The miR-100-5p Targets SMARCA5 to Regulate the Apoptosis and Intracellular Survival of BCG in Infected THP-1 Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Growth and Cell Culture
2.2. Cell Infection with BCG
2.3. Total RNA Extraction and Sequencing
2.4. Cell Transfection
2.5. Quantitative Real-Time Polymerase Chain Reaction
2.6. Cell Death Assay
2.7. Apoptosis Assay
2.8. Western Blotting Assay
2.9. Assay on Intracellular Bacterial Number
2.10. Target Gene Prediction and Analysis
2.11. Dual-Luciferase Reporter Assay
2.12. Statistical Analysis
3. Results
3.1. BCG Infection Reduced miR-100-5p Expression in THP-1 Cells
3.2. miR-100-5p Inhibited Apoptosis of BCG Infected THP-1 Cells
3.3. miR-100-5p Regulates the PI3K/AKT Signalling Pathway
3.4. miR-100-5p Promoted BCG Intracellular Survival via Suppression of Apoptosis
3.5. miR-100-5p Directly Targets SMARCA5
3.6. miR-100-5p Regulates Apoptosis and BCG Survival in THP-1 via SMARCA5
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- WHO. Global Tuberculosis Report 2020. 2021. Available online: https://www.who.int/publications/i/item/9789240013131 (accessed on 13 May 2021).
- Zuniga, E.S.; Early, J.; Parish, T. The future for early-stage tuberculosis drug discovery. Future Microbiol. 2015, 10, 217–229. [Google Scholar] [CrossRef] [PubMed]
- Liang, S.X.; Song, Z.G.; Wu, Y.Y.; Gao, Y.P.; Gao, M.Q.; Liu, F.Y.; Wang, F.Y.; Zhang, Y. MicroRNA-27b Modulates Inflammatory Response and Apoptosis during Mycobacterium tuberculosis Infection. J. Immunol. 2018, 200, 3506–3518. [Google Scholar] [CrossRef] [PubMed]
- Jia, J.Y.; Abudu, Y.P.; Claude-Taupin, A.; Gu, Y.X.; Kumar, S.; Choi, S.W.; Peters, R.; Mudd, M.H.; Allers, L.; Salemi, M.; et al. Galectins Control mTOR in Response to Endomembrane Damage. Mol. Cell 2018, 70, 120. [Google Scholar] [CrossRef]
- Behar, S.M.; Briken, V. Apoptosis inhibition by intracellular bacteria and its consequence on host immunity. Curr. Opin. Immunol. 2019, 60, 103–110. [Google Scholar] [CrossRef] [PubMed]
- Zhai, W.J.; Wu, F.J.; Zhang, Y.Y.; Fu, Y.R.; Liu, Z.J. The Immune Escape Mechanisms of Mycobacterium Tuberculosis. Int. J. Mol. Sci. 2019, 20, 340. [Google Scholar] [CrossRef] [PubMed]
- Oddo, M.; Renno, T.; Attinger, A.; Bakker, T.; MacDonald, H.R.; Meylan, P.R.A. Fas ligand-induced apoptosis of infected human macrophages reduces the viability of intracellular Mycobacterium tuberculosis. J. Immunol. 1998, 160, 5448–5454. [Google Scholar] [CrossRef] [PubMed]
- Keane, J.; Remold, H.G.; Kornfeld, H. Virulent Mycobacterium tuberculosis strains evade apoptosis of infected alveolar macrophages. J. Immunol. 2000, 164, 2016–2020. [Google Scholar] [CrossRef]
- Riendeau, C.J.; Kornfeld, H. THP-1 cell apoptosis in response to mycobacterial infection. Infect Immun. 2003, 71, 254–259. [Google Scholar] [CrossRef]
- Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
- Ouimet, M.; Koster, S.; Sakowski, E.; Ramkhelawon, B.; van Solingen, C.; Oldebeken, S.; Karunakaran, D.; Portal-Celhay, C.; Sheedy, F.J.; Ray, T.D.; et al. Mycobacterium tuberculosis induces the miR-33 locus to reprogram autophagy and host lipid metabolism. Nat. Immunol. 2016, 17, 677–686. [Google Scholar] [CrossRef] [Green Version]
