Unlocking the Potential of Human-Induced Pluripotent Stem Cells: Cellular Responses and Secretome Profiles in Peptide Hydrogel 3D Culture
Abstract
:1. Introduction
2. Method
2.1. Materials and 3D Cell Culture Conditions
2.2. hiPSC 3D Embedded Culture within PGmatrix hiPSC
2.3. hiPSC 3D Suspension Culture within the PGmatrix 3D Suspension Matrix
2.4. hiPSC 3D Culture Medium Collection
2.5. Retrieving hiPSCs from the 3D Culture
2.6. hiPSC 2D Cell Culture
2.7. Cell Count and Viability Measurement
2.8. Expression of Pluripotent Biomarkers via RT-qPCR
2.9. Extracellular Vesicle Extraction
2.10. EV Detection via NTA
2.11. Mass Spectrum (MS) for Protein Release Measurement
2.12. Functional Enrichment Analysis
2.13. Statistical Analysis
3. Results
3.1. hiPSC Proliferation Supported by the PGmatrix hiPSC 3D Culture System
3.1.1. hiPSC Lines
3.1.2. PGmatrix Concentration
3.1.3. Culture Duration
3.1.4. Three-Dimensional Embedded vs. Three-Dimensional Suspension Cultures
3.2. Stable Pluripotent Gene Expression of hiPSCs Cultured in 3D PGmatrix hiPSC Systems
3.3. Protein and Genetic Profile Secreted by hiPSCs
3.3.1. Protein Profile Analysis
3.3.2. Functional Gene Ontology Analysis
3.3.3. Release of Extracellular Vesicles
3.3.4. Growth Factors and Extracellular Matrix (ECM) Proteins
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sampaziotis, F.; de Brito, M.C.; Madrigal, P.; Bertero, A.; Saeb-Parsy, K.; Soares, F.A.C.; Schrumpf, E.; Melum, E.; Karlsen, T.H.; Bradley, J.A.; et al. Cholangiocytes derived from human induced pluripotent stem cells for disease modeling and drug validation. Nat. Biotechnol. 2015, 33, 845–852. [Google Scholar] [CrossRef] [PubMed]
- Yamanaka, S. Pluripotent Stem Cell-Based Cell Therapy—Promise and Challenges. Cell Stem Cell 2020, 27, 523–531. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, S.; Miwa, H.; Kawachi, T.; Kume, S.; Takahashi, K. Generation of intestinal organoids derived from human pluripotent stem cells for drug testing. Sci. Rep. 2020, 10, 5989. [Google Scholar] [CrossRef] [PubMed]
- Goldfracht, I.; Efraim, Y.; Shinnawi, R.; Kovalev, E.; Huber, I.; Gepstein, A.; Arbel, G.; Shaheen, N.; Tiburcy, M.; Zimmermann, W.H.; et al. Engineered heart tissue models from hiPSC-derived cardiomyocytes and cardiac ECM for disease modeling and drug testing applications. Acta Biomater. 2019, 92, 145–159. [Google Scholar] [CrossRef]
- Fermini, B.; Fossa, A.A. The impact of drug-induced QT interval prolongation on drug discovery and development. Nat. Rev. Drug Discov. 2003, 2, 439–447. [Google Scholar] [CrossRef]
- Kussauer, S.; David, R.; Lemcke, H. hiPSCs derived cardiac cells for drug and toxicity screening and disease modeling: What micro-electrode-array analyses can tell us. Cells 2019, 8, 1331. [Google Scholar] [CrossRef]
- Kilpinen, H.; Goncalves, A.; Leha, A.; Afzal, V.; Alasoo, K.; Ashford, S.; Bala, S.; Bensaddek, D.; Casale, F.P.; Culley, O.J.; et al. Common genetic variation drives molecular heterogeneity in human iPSCs. Nature 2017, 546, 370–375. [Google Scholar] [CrossRef]
- Shiba, Y.; Gomibuchi, T.; Seto, T.; Wada, Y.; Ichimura, H.; Tanaka, Y.; Ogasawara, T.; Okada, K.; Shiba, N.; Sakamoto, K.; et al. Allogeneic transplantation of iPS cell-derived cardiomyocytes regenerates primate hearts. Nature 2016, 538, 388–391. [Google Scholar] [CrossRef]
