Autophagy and Endoplasmic Reticulum Stress during Onset and Progression of Arrhythmogenic Cardiomyopathy
Abstract
:1. Introduction
2. Material and Methods
2.1. Animals
2.2. Electron Microscopy
2.3. Paraffin Embedding, Sectioning and Histological Staining
2.4. LC3 and Cleaved Caspase 3 (CC3) Immunohistochemistry
2.5. SQSTM1/p62 Immunofluorescence
2.6. Real-Time PCR
2.7. In Situ Hybridization
2.8. Statistical Methods
3. Results
3.1. LC3-Positive Autophagosomes Accumulate in Cardiomyocytes of Dsg2-Mutant Mice
3.2. Increased SQSTM1/p62 Protein and Sqstm1/p62 mRNA Levels Are Detected during the Acute Phase and Late Progression of Murine Arrhythmogenic Cardiomyopathy
3.3. Ultrastructural Alterations Occur in Dsg2-Mutant Mice during Disease Onset and Chronic Disease Progression
3.4. Markers of the Unfolded Protein Response Are Increased at Disease Onset
3.5. mRNAs Coding for Calcium Handling Proteins Are Dysregulated during the Chronic Disease Phase
4. Discussion
4.1. Enhanced Autophagy and Endoplasmic Reticulum Stress May Be Induced by Altered Force Distribution
4.2. Endoplasmic Reticulum Stress and Increased Autophagy in Cardiomyocytes Coincide with Fibrotic Lesion Progression
4.3. Local ER Stress and Autophagy Are Induced in Cardiomyocytes Adjacent to Mature Fibrotic Scars and Interstitial Fibrosis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Herren, T.; Gerber, P.A.; Duru, F. Arrhythmogenic right ventricular cardiomyopathy/dysplasia: A not so rare “disease of the desmosome” with multiple clinical presentations. Clin. Res. Cardiol. 2009, 98, 141–158. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.; Chen, L.; Duru, F.; Hu, S. Heart Failure in Patients with Arrhythmogenic Cardiomyopathy. J. Clin. Med. 2021, 10, 4782. [Google Scholar] [CrossRef]
- Basso, C.; Corrado, D.; Marcus, F.I.; Nava, A.; Thiene, G. Arrhythmogenic right ventricular cardiomyopathy. Lancet 2009, 373, 1289–1300. [Google Scholar] [CrossRef]
- Marcus, F.I.; McKenna, W.J.; Sherrill, D.; Basso, C.; Bauce, B.; Bluemke, D.A.; Calkins, H.; Corrado, D.; Cox, M.G.P.J.; Daubert, J.P.; et al. Diagnosis of arrhythmogenic right ventricular cardiomyopathy/Dysplasia: Proposed modification of the task force criteria. Circulation 2010, 121, 1533–1541. [Google Scholar] [CrossRef]
- Cipriani, A.; Bauce, B.; De Lazzari, M.; Rigato, I.; Bariani, R.; Meneghin, S.; Pilichou, K.; Motta, R.; Aliberti, C.; Thiene, G.; et al. Arrhythmogenic Right Ventricular Cardiomyopathy: Characterization of Left Ventricular Phenotype and Differential Diagnosis With Dilated Cardiomyopathy. J. Am. Heart Assoc. 2020, 9, e014628. [Google Scholar] [CrossRef]
- Bennett, R.G.; Haqqani, H.M.; Berruezo, A.; Della Bella, P.; Marchlinski, F.E.; Hsu, C.J.; Kumar, S. Arrhythmogenic Cardiomyopathy in 2018–2019: ARVC/ALVC or Both? Heart Lung Circ. 2019, 28, 164–177. [Google Scholar] [CrossRef]
- Saguner, A.M. Arrhythmogenic ventricular cardiomyopathy: A paradigm shift from right to biventricular disease. World J. Cardiol. 2014, 6, 154. [Google Scholar] [CrossRef]
- Ackerman, M.J.; Priori, S.G.; Willems, S.; Berul, C.; Brugada, R.; Calkins, H.; Camm, A.J.; Ellinor, P.T.; Gollob, M.; Hamilton, R.; et al. HRS/EHRA Expert Consensus Statement on the State of Genetic Testing for the Channelopathies and Cardiomyopathies: This document was developed as a partnership between the Heart Rhythm Society (HRS) and the European Heart Rhythm Association (EHRA). Europace 2011, 13, 1077–1109. [Google Scholar] [CrossRef]
