Modulation of Suppressive Activity and Proliferation of Human Regulatory T Cells by Splice-Switching Oligonucleotides Targeting FoxP3 Pre-mRNA
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patients, Healthy Donors, and Blood Sampling
2.2. Detection of Tregs and Treg-Associated Cellular Markers in Peripheral Blood Samples
2.3. Treg Purification and Ex Vivo Expansion
2.4. RNA Isolation and Real-Time RT-PCR
2.5. Cell Transfection with Splice-Switching Oligonucleotides
2.6. Western Blotting
2.7. Suppression Assay
2.8. Inhibition of Telomerase
2.9. Determination of Cytokines by Bio-Plex Assay
2.10. Statistics
3. Results
3.1. Study Participants
3.2. Expression of FoxP3 Splice Variants in Tregs from MS Patients
3.3. Expansion Ex Vivo Does Not Lead to a Shift in the Expression of FoxP3 Splice Variants
3.4. Modulation of Exon 2 and Exon 7 Alternative Splicing with Single Splice-Switching Oligonucleotides
3.5. Splice-Switching Oligonucleotides Targeting Both Exon 2 and Exon 7 on FoxP3 Pre-mRNA Induce Selective Expression of a Single Splice Variant
3.6. Selective Expression of FoxP3 Splice Variants Has an Effect on Treg Proliferation
3.7. Expression of Treg-Associated Cell Markers in Cells Transfected with SSOs
3.8. The Effect of FoxP3 Alternative Splicing on the Suppressive Activity of Tregs
3.9. The Effect of FoxP3 Alternative Splicing on Treg-Associated Suppressive Molecules
3.10. Induction of FoxP3 Alternative Splicing Changes the Cytokine Profile of Tregs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sakaguchi, S.; Sakaguchi, N.; Asano, M.; Itoh, M.; Toda, M. Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J. Immunol. 1995, 155, 1151–1164. [Google Scholar] [CrossRef] [PubMed]
- Baecher-Allan, C.; Hafler, D.A. Human regulatory T cells and their role in autoimmune disease. Immunol. Rev. 2006, 212, 203–216. [Google Scholar] [CrossRef] [PubMed]
- Lifshitz, G.V.; Zhdanov, D.D.; Lokhonina, A.V.; Eliseeva, D.D.; Lyssuck, E.Y.; Zavalishin, I.A.; Bykovskaia, S.N. Ex vivo expanded regulatory T cells CD4 + CD25 + FoxP3 + CD127 Low develop strong immunosuppressive activity in patients with remitting-relapsing multiple sclerosis. Autoimmunity 2016, 49, 388–396. [Google Scholar] [CrossRef] [PubMed]
- Christodoulou, M.I.; Kapsogeorgou, E.K.; Moutsopoulos, N.M.; Moutsopoulos, H.M. Foxp3+ T-regulatory cells in Sjogren’s syndrome: Correlation with the grade of the autoimmune lesion and certain adverse prognostic factors. Am. J. Pathol. 2008, 173, 1389–1396. [Google Scholar] [CrossRef]
- Nussbaum, L.; Chen, Y.L.; Ogg, G.S. Role of regulatory T cells in psoriasis pathogenesis and treatment. Br. J. Dermatol. 2021, 184, 14–24. [Google Scholar] [CrossRef]
- Blinova, V.G.; Vasilyev, V.I.; Rodionova, E.B.; Zhdanov, D.D. The Role of Regulatory T Cells in the Onset and Progression of Primary Sjogren’s Syndrome. Cells 2023, 12, 1359. [Google Scholar] [CrossRef]
- Hori, S.; Nomura, T.; Sakaguchi, S. Control of regulatory T cell development by the transcription factor Foxp3. Science 2003, 299, 1057–1061. [Google Scholar] [CrossRef]
- Rudensky, A.Y. Regulatory T cells and Foxp3. Immunol. Rev. 2011, 241, 260–268. [Google Scholar] [CrossRef]
- Baralle, F.E.; Giudice, J. Alternative splicing as a regulator of development and tissue identity. Nat. Rev. Mol. Cell Biol. 2017, 18, 437–451. [Google Scholar] [CrossRef]