- Huang, J.; Jiao, J.H.; Xu, W.H.; Zhao, H.Y.; Zhang, C.X.; Shi, Y.; Xiao, Z.J. miR-155 is upregulated in patients with active tuberculosis and inhibits apoptosis of monocytes by targeting FOXO3. Mol. Med. Rep. 2015, 12, 7102–7108. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Yue, Y.; Xu, W.; Xiong, S. MicroRNA-146a represses mycobacteria-induced inflammatory response and facilitates bacterial replication via targeting IRAK-1 and TRAF-6. PLoS ONE 2013, 8, e81438. [Google Scholar] [CrossRef]
- Zhao, Z.; Hao, J.; Li, X.; Chen, Y.; Qi, X. MiR-21-5p regulates mycobacterial survival and inflammatory responses by targeting Bcl-2 and TLR4 in Mycobacterium tuberculosis-infected macrophages. FEBS Lett. 2019, 593, 1326–1335. [Google Scholar] [CrossRef] [PubMed]
- Wallach, T.; Mossmann, Z.J.; Szczepek, M.; Wetzel, M.; Machado, R.; Raden, M.; Miladi, M.; Kleinau, G.; Kruger, C.; Dembny, P.; et al. MicroRNA-100-5p and microRNA-298-5p released from apoptotic cortical neurons are endogenous Toll-like receptor 7/8 ligands that contribute to neurodegeneration. Mol. Neurodegener. 2021, 16, 80. [Google Scholar] [CrossRef]
- Li, X.; Ren, Y.; Liu, D.; Yu, X.; Chen, K. Role of miR-100-5p and CDC25A in breast carcinoma cells. PeerJ 2022, 9, e12263. [Google Scholar] [CrossRef]
- Ye, Y.; Li, S.L.; Wang, J.J. miR-100-5p Downregulates mTOR to Suppress the Proliferation, Migration, and Invasion of Prostate Cancer Cells. Front Oncol. 2020, 10, 578948. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Liu, X.; Wang, Y.; Yang, S.; Chen, Y.; Yuan, T. miR-100 inhibits the migration and invasion of nasopharyngeal carcinoma by targeting IGF1R. Oncol. Lett. 2018, 15, 8333–8338. [Google Scholar] [CrossRef] [PubMed]
- Zeng, J.; Wang, L.; Zhao, J.; Zheng, Z.; Peng, J.; Zhang, W.; Wen, T.; Nie, J.; Ding, L.; Yi, D. MiR-100-5p regulates cardiac hypertrophy through activation of autophagy by targeting mTOR. Hum. Cell 2021, 34, 1388–1397. [Google Scholar] [CrossRef]
- Zhu, Y.F.; Xiao, Y.; Kong, D.L.; Liu, H.; Chen, X.; Chen, Y.Y.; Zhu, T.T.; Peng, Y.C.; Zhai, W.J.; Hu, C.M.; et al. Down-Regulation of miR-378d Increased Rab10 Expression to Help Clearance of Mycobacterium tuberculosis in Macrophages. Front Cell Infect Mi. 2020, 10, 108. [Google Scholar] [CrossRef]
- Zhu, T.; Liu, H.; Su, L.; Xiong, X.; Wang, J.; Xiao, Y.; Zhu, Y.; Peng, Y.; Dawood, A.; Hu, C.; et al. MicroRNA-18b-5p Downregulation Favors Mycobacterium tuberculosis Clearance in Macrophages via HIF-1alpha by Promoting an Inflammatory Response. ACS Infect Dis. 2021, 7, 800–810. [Google Scholar] [CrossRef] [PubMed]
- Kumar, M.; Sahu, S.K.; Kumar, R.; Subuddhi, A.; Maji, R.K.; Jana, K.; Gupta, P.; Raffetseder, J.; Lerm, M.; Ghosh, Z.; et al. MicroRNA let-7 modulates the immune response to Mycobacterium tuberculosis infection via control of A20, an inhibitor of the NF-kappaB pathway. Cell Host Microbe 2015, 17, 345–356. [Google Scholar] [CrossRef]