- Gemayel, C.; Pelliccia, A.; Thompson, P.D. Arrhythmogenic right ventricular cardiomyopathy. J. Am. Coll. Cardiol. 2001, 38, 1773–1781. [Google Scholar] [CrossRef] [Green Version]
- Turrini, P.; Basso, C.; Daliento, L.; Nava, A.; Thiene, G. Is arrhythmogenic right ventricular cardiomyopathy a paediatric problem too? Images Paediatr. Cardiol. 2001, 3, 18–37. [Google Scholar]
- Choy, K.W.; Murugan, D.; Mustafa, M.R. Natural products targeting ER stress pathway for the treatment of cardiovascular diseases. Pharmacol. Res. 2018, 132, 119–129. [Google Scholar] [CrossRef] [PubMed]
- Ren, J.; Bi, Y.; Sowers, J.R.; Hetz, C.; Zhang, Y. Endoplasmic reticulum stress and unfolded protein response in cardiovascular diseases. Nat. Rev. Cardiol. 2021, 18, 499–521. [Google Scholar] [CrossRef] [PubMed]
- Zech, A.T.L.; Singh, S.R.; Schlossarek, S.; Carrier, L. Autophagy in cardiomyopathies. Biochim. Biophys. Acta Mol. Cell Res. 2020, 1867, 118432. [Google Scholar] [CrossRef] [PubMed]
- Kuma, A.; Matsui, M.; Mizushima, N. LC3, an Autophagosome Marker, Can be Incorporated into Protein Aggregates Independent of Autophagy: Caution in the Interpretation of LC3 Localization. Autophagy 2007, 3, 323–328. [Google Scholar] [CrossRef] [Green Version]
- Ogata, M.; Hino, S.-i.; Saito, A.; Morikawa, K.; Kondo, S.; Kanemoto, S.; Murakami, T.; Taniguchi, M.; Tanii, I.; Yoshinaga, K.; et al. Autophagy Is Activated for Cell Survival after Endoplasmic ReticulumStress. Mol. Cell. Biol. 2006, 26, 9220–9231. [Google Scholar] [CrossRef] [Green Version]
- Yorimitsu, T.; Klionsky, D.J. Eating the endoplasmic reticulum: Quality control by autophagy. Trends Cell Biol. 2007, 17, 279–285. [Google Scholar] [CrossRef]
- Klionsky, D.J. Autophagy: From phenomenology to molecular understanding in less than a decade. Nat. Rev. Mol. Cell Biol. 2007, 8, 931–937. [Google Scholar] [CrossRef]
- Castillero, E.; Akashi, H.; Pendrak, K.; Yerebakan, H.; Najjar, M.; Wang, C.; Naka, Y.; Mancini, D.; Sweeney, H.L.; D’Armiento, J.; et al. Attenuation of the unfolded protein response and endoplasmic reticulum stress after mechanical unloading in dilated cardiomyopathy. Am. J. Physiol. Heart Circ. Physiol. 2015, 309, H459–H470. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Groenendyk, J.; Sreenivasaiah, P.K.; Kim, D.H.; Agellon, L.B.; Michalak, M. Biology of Endoplasmic Reticulum Stress in the Heart. Circ. Res. 2010, 107, 1185–1197. [Google Scholar] [CrossRef] [Green Version]
- Nishida, K.; Kyoi, S.; Yamaguchi, O.; Sadoshima, J.; Otsu, K.; Sciarretta, S.; Maejima, Y.; Zablocki, D.; Sadoshima, J. The role of autophagy in the heart. Cell Death Differ. 2009, 16, 31–38. [Google Scholar] [CrossRef] [Green Version]
- Belaidi, E.; Thomas, A.; Bourdier, G.; Moulin, S.; Lemarié, E.; Levy, P.; Pépin, J.L.; Korichneva, I.; Godin-Ribuot, D.; Arnaud, C. Endoplasmic reticulum stress as a novel inducer of hypoxia inducible factor-1 activity: Its role in the susceptibility to myocardial ischemia-reperfusion induced by chronic intermittent hypoxia. Int. J. Cardiol. 2016, 210, 45–53. [Google Scholar] [CrossRef]
- Bravo-San Pedro, J.M.; Kroemer, G.; Galluzzi, L. Autophagy and Mitophagy in Cardiovascular Disease. Circ. Res. 2017, 120, 1812–1824. [Google Scholar] [CrossRef] [PubMed]
- Mialet-Perez, J.; Vindis, C. Autophagy in health and disease: Focus on the cardiovascular system. Essays Biochem. 2017, 61, 721–732. [Google Scholar] [CrossRef]