- Sato, Y.; Liu, J.; Lee, E.; Perriman, R.; Roncarolo, M.G.; Bacchetta, R. Co-Expression of FOXP3FL and FOXP3Δ2 Isoforms Is Required for Optimal Treg-Like Cell Phenotypes and Suppressive Function. Front. Immunol. 2021, 12, 752394. [Google Scholar] [CrossRef]
- Blinova, V.G.; Novachly, N.S.; Gippius, S.N.; Hilal, A.; Gladilina, Y.A.; Eliseeva, D.D.; Zhdanov, D.D. Phenotypical and Functional Characteristics of Human Regulatory T Cells during Ex Vivo Maturation from CD4+ T Lymphocytes. Appl. Sci. 2021, 11, 5776. [Google Scholar] [CrossRef]
- Du, J.; Wang, Q.; Yang, S.; Chen, S.; Fu, Y.; Spath, S.; Domeier, P.; Hagin, D.; Anover-Sombke, S.; Haouili, M.; et al. FOXP3 exon 2 controls T(reg) stability and autoimmunity. Sci. Immunol. 2022, 7, eabo5407. [Google Scholar] [CrossRef] [PubMed]
- Seitz, C.; Joly, A.-L.; Fang, F.; Frith, K.; Gray, P.; Andersson, J. The FOXP3 full-length isoform controls the lineage-stability of CD4(+)FOXP3(+) regulatory T cells. Clin. Immunol. 2022, 237, 108957. [Google Scholar] [CrossRef] [PubMed]
- Sambucci, M.; Gargano, F.; De Rosa, V.; De Bardi, M.; Picozza, M.; Placido, R.; Ruggieri, S.; Capone, A.; Gasperini, C.; Matarese, G.; et al. FoxP3 isoforms and PD-1 expression by T regulatory cells in multiple sclerosis. Sci. Rep. 2018, 8, 3674. [Google Scholar] [CrossRef] [PubMed]
- Havens, M.A.; Hastings, M.L. Splice-switching antisense oligonucleotides as therapeutic drugs. Nucleic Acids Res. 2016, 44, 6549–6563. [Google Scholar] [CrossRef] [PubMed]
- Sergeeva, O.V.; Shcherbinina, E.Y.; Shomron, N.; Zatsepin, T.S. Modulation of RNA Splicing by Oligonucleotides: Mechanisms of Action and Therapeutic Implications. Nucleic Acid Ther. 2022, 32, 123–138. [Google Scholar] [CrossRef] [PubMed]
- Thompson, A.J.; Banwell, B.L.; Barkhof, F.; Carroll, W.M.; Coetzee, T.; Comi, G.; Correale, J.; Fazekas, F.; Filippi, M.; Freedman, M.S.; et al. Diagnosis of multiple sclerosis: 2017 revisions of the McDonald criteria. Lancet Neurol. 2018, 17, 162–173. [Google Scholar] [CrossRef]
- Kurtzke, J.F. Rating neurologic impairment in multiple sclerosis: An expanded disability status scale (EDSS). Neurology 1983, 33, 1444–1452. [Google Scholar] [CrossRef]
- Hippen, K.L.; Merkel, S.C.; Schirm, D.K.; Sieben, C.M.; Sumstad, D.; Kadidlo, D.M.; McKenna, D.H.; Bromberg, J.S.; Levine, B.L.; Riley, J.L.; et al. Massive ex vivo expansion of human natural regulatory T cells (T(regs)) with minimal loss of in vivo functional activity. Sci. Transl. Med. 2011, 3, 83ra41. [Google Scholar] [CrossRef]
- Sherley, J.L.; Stadler, P.B.; Stadler, J.S. A quantitative method for the analysis of mammalian cell proliferation in culture in terms of dividing and non-dividing cells. Cell Prolif. 1995, 28, 137–144. [Google Scholar] [CrossRef]
- Zhdanov, D.D.; Plyasova, A.A.; Gladilina, Y.A.; Pokrovsky, V.S.; Grishin, D.V.; Grachev, V.A.; Orlova, V.S.; Pokrovskaya, M.V.; Alexandrova, S.S.; Lobaeva, T.A.; et al. Inhibition of telomerase activity by splice-switching oligonucleotides targeting the mRNA of the telomerase catalytic subunit affects proliferation of human CD4+ T lymphocytes. Biochem. Biophys. Res. Commun. 2019, 509, 790–796. [Google Scholar] [CrossRef] [PubMed]