- Choi, S.H.; Kim, Y.H.; Hebisch, M.; Sliwinski, C.; Lee, S.; D’avanzo, C.; Chen, H.; Hooli, B.; Asselin, C.; Muffat, J.; et al. A three-dimensional human neural cell culture model of Alzheimer’s disease. Nature 2014, 515, 274–278. [Google Scholar] [CrossRef]
- Muguruma, K.; Nishiyama, A.; Kawakami, H.; Hashimoto, K.; Sasai, Y. Self-Organization of Polarized Cerebellar Tissue in 3D Culture of Human Pluripotent Stem Cells. Cell Rep. 2015, 10, 537–550. [Google Scholar] [CrossRef]
- Li, Q.; Qi, G.; Liu, X.; Bai, J.; Zhao, J.; Tang, G.; Zhang, Y.S.; Chen-Tsai, R.; Zhang, M.; Wang, D.; et al. Universal Peptide Hydrogel for Scalable Physiological Formation and Bioprinting of 3D Spheroids from Human Induced Pluripotent Stem Cells. Adv. Funct. Mater. 2021, 31, 2104046. [Google Scholar] [CrossRef]
- Thippabhotla, S.; Zhong, C.; He, M. 3D cell culture stimulates the secretion of in vivo like extracellular vesicles. Sci. Rep. 2019, 9, 13012. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Qu, X.; Zhu, W.; Li, Y.; Yuan, S.; Zhang, H.; Liu, J.; Wang, P.; Lai, C.S.E.; Zanella, F.; et al. Deterministically patterned biomimetic human iPSC-derived hepatic model via rapid 3D bioprinting. Proc. Natl. Acad. Sci. USA 2016, 113, 2206–2211. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.S.; Huang, H. Novel Protein Peptide Hydrogels. U.S. Patent No. 8,835,395, 16 September 2014. [Google Scholar]
- Huang, H.; Herrera, A.I.; Luo, Z.; Prakash, O.; Sun, X.S. Structural Transformation and Physical Properties of a Hydrogel-Forming Peptide Studied by NMR, Transmission Electron Microscopy, and Dynamic Rheometer. Biophys. J. 2012, 103, 979–988. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Qi, G.; Lutter, D.; Beard, W.; Souza, C.R.S.; Highland, M.A.; Wu, W.; Li, P.; Zhang, Y.; Atala, A.; et al. Injectable Peptide Hydrogel Encapsulation of Mesenchymal Stem Cells Improved Viability, Stemness, Anti-Inflammatory Effects, and Early Stage Wound Healing. Biomolecules 2022, 12, 1317. [Google Scholar] [CrossRef]
- Carter, T.; Qi, G.; Wang, W.; Nguyen, A.; Cheng, N.; Ju, Y.M.; Lee, S.J.; Yoo, J.J.; Atala, A.; Sun, X.S. Self-Assembling Peptide Solution Accelerates Hemostasis. Adv. Wound Care 2021, 10, 191–203. [Google Scholar] [CrossRef]
- Huang, H.; Ding, Y.; Sun, X.S.; Nguyen, T.A. Peptide Hydrogelation and Cell Encapsulation for 3D Culture of MCF-7 Breast Cancer Cells. PLoS ONE 2013, 8, e59482. [Google Scholar] [CrossRef]
- Kumar, D.; Kandl, C.; Hamilton, C.D.; Shnayder, Y.; Tsue, T.T.; Kakarala, K.; Ledgerwood, L.; Sun, X.S.; Huang, H.; Girod, D.; et al. Mitigation of Tumor-Associated Fibroblast-Facilitated Head and Neck Cancer Progression With Anti-Hepatocyte Growth Factor Antibody Ficlatuzumab. JAMA Otolaryngol. Neck Surg. 2015, 141, 1133–1139. [Google Scholar] [CrossRef]
- Liang, J.; Sun, X.S.; Yang, Z.; Cao, S. Anticancer Drug Camptothecin Test in 3D Hydrogel Networks with HeLa cells. Sci. Rep. 2017, 7, 37626. [Google Scholar] [CrossRef]
- Xu, J.; Qi, G.; Sui, C.; Wang, W.; Sun, X. 3D h9e peptide hydrogel: An advanced three-dimensional cell culture system for anticancer prescreening of chemopreventive phenolic agents. Toxicol. Vitr. 2019, 61, 104599. [Google Scholar] [CrossRef]