- Kant, S.; Krull, P.; Eisner, S.; Leube, R.E.; Krusche, C.A. Histological and ultrastructural abnormalities in murine desmoglein 2-mutant hearts. Cell Tissue Res. 2012, 348, 249–259. [Google Scholar] [CrossRef] [PubMed]
- Rizzo, S.; Lodder, E.M.; Verkerk, A.O.; Wolswinkel, R.; Beekman, L.; Pilichou, K.; Basso, C.; Remme, C.A.; Thiene, G.; Bezzina, C.R. Intercalated disc abnormalities, reduced Na+ current density, and conduction slowing in desmoglein-2 mutant mice prior to cardiomyopathic changes. Cardiovasc. Res. 2012, 95, 409–418. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gerçek, M.; Gerçek, M.; Kant, S.; Simsekyilmaz, S.; Kassner, A.; Milting, H.; Liehn, E.A.; Leube, R.E.; Krusche, C.A. Cardiomyocyte Hypertrophy in Arrhythmogenic Cardiomyopathy. Am. J. Pathol. 2017, 187, 752–766. [Google Scholar] [CrossRef] [Green Version]
- Krusche, C.A.; Holthöfer, B.; Hofe, V.; Van De Sandt, A.M.; Eshkind, L.; Bockamp, E.; Merx, M.W.; Kant, S.; Windoffer, R.; Leube, R.E. Desmoglein 2 mutant mice develop cardiac fibrosis and dilation. Basic Res. Cardiol. 2011, 106, 617–633. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lubos, N.; van der Gaag, S.; Gerçek, M.; Kant, S.; Leube, R.E.; Krusche, C.A. Inflammation shapes pathogenesis of murine arrhythmogenic cardiomyopathy. Basic Res. Cardiol. 2020, 115, 42. [Google Scholar] [CrossRef]
- Fressart, V.; Duthoit, G.; Donal, E.; Probst, V.; Deharo, J.C.; Chevalier, P.; Klug, D.; Dubourg, O.; Delacretaz, E.; Cosnay, P.; et al. Desmosomal gene analysis in arrhythmogenic right ventricular dysplasia/cardiomyopathy: Spectrum of mutations and clinical impact in practice. Europace 2010, 12, 861–868. [Google Scholar] [CrossRef]
- Lin, Y.; Zhang, Q.; Zhong, Z.A.; Xu, Z.; He, S.; Rao, F.; Liu, Y.; Tang, J.; Wang, F.; Liu, H.; et al. Whole Genome Sequence Identified a Rare Homozygous Pathogenic Mutation of the DSG2 Gene in a Familial Arrhythmogenic Cardiomyopathy Involving Both Ventricles. Cardiology 2017, 138, 41–54. [Google Scholar] [CrossRef]
- Brodehl, A.; Meshkov, A.; Myasnikov, R.; Kiseleva, A.; Kulikova, O.; Klauke, B.; Sotnikova, E.; Stanasiuk, C.; Divashuk, M.; Pohl, G.M.; et al. Hemi- and Homozygous Loss-of-Function Mutations in DSG2 (Desmoglein-2) Cause Recessive Arrhythmogenic Cardiomyopathy with an Early Onset. Int. J. Mol. Sci. 2021, 22, 3786. [Google Scholar] [CrossRef] [PubMed]
- Gerull, B.; Brodehl, A. Insights into Genetics and Pathophysiology of Arrhythmogenic Cardiomyopathy. Curr. Heart Fail. Rep. 2021, 18, 378–390. [Google Scholar] [CrossRef] [PubMed]
- Kant, S.; Holthöfer, B.; Magin, T.M.; Krusche, C.A.; Leube, R.E. Desmoglein 2-Dependent Arrhythmogenic Cardiomyopathy Is Caused by a Loss of Adhesive Function. Circ. Cardiovasc. Genet. 2015, 8, 553–563. [Google Scholar] [CrossRef] [Green Version]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Chelko, S.P.; Asimaki, A.; Lowenthal, J.; Bueno-Beti, C.; Bedja, D.; Scalco, A.; Amat-Alarcon, N.; Andersen, P.; Judge, D.P.; Tung, L.; et al. Therapeutic Modulation of the Immune Response in Arrhythmogenic Cardiomyopathy. Circulation 2019, 140, 1491–1505. [Google Scholar] [CrossRef]
- Ng, K.E.; Delaney, P.J.; Thenet, D.; Murtough, S.; Webb, C.M.; Zaman, N.; Tsisanova, E.; Mastroianni, G.; Walker, S.L.M.; Westaby, J.D.; et al. Early inflammation precedes cardiac fibrosis and heart failure in desmoglein 2 murine model of arrhythmogenic cardiomyopathy. Cell Tissue Res. 2021, 386, 79–98. [Google Scholar] [CrossRef] [PubMed]