- Zhdanov, D.D.; Pokrovsky, V.S.; Orlova, E.V.; Orlova, V.S.; Pokrovskaya, M.V.; Aleksandrova, S.S.; Sokolov, N.N. Intracellular localization of apoptotic endonuclease EndoG and splice-variants of telomerase catalytic subunit hTERT. Biochemistry 2017, 82, 894–905. [Google Scholar] [CrossRef] [PubMed]
- Baker, B.F.; Lot, S.S.; Condon, T.P.; Cheng-Flournoy, S.; Lesnik, E.A.; Sasmor, H.M.; Bennett, C.F. 2′-O-(2-Methoxy)ethyl-modified anti-intercellular adhesion molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1 mRNA level and inhibit formation of the ICAM-1 translation initiation complex in human umbilical vein endothelial cells. J. Biol. Chem. 1997, 272, 11994–12000. [Google Scholar] [CrossRef] [PubMed]
- Zhdanov, D.D.; Gladilina, Y.A.; Pokrovsky, V.S.; Grishin, D.V.; Grachev, V.A.; Orlova, V.S.; Pokrovskaya, M.V.; Alexandrova, S.S.; Plyasova, A.A.; Sokolov, N.N. Endonuclease G modulates the alternative splicing of deoxyribonuclease 1 mRNA in human CD4+ T lymphocytes and prevents the progression of apoptosis. Biochimie 2019, 157, 158–176. [Google Scholar] [CrossRef] [PubMed]
- Quah, B.J.C.; Parish, C.R. The Use of Carboxyfluorescein Diacetate Succinimidyl Ester (CFSE) to Monitor Lymphocyte Proliferation. J. Vis. Exp. 2010, 44, 2259. [Google Scholar] [CrossRef]
- Crowley, L.C.; Scott, A.P.; Marfell, B.J.; Boughaba, J.A.; Chojnowski, G.; Waterhouse, N.J. Measuring Cell Death by Propidium Iodide Uptake and Flow Cytometry. Cold Spring Harb. Protoc. 2016, 2016, pdb-prot087163. [Google Scholar] [CrossRef] [PubMed]
- Zhdanov, D.D.; Gladilina, Y.A.; Pokrovsky, V.S.; Grishin, D.V.; Grachev, V.A.; Orlova, V.S.; Pokrovskaya, M.V.; Alexandrova, S.S.; Sokolov, N.N. Murine regulatory T cells induce death of effector T, B, and NK lymphocytes through a contact-independent mechanism involving telomerase suppression and telomere-associated senescence. Cell. Immunol. 2018, 331, 146–160. [Google Scholar] [CrossRef]
- Zhdanov, D.D.; Gladilina, Y.A.; Grishin, D.V.; Grachev, V.A.; Orlova, V.S.; Pokrovskaya, M.V.; Alexandrova, S.S.; Pokrovsky, V.S.; Sokolov, N.N. Contact-independent suppressive activity of regulatory T cells is associated with telomerase inhibition, telomere shortening and target lymphocyte apoptosis. Mol. Immunol. 2018, 101, 229–244. [Google Scholar] [CrossRef]
- Verma, N.D.; Lam, A.D.; Chiu, C.; Tran, G.T.; Hall, B.M.; Hodgkinson, S.J. Multiple sclerosis patients have reduced resting and increased activated CD4(+)CD25(+)FOXP3(+)T regulatory cells. Sci. Rep. 2021, 11, 10476. [Google Scholar] [CrossRef]
- Calahorra, L.; Camacho-Toledano, C.; Serrano-Regal, M.P.; Ortega, M.C.; Clemente, D. Regulatory Cells in Multiple Sclerosis: From Blood to Brain. Biomedicines 2022, 10, 335. [Google Scholar] [CrossRef]
- Smith, P.J.; Zhang, C.; Wang, J.; Chew, S.L.; Zhang, M.Q.; Krainer, A.R. An increased specificity score matrix for the prediction of SF2/ASF-specific exonic splicing enhancers. Hum. Mol. Genet. 2006, 15, 2490–2508. [Google Scholar] [CrossRef] [PubMed]
- Cartegni, L.; Wang, J.; Zhu, Z.; Zhang, M.Q.; Krainer, A.R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 2003, 31, 3568–3571. [Google Scholar] [CrossRef] [PubMed]
- Gladilina, Y.A.; Bey, L.; Hilal, A.; Neborak, E.V.; Blinova, V.G.; Zhdanov, D.D. Cytoprotective Activity of Polyamines Is Associated with the Alternative Splicing of RAD51A Pre-mRNA in Normal Human CD4+ T Lymphocytes. Int. J. Mol. Sci. 2022, 23, 1863. [Google Scholar] [CrossRef] [PubMed]