- Zhu, T.; Liu, H.; Su, L.; Dawood, A.; Hu, C.; Chen, X.; Chen, H.; Chen, Y.; Guo, A. Identification of Unique Key miRNAs, TFs, and mRNAs in Virulent MTB Infection Macrophages by Network Analysis. Int. J. Mol. Sci. 2021, 23, 382. [Google Scholar] [CrossRef]
- Mohareer, K.; Asalla, S.; Banerjee, S. Cell death at the cross roads of host-pathogen interaction in Mycobacterium tuberculosis infection. Tuberculosis 2018, 113, 99–121. [Google Scholar] [CrossRef] [PubMed]
- Lam, A.; Prabhu, R.; Gross, C.M.; Riesenberg, L.A.; Singh, V.; Aggarwal, S. Role of apoptosis and autophagy in tuberculosis. Am. J. Physiol. Lung Cell Mol. Physiol. 2017, 313, L218–L229. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.L.; Yang, K.; Ren, T.T.; Huang, Y.; Liang, X.; Yu, Y.Y.; Wang, W.; Niu, J.F.; Lou, J.B.; Tang, X.D.; et al. miR-100-5p Inhibits Malignant Behavior of Chordoma Cells by Targeting IGF1R. Cancer Manag. Res. 2020, 12, 4129–4137. [Google Scholar] [CrossRef]
- Chen, P.; Lin, C.; Quan, J.; Lai, Y.; He, T.; Zhou, L.; Pan, X.; Wu, X.; Wang, Y.; Ni, L.; et al. Oncogenic miR-100-5p is associated with cellular viability, migration and apoptosis in renal cell carcinoma. Mol. Med. Rep. 2017, 16, 5023–5030. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.; Zhang, M.; Cao, F.; Han, J.; Han, P.; Wu, Y.; Deng, R.; Zhang, G.; An, X.; Zhang, L.; et al. Effect of MiR-100-5p on proliferation and apoptosis of goat endometrial stromal cell in vitro and embryo implantation in vivo. J. Cell Mol. Med. 2022, 26, 2543–2556. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Zhu, W.; Yang, Y.; Guo, M.; Qian, H.; Jiang, W.; Chen, Y.; Lian, C.; Xu, Z.; Bai, H.; et al. Exosomal miR-100-5p inhibits osteogenesis of hBMSCs and angiogenesis of HUVECs by suppressing the BMPR2/Smad1/5/9 signalling pathway. Stem Cell Res. 2021, 12, 390. [Google Scholar] [CrossRef] [PubMed]
- Alrfaei, B.M.; Clark, P.; Vemuganti, R.; Kuo, J.S. MicroRNA miR-100 Decreases Glioblastoma Growth by Targeting SMARCA5 and ErbB3 in Tumor-Initiating Cells. Technol. Cancer Res. Treat. 2020, 19, 1533033820960748. [Google Scholar] [CrossRef]
- Zikmund, T.; Kokavec, J.; Turkova, T.; Savvulidi, F.; Paszekova, H.; Vodenkova, S.; Sedlacek, R.; Skoultchi, A.I.; Stopka, T. ISWI ATPase Smarca5 Regulates Differentiation of Thymocytes Undergoing beta-Selection. J. Immunol. 2019, 202, 3434–3446. [Google Scholar] [CrossRef]
- Ai, C.; Ma, G.; Deng, Y.; Zheng, Q.; Gen, Y.; Li, W.; Li, Y.; Zu, L.; Zhou, Q. Nm23-H1 inhibits lung cancer bone-specific metastasis by upregulating miR-660-5p targeted SMARCA5. Thorac. Cancer 2020, 11, 640–650. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.Y.; Ma, Y.R.; Lin, Y.F.; Chen, R.; Xu, B.; Deng, J.L. SHU00238 Promotes Colorectal Cancer Cell Apoptosis Through miR-4701-3p and miR-4793-3p. Front. Genet. 2020, 10, 1320. [Google Scholar] [CrossRef]
- Mueller, A.C.; Sun, D.; Dutta, A. The miR-99 family regulates the DNA damage response through its target SNF2H. Oncogene 2013, 32, 1164–1172. [Google Scholar] [CrossRef]
- Finn, K.; Lowndes, N.F.; Grenon, M. Eukaryotic DNA damage checkpoint activation in response to double-strand breaks. Cell Mol. Life Sci. 2012, 69, 1447–1473. [Google Scholar] [CrossRef] [PubMed]