- Pilichou, K.; Remme, C.A.; Basso, C.; Campian, M.E.; Rizzo, S.; Barnett, P.; Scicluna, B.P.; Bauce, B.; Van Den Hoff, M.J.B.; De Bakker, J.M.T.; et al. Myocyte necrosis underlies progressive myocardial dystrophy in mouse dsg2-related arrhythmogenic right ventricular cardiomyopathy. J. Exp. Med. 2009, 206, 1787–1802. [Google Scholar] [CrossRef] [Green Version]
- Kabeya, Y.; Mizushima, N.; Ueno, T.; Yamamoto, A.; Kirisako, T.; Noda, T.; Kominami, E.; Ohsumi, Y.; Yoshimori, T. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J. 2000, 19, 5720–5728. [Google Scholar] [CrossRef] [PubMed]
- Klionsky, D.J.; Abdelmohsen, K.; Abe, A.; Abedin, M.J.; Abeliovich, H.; Acevedo Arozena, A.; Adachi, H.; Adams, C.M.; Adams, P.D.; Adeli, K.; et al. Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition). Autophagy 2016, 12, 1–222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosenfeldt, M.T.; Nixon, C.; Liu, E.; Mah, L.Y.; Ryan, K.M. Analysis of macroautophagy by immunohistochemistry. Autophagy 2012, 8, 963–969. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, S.; Jiang, Y.-P.; Ballou, L.M.; Zong, W.-X.; Lin, R.Z. Activation of Gαq in Cardiomyocytes Increases Vps34 Activity and Stimulates Autophagy. J. Cardiovasc. Pharmacol. 2017, 69, 198–211. [Google Scholar] [CrossRef] [Green Version]
- Zheng, Q.; Su, H.; Ranek, M.J.; Wang, X. Autophagy and p62 in Cardiac Proteinopathy. Circ. Res. 2011, 109, 296–308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bjørkøy, G.; Lamark, T.; Brech, A.; Outzen, H.; Perander, M.; Øvervatn, A.; Stenmark, H.; Johansen, T. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 2005, 171, 603–614. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Johansen, T.; Lamark, T. Selective autophagy mediated by autophagic adapter proteins. Autophagy 2011, 7, 279–296. [Google Scholar] [CrossRef] [PubMed]
- Bernales, S.; McDonald, K.L.; Walter, P. Autophagy Counterbalances Endoplasmic Reticulum Expansion during the Unfolded Protein Response. PLoS Biol. 2006, 4, e423. [Google Scholar] [CrossRef] [Green Version]
- Bravo, R.; Parra, V.; Gatica, D.; Rodriguez, A.E.; Torrealba, N.; Paredes, F.; Wang, Z.V.; Zorzano, A.; Hill, J.A.; Jaimovich, E.; et al. Endoplasmic Reticulum and the Unfolded Protein Response: Dynamics and Metabolic Integration. Int. Rev. Cell Mol. Biol. 2013, 301, 215–290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Senft, D.; Ronai, Z.A. UPR, autophagy, and mitochondria crosstalk underlies the ER stress response. Trends Biochem. Sci. 2015, 40, 141–148. [Google Scholar] [CrossRef] [Green Version]
- Nah, J.; Zhai, P.; Huang, C.Y.; Fernandez, A.F.; Mareedu, S.; Levine, B.; Sadoshima, J. Upregulation of Rubicon promotes autosis during myocardial ischemia/reperfusion injury. J. Clin. Investig. 2020, 130, 2978–2991. [Google Scholar] [CrossRef] [PubMed]
- B’Chir, W.; Maurin, A.C.; Carraro, V.; Averous, J.; Jousse, C.; Muranishi, Y.; Parry, L.; Stepien, G.; Fafournoux, P.; Bruhat, A. The eIF2α/ATF4 pathway is essential for stress-induced autophagy gene expression. Nucleic Acids Res. 2013, 41, 7683–7699. [Google Scholar] [CrossRef] [Green Version]
- Hu, H.; Tian, M.; Ding, C.; Yu, S. The C/EBP homologous protein (CHOP) transcription factor functions in endoplasmic reticulum stress-induced apoptosis and microbial infection. Front. Immunol. 2019, 9, 3083. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rouschop, K.M.A.; van den Beucken, T.; Dubois, L.; Niessen, H.; Bussink, J.; Savelkouls, K.; Keulers, T.; Mujcic, H.; Landuyt, W.; Voncken, J.W.; et al. The unfolded protein response protects human tumor cells during hypoxia through regulation of the autophagy genes MAP1LC3B and ATG5. J. Clin. Investig. 2010, 120, 127–141. [Google Scholar] [CrossRef] [PubMed]