- Claeys, E.; Vermeire, K. The CD4 Receptor: An Indispensable Protein in T Cell Activation and A Promising Target for Immunosuppression. Arch. Microbiol. Immunol. 2019, 3, 133–150. [Google Scholar] [CrossRef]
- Brusko, T.M.; Wasserfall, C.H.; Hulme, M.A.; Cabrera, R.; Schatz, D.; Atkinson, M.A. Influence of membrane CD25 stability on T lymphocyte activity: Implications for immunoregulation. PLoS ONE 2009, 4, e7980. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Putnam, A.L.; Xu-Yu, Z.; Szot, G.L.; Lee, M.R.; Zhu, S.; Gottlieb, P.A.; Kapranov, P.; Gingeras, T.R.; Fazekas de St Groth, B.; et al. CD127 expression inversely correlates with FoxP3 and suppressive function of human CD4+ T reg cells. J. Exp. Med. 2006, 203, 1701–1711. [Google Scholar] [CrossRef]
- Hoff, H.; Kolar, P.; Ambach, A.; Radbruch, A.; Brunner-Weinzierl, M.C. CTLA-4 (CD152) inhibits T cell function by activating the ubiquitin ligase Itch. Mol. Immunol. 2010, 47, 1875–1881. [Google Scholar] [CrossRef]
- Klein, M.; Bopp, T. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation. Front. Immunol. 2016, 7, 315. [Google Scholar] [CrossRef]
- Liang, B.; Workman, C.; Lee, J.; Chew, C.; Dale, B.M.; Colonna, L.; Flores, M.; Li, N.; Schweighoffer, E.; Greenberg, S.; et al. Regulatory T cells inhibit dendritic cells by lymphocyte activation gene-3 engagement of MHC class II. J. Immunol. 2008, 180, 5916–5926. [Google Scholar] [CrossRef]
- Yu, W.-Q.; Ji, N.-F.; Gu, C.-J.; Wang, Y.-L.; Huang, M.; Zhang, M.-S. Coexpression of Helios in Foxp3(+) Regulatory T Cells and Its Role in Human Disease. Dis. Markers 2021, 2021, 5574472. [Google Scholar] [CrossRef]
- Schmidt, A.; Oberle, N.; Krammer, P.H. Molecular mechanisms of treg-mediated T cell suppression. Front. Immunol. 2012, 3, 51. [Google Scholar] [CrossRef] [PubMed]
- Wing, K.; Onishi, Y.; Prieto-Martin, P.; Yamaguchi, T.; Miyara, M.; Fehervari, Z.; Nomura, T.; Sakaguchi, S. CTLA-4 control over Foxp3+ regulatory T cell function. Science 2008, 322, 271–275. [Google Scholar] [CrossRef] [PubMed]
- Madireddi, S.; Eun, S.-Y.; Mehta, A.K.; Birta, A.; Zajonc, D.M.; Niki, T.; Hirashima, M.; Podack, E.R.; Schreiber, T.H.; Croft, M. Regulatory T Cell-Mediated Suppression of Inflammation Induced by DR3 Signaling Is Dependent on Galectin-9. J. Immunol. 2017, 199, 2721–2728. [Google Scholar] [CrossRef] [PubMed]
- Campos-Mora, M.; Contreras-Kallens, P.; Gálvez-Jirón, F.; Rojas, M.; Rojas, C.; Refisch, A.; Cerda, O.; Pino-Lagos, K. CD4+Foxp3+T Regulatory Cells Promote Transplantation Tolerance by Modulating Effector CD4+ T Cells in a Neuropilin-1-Dependent Manner. Front. Immunol. 2019, 10, 882. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Lei, L. Interleukin-35 regulates the balance of Th17 and Treg responses during the pathogenesis of connective tissue diseases. Int. J. Rheum. Dis. 2021, 24, 21–27. [Google Scholar] [CrossRef]
- Ng, T.H.S.; Britton, G.J.; Hill, E.V.; Verhagen, J.; Burton, B.R.; Wraith, D.C. Regulation of adaptive immunity; the role of interleukin-10. Front. Immunol. 2013, 4, 129. [Google Scholar] [CrossRef]
- Wolf, S.F.; Temple, P.A.; Kobayashi, M.; Young, D.; Dicig, M.; Lowe, L.; Dzialo, R.; Fitz, L.; Ferenz, C.; Hewick, R.M. Cloning of cDNA for natural killer cell stimulatory factor, a heterodimeric cytokine with multiple biologic effects on T and natural killer cells. J. Immunol. 1991, 146, 3074–3081. [Google Scholar] [CrossRef]
