vitro Evaluation of CD276-CAR NK-92 Functionality, Migration and Invasion Potential in the Presence of Immune Inhibitory Factors of the Tumor Microenvironment. Cells. 2021; 10(5):1020. https://doi.org/10.3390/cells10051020
Chicago/Turabian StyleGrote, Stefan, Guillermo Ureña-Bailén, Kenneth Chun-Ho Chan, Caroline Baden, Markus Mezger, Rupert Handgretinger, and Sabine Schleicher. 2021. "In Vitro Evaluation of CD276-CAR NK-92 Functionality, Migration and Invasion Potential in the Presence of Immune Inhibitory Factors of the Tumor Microenvironment" Cells 10, no. 5: 1020. https://doi.org/10.3390/cells10051020