- Zinszner, H.; Kuroda, M.; Wang, X.; Batchvarova, N.; Lightfoot, R.T.; Remotti, H.; Stevens, J.L.; Ron, D. CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev. 1998, 12, 982–995. [Google Scholar] [CrossRef] [PubMed]
- van Schadewijk, A.; van’t Wout, E.F.; Stolk, J.; Hiemstra, P.S. A quantitative method for detection of spliced X-box binding protein-1 (XBP1) mRNA as a measure of endoplasmic reticulum (ER) stress. Cell Stress Chaperones 2012, 17, 275–279. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kania, E.; Pająk, B.; Orzechowski, A. Calcium homeostasis and ER stress in control of autophagy in cancer cells. BioMed Res. Int. 2015, 2015, 352794. [Google Scholar] [CrossRef] [Green Version]
- Naudin, V.; Oliviero, P.; Rannou, F.; Beuve, C.S.; Charlemagne, D. The density of ryanodine receptors decreases with pressure overload-induced rat cardiac hypertrophy. FEBS Lett. 1991, 285, 135–138. [Google Scholar] [CrossRef] [Green Version]
- Pogwizd, S.M.; Qi, M.; Yuan, W.; Samarel, A.M.; Bers, D.M. Upregulation of Na+/Ca2+ Exchanger Expression and Function in an Arrhythmogenic Rabbit Model of Heart Failure. Circ. Res. 1999, 85, 1009–1019. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vatner, D.E.; Sato, N.; Kiuchi, K.; Shannon, R.P.; Vatner, S.F. Decrease in myocardial ryanodine receptors and altered excitation- contraction coupling early in the development of heart failure. Circulation 1994, 90, 1423–1430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gottlieb, R.A.; Mentzer, R.M. Autophagy During Cardiac Stress: Joys and Frustrations of Autophagy. Annu. Rev. Physiol. 2010, 72, 45–59. [Google Scholar] [CrossRef] [Green Version]
- Gupta, M.K.; Kaminski, R.; Mullen, B.; Gordon, J.; Burdo, T.H.; Cheung, J.Y.; Feldman, A.M.; Madesh, M.; Khalili, K. HIV-1 Nef-induced cardiotoxicity through dysregulation of autophagy. Sci. Rep. 2017, 7, 8572. [Google Scholar] [CrossRef] [PubMed]
- Nakai, A.; Yamaguchi, O.; Takeda, T.; Higuchi, Y.; Hikoso, S.; Taniike, M.; Omiya, S.; Mizote, I.; Matsumura, Y.; Asahi, M.; et al. The role of autophagy in cardiomyocytes in the basal state and in response to hemodynamic stress. Nat. Med. 2007, 13, 619–624. [Google Scholar] [CrossRef] [PubMed]
- Lee, E.; Koo, Y.; Ng, A.; Wei, Y.; Luby-Phelps, K.; Juraszek, A.; Xavier, R.J.; Cleaver, O.; Levine, B.; Amatruda, J.F. Autophagy is essential for cardiac morphogenesis during vertebrate development. Autophagy 2014, 10, 572–587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- van Bavel, J.J.; Vos, M.A.; van der Heyden, M.A. Cardiac Arrhythmias and Antiarrhythmic Drugs: An Autophagic Perspective. Front. Physiol. 2018, 9, 127. [Google Scholar] [CrossRef] [Green Version]
- Hamada, H.; Suzuki, M.; Yuasa, S.; Mimura, N.; Shinozuka, N.; Takada, Y.; Suzuki, M.; Nishino, T.; Nakaya, H.; Koseki, H.; et al. Dilated Cardiomyopathy Caused by Aberrant Endoplasmic Reticulum Quality Control in Mutant KDEL Receptor Transgenic Mice. Mol. Cell. Biol. 2004, 24, 8007–8017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, H.; Lei, H.; Shi, Y.; Wang, J.-J.; Chen, N.; Li, Z.-H.; Chen, Y.-F.; Ye, Q.-F.; Yang, Y. Autophagy inhibitor 3-methyladenine alleviates overload-exercise-induced cardiac injury in rats. Acta Pharmacol. Sin. 2017, 38, 990–997. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maron, B.J.; Ferrans, V.J.; Roberts, W.C. Ultrastructural features of degenerated cardiac muscle cells in patients with cardiac hypertrophy. Am. J. Pathol. 1975, 79, 387–434. [Google Scholar] [PubMed]