- King, I.L.; Segal, B.M. Cutting edge: IL-12 induces CD4+CD25- T cell activation in the presence of T regulatory cells. J. Immunol. 2005, 175, 641–645. [Google Scholar] [CrossRef]
- Oral, H.B.; Kotenko, S.V.; Yilmaz, M.; Mani, O.; Zumkehr, J.; Blaser, K.; Akdis, C.A.; Akdis, M. Regulation of T cells and cytokines by the interleukin-10 (IL-10)-family cytokines IL-19, IL-20, IL-22, IL-24 and IL-26. Eur. J. Immunol. 2006, 36, 380–388. [Google Scholar] [CrossRef]
- Pène, J.; Chevalier, S.; Preisser, L.; Vénéreau, E.; Guilleux, M.-H.; Ghannam, S.; Molès, J.-P.; Danger, Y.; Ravon, E.; Lesaux, S.; et al. Chronically inflamed human tissues are infiltrated by highly differentiated Th17 lymphocytes. J. Immunol. 2008, 180, 7423–7430. [Google Scholar] [CrossRef]
- Wolk, K.; Kunz, S.; Asadullah, K.; Sabat, R. Cutting edge: Immune cells as sources and targets of the IL-10 family members? J. Immunol. 2002, 168, 5397–5402. [Google Scholar] [CrossRef] [PubMed]
- Iwasaki, Y.; Fujio, K.; Okamura, T.; Yamamoto, K. Interleukin-27 in T cell immunity. Int. J. Mol. Sci. 2015, 16, 2851–2863. [Google Scholar] [CrossRef] [PubMed]
- Fontenot, J.D.; Gavin, M.A.; Rudensky, A.Y. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat. Immunol. 2003, 4, 330–336. [Google Scholar] [CrossRef] [PubMed]
- Kiaf, B.; Bode, K.; Schuster, C.; Kissler, S. Gata3 is detrimental to regulatory T cell function in autoimmune diabetes. bioRxiv Prepr. Serv. Biol. 2023. [Google Scholar] [CrossRef]
- Szabo, S.J.; Kim, S.T.; Costa, G.L.; Zhang, X.; Fathman, C.G.; Glimcher, L.H. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 2000, 100, 655–669. [Google Scholar] [CrossRef]
- Tan, T.G.; Mathis, D.; Benoist, C. Singular role for T-BET+CXCR3+ regulatory T cells in protection from autoimmune diabetes. Proc. Natl. Acad. Sci. USA 2016, 113, 14103–14108. [Google Scholar] [CrossRef]
- Kim, Y.U.; Kim, B.-S.; Lim, H.; Wetsel, R.A.; Chung, Y. Enforced Expression of CXCR5 Drives T Follicular Regulatory-Like Features in Foxp3(+) T Cells. Biomol. Ther. 2017, 25, 130–139. [Google Scholar] [CrossRef]
- Larkin, J., III; Ahmed, C.M.; Wilson, T.D.; Johnson, H.M. Regulation of interferon gamma signaling by suppressors of cytokine signaling and regulatory T cells. Front. Immunol. 2013, 4, 469. [Google Scholar] [CrossRef]
- Tran, G.T.; Hodgkinson, S.J.; Carter, N.M.; Verma, N.D.; Plain, K.M.; Boyd, R.; Robinson, C.M.; Nomura, M.; Killingsworth, M.; Hall, B.M. IL-5 promotes induction of antigen-specific CD4+CD25+ T regulatory cells that suppress autoimmunity. Blood 2012, 119, 4441–4450. [Google Scholar] [CrossRef]
- Yang, W.-C.; Hwang, Y.-S.; Chen, Y.-Y.; Liu, C.-L.; Shen, C.-N.; Hong, W.-H.; Lo, S.-M.; Shen, C.-R. Interleukin-4 Supports the Suppressive Immune Responses Elicited by Regulatory T Cells. Front. Immunol. 2017, 8, 1508. [Google Scholar] [CrossRef]
- Bovenschen, H.J.; van de Kerkhof, P.C.; van Erp, P.E.; Woestenenk, R.; Joosten, I.; Koenen, H.J.P.M. Foxp3+ regulatory T cells of psoriasis patients easily differentiate into IL-17A-producing cells and are found in lesional skin. J. Invest. Dermatol. 2011, 131, 1853–1860. [Google Scholar] [CrossRef] [PubMed]