- Yan, Q.Y.; Zhang, B.; Ling, X.; Zhu, B.; Mei, S.H.; Yang, H.; Zhang, D.J.; Huo, J.P.; Zhao, Z.G. CTLA-4 Facilitates DNA Damage-Induced Apoptosis by Interacting With PP2A. Front Cell Dev. Biol. 2022, 10, 728771. [Google Scholar] [CrossRef]
- Liu, F.; Chen, J.; Wang, P.; Li, H.; Zhou, Y.; Liu, H.; Liu, Z.; Zheng, R.; Wang, L.; Yang, H.; et al. MicroRNA-27a controls the intracellular survival of Mycobacterium tuberculosis by regulating calcium-associated autophagy. Nat. Commun. 2018, 9, 4295. [Google Scholar] [CrossRef]
- Wendell, L.; Mayer, B.; Pawson, T. Cell Signaling: Principles and Mechanisms; Garland Science, Taylor and Francis Group: New York, NY, USA, 2015. [Google Scholar]
- Song, H.P.; Chu, Z.G.; Zhang, D.X.; Dang, Y.M.; Zhang, Q. PI3K-AKT Pathway Protects Cardiomyocytes Against Hypoxia-Induced Apoptosis by MitoKATP-Mediated Mitochondrial Translocation of pAKT. Cell Physiol. Biochem. 2018, 49, 717–727. [Google Scholar] [CrossRef]
- Fan, Q.; Wu, M.; Li, C.; Li, J. MiR-107 Aggravates Oxygen-Glucose Deprivation/Reoxygenation (OGD/R)-Induced Injury Through Inactivating PI3K-AKT Signalling Pathway by Targeting FGF9/FGF12 in PC12 Cells. J. Stroke Cerebrovasc. Dis. 2022, 31, 106295. [Google Scholar] [PubMed]
- Liu, Y.; Zhu, S.T.; Wang, X.; Deng, J.; Li, W.H.; Zhang, P.; Liu, B.S. MiR-100 Inhibits Osteosarcoma Cell Proliferation, Migration, and Invasion and Enhances Chemosensitivity by Targeting IGFIR. Technol. Cancer Res. Treat 2016, 15, NP40–NP48. [Google Scholar] [CrossRef]
Sequence Name | Sequence 5′-3′ |
---|---|
Has-miR-100-5p mimic negative control | UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT |
Has-miR-100-5p mimic | AACCCGUAGAUCCGAACUUGUG CAAGUUCGGAUCUACGGGUUUU |
Has-miR-100-5p inhibitor negative control | CAGUACUUUUGUGUAGUACAA |
Has-miR-100-5p inhibitor | CACAAGUUCGGAUCUACGGGUU |
siSMARCA5 negative control | UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT |
siSMARCA5 | AGGAAAUAUUUGAUGAUGCTT GCAUCAUCAAAUAUUUCCUCC |
Control | BCG-Infected | M. tb-Infected | |
---|---|---|---|
6 h | 4933.81 | 3146.33 | 2703.04 |
24 h | 6258.37 | 2833.35 | 3251.83 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Su, L.; Zhu, T.; Liu, H.; Zhu, Y.; Peng, Y.; Tang, T.; Zhou, S.; Hu, C.; Chen, H.; Guo, A.; et al. The miR-100-5p Targets SMARCA5 to Regulate the Apoptosis and Intracellular Survival of BCG in Infected THP-1 Cells. Cells 2023, 12, 476. https://doi.org/10.3390/cells12030476
Su L, Zhu T, Liu H, Zhu Y, Peng Y, Tang T, Zhou S, Hu C, Chen H, Guo A, et al. The miR-100-5p Targets SMARCA5 to Regulate the Apoptosis and Intracellular Survival of BCG in Infected THP-1 Cells. Cells. 2023; 12(3):476. https://doi.org/10.3390/cells12030476
Chicago/Turabian StyleSu, Li, Tingting Zhu, Han Liu, Yifan Zhu, Yongchong Peng, Tian Tang, Shiying Zhou, Changmin Hu, Huanchun Chen, Aizhen Guo, and et al. 2023. "The miR-100-5p Targets SMARCA5 to Regulate the Apoptosis and Intracellular Survival of BCG in Infected THP-1 Cells" Cells 12, no. 3: 476. https://doi.org/10.3390/cells12030476