- DeLaughter, D.M.; Bick, A.G.; Wakimoto, H.; McKean, D.; Gorham, J.M.; Kathiriya, I.S.; Hinson, J.T.; Homsy, J.; Gray, J.; Pu, W.; et al. Single-Cell Resolution of Temporal Gene Expression during Heart Development. Dev. Cell 2016, 39, 480–490. [Google Scholar] [CrossRef] [Green Version]
- Giudice, J.; Xia, Z.; Wang, E.T.; Scavuzzo, M.A.; Ward, A.J.; Kalsotra, A.; Wang, W.; Wehrens, X.H.; Burge, C.B.; Li, W.; et al. Alternative splicing regulates vesicular trafficking genes in cardiomyocytes during postnatal heart development. Nat. Commun. 2014, 5, 3603. [Google Scholar] [CrossRef] [Green Version]
- Banerjee, I.; Fuseler, J.W.; Price, R.L.; Borg, T.K.; Baudino, T.A. Determination of cell types and numbers during cardiac development in the neonatal and adult rat and mouse. Am. J. Physiol. Heart Circ. Physiol. 2007, 293, H1883–H1891. [Google Scholar] [CrossRef] [Green Version]
- Imanaka-Yoshida, K.; Amitani, A.; Ioshii, S.O.; Koyabu, S.; Yamakado, T.; Yoshida, T. Alterations of expression and distribution of the Ca(2+)-storing proteins in endo/sarcoplasmic reticulum during differentiation of rat cardiomyocytes. J. Mol. Cell Cardiol. 1996, 28, 553–562. [Google Scholar] [CrossRef]
- Zhou, Y.Q.; Foster, F.S.; Parkes, R.; Adamson, S.L. Developmental changes in left and right ventricular diastolic filling patterns in mice. Am. J. Physiol. Heart Circ. Physiol. 2003, 285, H1563–H1575. [Google Scholar] [CrossRef] [Green Version]
- Wang, Q.; Lin, J.L.; Chan, S.Y.; Lin, J.J. The Xin repeat-containing protein, mXinbeta, initiates the maturation of the intercalated discs during postnatal heart development. Dev. Biol. 2013, 374, 264–280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pruna, M.; Ehler, E. The intercalated disc: A mechanosensing signalling node in cardiomyopathy. Biophys. Rev. 2020, 12, 931–946. [Google Scholar] [CrossRef] [PubMed]
- Henning, R.H.; Brundel, B. Proteostasis in cardiac health and disease. Nat. Rev. Cardiol. 2017, 14, 637–653. [Google Scholar] [CrossRef]
- Agnetti, G.; Herrmann, H.; Cohen, S. New roles for desmin in the maintenance of muscle homeostasis. FEBS J. 2021. [Google Scholar] [CrossRef] [PubMed]
- Capetanaki, Y.; Bloch, R.J.; Kouloumenta, A.; Mavroidis, M.; Psarras, S. Muscle intermediate filaments and their links to membranes and membranous organelles. Exp. Cell Res. 2007, 313, 2063–2076. [Google Scholar] [CrossRef]
- Moazzen, H.; Venger, K.; Kant, S.; Leube, R.E.; Krusche, C.A. Desmoglein 2 regulates cardiogenesis by restricting hematopoiesis in the developing murine heart. Sci. Rep. 2021, 11, 21687. [Google Scholar] [CrossRef]
- Hohfeld, J.; Benzing, T.; Bloch, W.; Furst, D.O.; Gehlert, S.; Hesse, M.; Hoffmann, B.; Hoppe, T.; Huesgen, P.F.; Kohn, M.; et al. Maintaining proteostasis under mechanical stress. EMBO Rep. 2021, 22, e52507. [Google Scholar] [CrossRef] [PubMed]
- Bliley, J.M.; Vermeer, M.; Duffy, R.M.; Batalov, I.; Kramer, D.; Tashman, J.W.; Shiwarski, D.J.; Lee, A.; Teplenin, A.S.; Volkers, L.; et al. Dynamic loading of human engineered heart tissue enhances contractile function and drives a desmosome-linked disease phenotype. Sci. Transl. Med. 2021, 13, eabd1817. [Google Scholar] [CrossRef] [PubMed]