- Grant, C.R.; Liberal, R.; Mieli-Vergani, G.; Vergani, D.; Longhi, M.S. Regulatory T-cells in autoimmune diseases: Challenges, controversies and--yet--unanswered questions. Autoimmun. Rev. 2015, 14, 105–116. [Google Scholar] [CrossRef] [PubMed]
- Shevyrev, D.; Tereshchenko, V. Treg Heterogeneity, Function, and Homeostasis. Front. Immunol. 2019, 10, 3100. [Google Scholar] [CrossRef] [PubMed]
- Rodi, M.; Dimisianos, N.; de Lastic, A.-L.; Sakellaraki, P.; Deraos, G.; Matsoukas, J.; Papathanasopoulos, P.; Mouzaki, A. Regulatory Cell Populations in Relapsing-Remitting Multiple Sclerosis (RRMS) Patients: Effect of Disease Activity and Treatment Regimens. Int. J. Mol. Sci. 2016, 17, 1398. [Google Scholar] [CrossRef] [PubMed]
- Balint, B.; Haas, J.; Schwarz, A.; Jarius, S.; Fürwentsches, A.; Engelhardt, K.; Bussmann, C.; Ebinger, F.; Fritzsching, B.; Paul, F.; et al. T-cell homeostasis in pediatric multiple sclerosis: Old cells in young patients. Neurology 2013, 81, 784–792. [Google Scholar] [CrossRef] [PubMed]
- Jamshidian, A.; Shaygannejad, V.; Pourazar, A.; Zarkesh-Esfahani, S.-H.; Gharagozloo, M. Biased Treg/Th17 balance away from regulatory toward inflammatory phenotype in relapsed multiple sclerosis and its correlation with severity of symptoms. J. Neuroimmunol. 2013, 262, 106–112. [Google Scholar] [CrossRef] [PubMed]
- Kouchaki, E.; Salehi, M.; Reza Sharif, M.; Nikoueinejad, H.; Akbari, H. Numerical status of CD4(+)CD25(+)FoxP3(+) and CD8(+)CD28(-) regulatory T cells in multiple sclerosis. Iran. J. Basic Med. Sci. 2014, 17, 250–255. [Google Scholar]
- Carbone, F.; De Rosa, V.; Carrieri, P.B.; Montella, S.; Bruzzese, D.; Porcellini, A.; Procaccini, C.; La Cava, A.; Matarese, G. Regulatory T cell proliferative potential is impaired in human autoimmune disease. Nat. Med. 2014, 20, 69–74. [Google Scholar] [CrossRef]
- Huan, J.; Culbertson, N.; Spencer, L.; Bartholomew, R.; Burrows, G.G.; Chou, Y.K.; Bourdette, D.; Ziegler, S.F.; Offner, H.; Vandenbark, A.A. Decreased FOXP3 levels in multiple sclerosis patients. J. Neurosci. Res. 2005, 81, 45–52. [Google Scholar] [CrossRef]
- Mohajeri, M.; Farazmand, A.; Mohyeddin Bonab, M.; Nikbin, B.; Minagar, A. FOXP3 gene expression in multiple sclerosis patients pre- and post mesenchymal stem cell therapy. Iran. J. Allergy. Asthma. Immunol. 2011, 10, 155–161. [Google Scholar]
- Zhdanov, D.D.; Plyasova, A.A.; Pokrovsky, V.S.; Pokrovskaya, M.V.; Alexandrova, S.S.; Gladilina, Y.A.; Sokolov, N.N. Inhibition of nuclease activity by a splice-switching oligonucleotide targeting deoxyribonuclease 1 mRNA prevents apoptosis progression and prolong viability of normal human CD4(+) T-lymphocytes. Biochimie 2020, 174, 34–43. [Google Scholar] [CrossRef] [PubMed]
- Lopes, J.E.; Torgerson, T.R.; Schubert, L.A.; Anover, S.D.; Ocheltree, E.L.; Ochs, H.D.; Ziegler, S.F. Analysis of FOXP3 reveals multiple domains required for its function as a transcriptional repressor. J. Immunol. 2006, 177, 3133–3142. [Google Scholar] [CrossRef] [PubMed]
- Chae, W.-J.; Henegariu, O.; Lee, S.-K.; Bothwell, A.L.M. The mutant leucine-zipper domain impairs both dimerization and suppressive function of Foxp3 in T cells. Proc. Natl. Acad. Sci. USA 2006, 103, 9631–9636. [Google Scholar] [CrossRef] [PubMed]
- Du, J.; Huang, C.; Zhou, B.; Ziegler, S.F. Isoform-specific inhibition of ROR alpha-mediated transcriptional activation by human FOXP3. J. Immunol. 2008, 180, 4785–4792. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Lopes, J.E.; Chong, M.M.W.; Ivanov, I.I.; Min, R.; Victora, G.D.; Shen, Y.; Du, J.; Rubtsov, Y.P.; Rudensky, A.Y.; et al. TGF-beta-induced Foxp3 inhibits T(H)17 cell differentiation by antagonizing RORgammat function. Nature 2008, 453, 236–240. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Samanta, A.; Song, X.; Iacono, K.T.; Brennan, P.; Chatila, T.A.; Roncador, G.; Banham, A.H.; Riley, J.L.; Wang, Q.; et al. FOXP3 is a homo-oligomer and a component of a supramolecular regulatory complex disabled in the human XLAAD/IPEX autoimmune disease. Int. Immunol. 2007, 19, 825–835. [Google Scholar] [CrossRef] [PubMed]
- Song, X.; Li, B.; Xiao, Y.; Chen, C.; Wang, Q.; Liu, Y.; Berezov, A.; Xu, C.; Gao, Y.; Li, Z.; et al. Structural and biological features of FOXP3 dimerization relevant to regulatory T cell function. Cell Rep. 2012, 1, 665–675. [Google Scholar] [CrossRef]
- Mailer, R.K.W.; Joly, A.-L.; Liu, S.; Elias, S.; Tegner, J.; Andersson, J. IL-1β promotes Th17 differentiation by inducing alternative splicing of FOXP3. Sci. Rep. 2015, 5, 14674. [Google Scholar] [CrossRef]
- Muls, N.G.V.; Dang, H.A.; Sindic, C.J.M.; van Pesch, V. Regulation of Treg-associated CD39 in multiple sclerosis and effects of corticotherapy during relapse. Mult. Scler. 2015, 21, 1533–1545. [Google Scholar] [CrossRef]
- Álvarez-Sánchez, N.; Cruz-Chamorro, I.; Díaz-Sánchez, M.; Lardone, P.J.; Guerrero, J.M.; Carrillo-Vico, A. Peripheral CD39-expressing T regulatory cells are increased and associated with relapsing-remitting multiple sclerosis in relapsing patients. Sci. Rep. 2019, 9, 2302. [Google Scholar] [CrossRef]
- Rubesa, G.; Podack, E.R.; Sepcić, J.; Rukavina, D. Increased perforin expression in multiple sclerosis patients during exacerbation of disease in peripheral blood lymphocytes. J. Neuroimmunol. 1997, 74, 198–204. [Google Scholar] [CrossRef] [PubMed]
- Jones, B.E.; Maerz, M.D.; Bahnson, H.T.; Somasundaram, A.; McCarthy, L.H.; Speake, C.; Buckner, J.H. Fewer LAG-3(+) T Cells in Relapsing-Remitting Multiple Sclerosis and Type 1 Diabetes. J. Immunol. 2022, 208, 594–602. [Google Scholar] [CrossRef] [PubMed]
- Lavon, I.; Heli, C.; Brill, L.; Charbit, H.; Vaknin-Dembinsky, A. Blood Levels of Co-inhibitory-Receptors: A Biomarker of Disease Prognosis in Multiple Sclerosis. Front. Immunol. 2019, 10, 835. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Ioan-Facsinay, A.; van der Voort, E.I.H.; Huizinga, T.W.J.; Toes, R.E.M. Transient expression of FOXP3 in human activated nonregulatory CD4+ T cells. Eur. J. Immunol. 2007, 37, 129–138. [Google Scholar] [CrossRef]
- Gavin, M.A.; Torgerson, T.R.; Houston, E.; DeRoos, P.; Ho, W.Y.; Stray-Pedersen, A.; Ocheltree, E.L.; Greenberg, P.D.; Ochs, H.D.; Rudensky, A.Y. Single-cell analysis of normal and FOXP3-mutant human T cells: FOXP3 expression without regulatory T cell development. Proc. Natl. Acad. Sci. USA 2006, 103, 6659–6664. [Google Scholar] [CrossRef]
- Allan, S.E.; Crome, S.Q.; Crellin, N.K.; Passerini, L.; Steiner, T.S.; Bacchetta, R.; Roncarolo, M.G.; Levings, M.K. Activation-induced FOXP3 in human T effector cells does not suppress proliferation or cytokine production. Int. Immunol. 2007, 19, 345–354. [Google Scholar] [CrossRef]