- Gautel, M.; Djinović-Carugo, K. The sarcomeric cytoskeleton: From molecules to motion. J. Exp. Biol. 2016, 219, 135–145. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krüger, M.; Linke, W.A. The giant protein titin: A regulatory node that integrates myocyte signaling pathways. J. Biol. Chem. 2011, 286, 9905–9912. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lange, S.; Xiang, F.; Yakovenko, A.; Vihola, A.; Hackman, P.; Rostkova, E.; Kristensen, J.; Brandmeier, B.; Franzen, G.; Hedberg, B.; et al. Cell biology: The kinase domain of titin controls muscle gene expression and protein turnover. Science 2005, 308, 1599–1603. [Google Scholar] [CrossRef] [Green Version]
- Shah, A.K.; Bhullar, S.K.; Elimban, V.; Dhalla, N.S. Oxidative Stress as A Mechanism for Functional Alterations in Cardiac Hypertrophy and Heart Failure. Antioxidants 2021, 10, 931. [Google Scholar] [CrossRef]
- Del Re, D.P.; Amgalan, D.; Linkermann, A.; Liu, Q.; Kitsis, R.N. Fundamental Mechanisms of Regulated Cell Death and Implications for Heart Disease. Physiol. Rev. 2019, 99, 1765–1817. [Google Scholar] [CrossRef]
- Yao, Y.; Lu, Q.; Hu, Z.; Yu, Y.; Chen, Q.; Wang, Q.K. A non-canonical pathway regulates ER stress signaling and blocks ER stress-induced apoptosis and heart failure. Nat. Commun. 2017, 8, 133. [Google Scholar] [CrossRef] [Green Version]
- Cerrone, M.; Montnach, J.; Lin, X.; Zhao, Y.T.; Zhang, M.; Agullo-Pascual, E.; Leo-Macias, A.; Alvarado, F.J.; Dolgalev, I.; Karathanos, T.V.; et al. Plakophilin-2 is required for transcription of genes that control calcium cycling and cardiac rhythm. Nat. Commun. 2017, 8, 106. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Liang, Y.; Bradford, W.H.; Sheikh, F. Desmosomes: Emerging pathways and non-canonical functions in cardiac arrhythmias and disease. Biophys. Rev. 2021, 13, 697–706. [Google Scholar] [CrossRef] [PubMed]
- Dhalla, N.S.; Dent, M.R.; Tappia, P.S.; Sethi, R.; Barta, J.; Goyal, R.K. Subcellular remodeling as a viable target for the treatment of congestive heart failure. J. Cardiovasc. Pharmacol. Ther. 2006, 11, 31–45. [Google Scholar] [CrossRef] [PubMed]
- Michael, A.; Haq, S.; Chen, X.; Hsich, E.; Cui, L.; Walters, B.; Shao, Z.; Bhattacharya, K.; Kilter, H.; Huggins, G.; et al. Glycogen synthase kinase-3beta regulates growth, calcium homeostasis, and diastolic function in the heart. J. Biol. Chem. 2004, 279, 21383–21393. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.C.; Perez-Hernandez, M.; Alvarado, F.J.; Maurya, S.R.; Montnach, J.; Yin, Y.; Zhang, M.; Lin, X.; Vasquez, C.; Heguy, A.; et al. Disruption of Ca(2+)i Homeostasis and Connexin 43 Hemichannel Function in the Right Ventricle Precedes Overt Arrhythmogenic Cardiomyopathy in Plakophilin-2-Deficient Mice. Circulation 2019, 140, 1015–1030. [Google Scholar] [CrossRef]
- Wang, Y.; Li, C.; Shi, L.; Chen, X.; Cui, C.; Huang, J.; Chen, B.; Hall, D.D.; Pan, Z.; Lu, M.; et al. Integrin beta1D Deficiency-Mediated RyR2 Dysfunction Contributes to Catecholamine-Sensitive Ventricular Tachycardia in Arrhythmogenic Right Ventricular Cardiomyopathy. Circulation 2020, 141, 1477–1493. [Google Scholar] [CrossRef]
- Chen, P.; Xiao, Y.; Wang, Y.; Zheng, Z.; Chen, L.; Yang, X.; Li, J.; Wu, W.; Zhang, S. Intracellular calcium current disorder and disease phenotype in OBSCN mutant iPSC-based cardiomyocytes in arrhythmogenic right ventricular cardiomyopathy. Theranostics 2020, 10, 11215–11229. [Google Scholar] [CrossRef]
- Dou, W.; Zhao, Q.; Malhi, M.; Liu, X.; Zhang, Z.; Wang, L.; Masse, S.; Nanthakumar, K.; Hamilton, R.; Maynes, J.T.; et al. Label-free conduction velocity mapping and gap junction assessment of functional iPSC-Cardiomyocyte monolayers. Biosens. Bioelectron. 2020, 167, 112468. [Google Scholar] [CrossRef] [PubMed]
- El-Battrawy, I.; Zhao, Z.; Lan, H.; Cyganek, L.; Tombers, C.; Li, X.; Buljubasic, F.; Lang, S.; Tiburcy, M.; Zimmermann, W.H.; et al. Electrical dysfunctions in human-induced pluripotent stem cell-derived cardiomyocytes from a patient with an arrhythmogenic right ventricular cardiomyopathy. Europace 2018, 20, f46–f56. [Google Scholar] [CrossRef] [PubMed]
- Hawthorne, R.N.; Blazeski, A.; Lowenthal, J.; Kannan, S.; Teuben, R.; DiSilvestre, D.; Morrissette-McAlmon, J.; Saffitz, J.E.; Boheler, K.R.; James, C.A.; et al. Altered Electrical, Biomolecular, and Immunologic Phenotypes in a Novel Patient-Derived Stem Cell Model of Desmoglein-2 Mutant ARVC. J. Clin. Med. 2021, 10, 3061. [Google Scholar] [CrossRef] [PubMed]
- Deftereos, S.; Papoutsidakis, N.; Giannopoulos, G.; Angelidis, C.; Raisakis, K.; Bouras, G.; Davlouros, P.; Panagopoulou, V.; Goudevenos, J.; Cleman, M.W.; et al. Calcium Ions in Inherited Cardiomyopathies. Med. Chem. 2016, 12, 139–150. [Google Scholar] [CrossRef]
- Moccia, F.; Lodola, F.; Stadiotti, I.; Pilato, C.A.; Bellin, M.; Carugo, S.; Pompilio, G.; Sommariva, E.; Maione, A.S. Calcium as a Key Player in Arrhythmogenic Cardiomyopathy: Adhesion Disorder or Intracellular Alteration? Int. J. Mol. Sci. 2019, 20, 3986. [Google Scholar] [CrossRef] [Green Version]
- van Opbergen, C.J.M.; Delmar, M.; van Veen, T.A.B. Potential new mechanisms of pro-arrhythmia in arrhythmogenic cardiomyopathy: Focus on calcium sensitive pathways. Neth. Heart J. 2017, 25, 157–169. [Google Scholar] [CrossRef] [Green Version]
- Gyöngyösi, M.; Winkler, J.; Ramos, I.; Do, Q.T.; Firat, H.; McDonald, K.; González, A.; Thum, T.; Díez, J.; Jaisser, F.; et al. Myocardial fibrosis: Biomedical research from bench to bedside. Eur. J. Heart Fail. 2017, 19, 177–191. [Google Scholar] [CrossRef]
- Kant, S.; Freytag, B.; Herzog, A.; Reich, A.; Merkel, R.; Hoffmann, B.; Krusche, C.A.; Leube, R.E. Desmoglein 2 mutation provokes skeletal muscle actin expression and accumulation at intercalated discs in murine hearts. J. Cell Sci. 2019, 132, jcs199612. [Google Scholar] [CrossRef] [Green Version]
Gene | NCBI ID | Sequence Forward (5′–3′) | Sequence Reverse (5′–3′) | UPL |
---|---|---|---|---|
Chop | NM_007837.3 | GCGACAGAGCCAGAATAACA | GATGCACTTCCTTCTGGAACA | #91 |
Sqstm1/p62 | NM_011018.3 | AGACCC CTCACAGGAAGGAC | CATCTGGGAGAGGGACTCAA | #41 |
uXbp1 | NM_013842.3 | TGACGAGGTTCCAGAGGTG | TGCAGAGGTGCACATAGTCTG | #49 |
sXbp1 | NM_001271730.1 | AGCAAGTGGTGGATTTGGAA | CCGTGAGTTTTCTCCCGTAA | #78 |
Hmbs (reference gene) | NM_013551.2 | AAGTTCCCCCACCTGGAA | GACGATGGCACTGAATTCCT | #42 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pitsch, M.; Kant, S.; Mytzka, C.; Leube, R.E.; Krusche, C.A. Autophagy and Endoplasmic Reticulum Stress during Onset and Progression of Arrhythmogenic Cardiomyopathy. Cells 2022, 11, 96. https://doi.org/10.3390/cells11010096
Pitsch M, Kant S, Mytzka C, Leube RE, Krusche CA. Autophagy and Endoplasmic Reticulum Stress during Onset and Progression of Arrhythmogenic Cardiomyopathy. Cells. 2022; 11(1):96. https://doi.org/10.3390/cells11010096
Chicago/Turabian StylePitsch, Mark, Sebastian Kant, Corinna Mytzka, Rudolf E. Leube, and Claudia A. Krusche. 2022. "Autophagy and Endoplasmic Reticulum Stress during Onset and Progression of Arrhythmogenic Cardiomyopathy" Cells 11, no. 1: 96. https://doi.org/10.3390/cells11010096