- Lui, P.P.; Cho, I.; Ali, N. Tissue regulatory T cells. Immunology 2020, 161, 4–17. [Google Scholar] [CrossRef]













| SSO | Sequence (5′–3′) | Label |
|---|---|---|
| #Con1 | A*T*G*T*G*CCGTAGGTGAGGCCTCACGTTCGTTA*A*A*C*G*G | Cy5.5 |
| #Con2 | G*T*G*A*G*GCCTCACGTTCGTTAAACGGATGTGC*C*G*T*A*G | Cy3 |
| #Ins2 | A*T*G*T*G*GCCTGTCCAGGAGGAGTGCCTGTAAG*T*G*G*G*G | Cy5.5 |
| #Ins7 | G*G*C*A*C*TCACGTTCTCCTTCTCCAGCACCAGC*T*G*T*G*A | Cy3 |
| #Del2 | T*C*C*C*A*CCTGCTCCCTCCTCCCTGCCCATTCA*C*C*G*T*C | Cy5.5 |
| #Del7 | C*T*G*C*A*CCGTGCAGACCTCCTCCCTGCCCCCC*A*G*C*A*G | Cy3 |
| Parameter | MS Group (n = 20) | HD Group (n = 20) |
|---|---|---|
| Number of female patients (%) | 15 (75%) | 12 (62.8%) |
| Age at study enrollment, mean ± SD * | 37.1 ± 11.1 | 36.2 ± 12.2 |
| Age range | 20–59 | 21–58 |
| Parameter | MS Group (n = 20) |
|---|---|
| Disease duration (years) | 6.1 ± 7.3 (0.1–27.5) |
| EDSS | 3.5 ± 1.3 (1.5–6) |
| MS course, patients (%) | |
| relapsing-remitting | 15 (75%) |
| active, secondary, and progressive | 3 (15%) |
| non-active, secondary, or progressive | 2 (10%) |
| Patients experiencing an MS relapse at study enrollment (%) | 10 (50%) |
| Functional system involvement, patients (%) | |
| pyramidal | 18 (90%) |
| cerebellar | 18 (90%) |
| brainstem | 18 (90%) |
| sensory | 17 (85%) |
| bowel/bladder | 9 (45%) |
| visual | 8 (40%) |
| mental | 10 (50%) |
| ambulation | 12 (60%) |
| Highly active MS patients (%) | 6 (30%) |
| DMT-naïve patients (%) | 15 (75%) |
| SSOs Transfection | Cell Divisions per Day |
|---|---|
| #Con1 & #Con2 | 0.40 |
| #Ins2 & #Ins7 | 0.58 |
| #Del2 & #Ins7 | 0.36 |
| #Ins2 & #Del7 | 0.27 |
| #Del2 & #Del7 | 0.25 |
| SSOs Transfection | Average Diameter (Microns) | Average Circularity |
|---|---|---|
| #Con1 & #Con2 | 10.65 | 0.89 |
| #Ins2 & #Ins7 | 10.64 | 0.88 |
| #Del2 & #Ins7 | 10.84 | 0.86 |
| #Ins2 & #Del7 | 10.24 | 0.85 |
| #Del2 & #Del7 | 7.76 | 0.86 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Blinova, V.G.; Gladilina, Y.A.; Abramova, A.A.; Eliseeva, D.D.; Vtorushina, V.V.; Shishparenok, A.N.; Zhdanov, D.D. Modulation of Suppressive Activity and Proliferation of Human Regulatory T Cells by Splice-Switching Oligonucleotides Targeting FoxP3 Pre-mRNA. Cells 2024, 13, 77. https://doi.org/10.3390/cells13010077
Blinova VG, Gladilina YA, Abramova AA, Eliseeva DD, Vtorushina VV, Shishparenok AN, Zhdanov DD. Modulation of Suppressive Activity and Proliferation of Human Regulatory T Cells by Splice-Switching Oligonucleotides Targeting FoxP3 Pre-mRNA. Cells. 2024; 13(1):77. https://doi.org/10.3390/cells13010077
Chicago/Turabian StyleBlinova, Varvara G., Yulia A. Gladilina, Anna A. Abramova, Daria D. Eliseeva, Valentina V. Vtorushina, Anastasia N. Shishparenok, and Dmitry D. Zhdanov. 2024. "Modulation of Suppressive Activity and Proliferation of Human Regulatory T Cells by Splice-Switching Oligonucleotides Targeting FoxP3 Pre-mRNA" Cells 13, no. 1: 77. https://doi.org/10.3390/cells13010077
APA StyleBlinova, V. G., Gladilina, Y. A., Abramova, A. A., Eliseeva, D. D., Vtorushina, V. V., Shishparenok, A. N., & Zhdanov, D. D. (2024). Modulation of Suppressive Activity and Proliferation of Human Regulatory T Cells by Splice-Switching Oligonucleotides Targeting FoxP3 Pre-mRNA. Cells, 13(1), 77. https://doi.org/10.3390/cells13010077