- Zhu, Q.; Hamilton, M.; Vasquez, B.; He, M. 3D-printing enabled micro-assembly of a microfluidic electroporation system for 3D tissue engineering. Lab Chip 2019, 19, 2362–2372. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Shi, J.; Laskin, J.; Liu, Z.; McVey, D.S.; Sun, X.S. Design of a shear-thinning recoverable peptide hydrogel from native sequences and application for influenza H1N1 vaccine adjuvant. Soft Matter 2011, 7, 8905–8912. [Google Scholar] [CrossRef]
- Liu, W.; Saint, D.A. A New Quantitative Method of Real Time Reverse Transcription Polymerase Chain Reaction Assay Based on Simulation of Polymerase Chain Reaction Kinetics. Anal. Biochem. 2002, 302, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Dragovic, R.A.; Gardiner, C.; Brooks, A.S.; Tannetta, D.S.; Ferguson, D.J.P.; Hole, P.; Carr, B.; Redman, C.W.G.; Harris, A.L.; Dobson, P.J.; et al. Sizing and phenotyping of cellular vesicles using Nanoparticle Tracking Analysis. Nanomed. Nanotechnol. Biol. Med. 2011, 7, 780–788. [Google Scholar] [CrossRef] [PubMed]
- Li, E. Chromatin modification and epigenetic reprogramming in mammalian development. Nat. Rev. Genet. 2002, 3, 662–673. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Q.; Wu, W.; Jia, K.; Qi, G.; Sun, X.S.; Li, P. Design and characterization of PROTAC degraders specific to protein N-terminal methyltransferase. Eur. J. Med. Chem. 2022, 244, 114830. [Google Scholar] [CrossRef] [PubMed]
- Kolanowski, T.J.; Antos, C.L.; Guan, K. Making human cardiomyocytes up to date: Derivation, maturation state and perspectives. Int. J. Cardiol. 2017, 241, 379–386. [Google Scholar] [CrossRef]
- Théry, C.; Zitvogel, L.; Amigorena, S. Exosomes: Composition, biogenesis and function. Nat. Rev. Immunol. 2002, 2, 569–579. [Google Scholar] [CrossRef]
- Adamiak, M.; Cheng, G.; Bobis-Wozowicz, S.; Zhao, L.; Kedracka-Krok, S.; Samanta, A.; Karnas, E.; Xuan, Y.-T.; Skupien-Rabian, B.; Chen, X.; et al. Induced Pluripotent Stem Cell (iPSC)–Derived Extracellular Vesicles Are Safer and More Effective for Cardiac Repair Than iPSCs. Circ. Res. 2018, 122, 296–309. [Google Scholar] [CrossRef]
- Barreca, M.M.; Cancemi, P.; Geraci, F. Mesenchymal and Induced Pluripotent Stem Cells-Derived Extracellular Vesicles: The New Frontier for Regenerative Medicine? Cells 2020, 9, 1163. [Google Scholar] [CrossRef]
- Jeske, R.; Bejoy, J.; Marzano, M.; Li, Y. Human Pluripotent Stem Cell-Derived Extracellular Vesicles: Characteristics and Applications. Tissue Eng. Part B Rev. 2020, 26, 129–144. [Google Scholar] [CrossRef] [PubMed]
- Wiklander, O.P.B.; Brennan, M.Á.; Lötvall, J.; Breakefield, X.O.; EL Andaloussi, S. Advances in therapeutic applications of extracellular vesicles. Sci. Transl. Med. 2019, 11, 492. [Google Scholar] [CrossRef] [PubMed]
- Eirin, A.; Zhu, X.-Y.; Puranik, A.S.; Woollard, J.R.; Tang, H.; Dasari, S.; Lerman, A.; Van Wijnen, A.J.; Lerman, L.O. Comparative proteomic analysis of extracellular vesicles isolated from porcine adipose tissue-derived mesenchymal stem/stromal cells. Sci. Rep. 2016, 6, 36120. [Google Scholar] [CrossRef] [PubMed]
- Hsiao, S.T.-F.; Asgari, A.; Lokmic, Z.T.; Sinclair, R.; Dusting, G.J.; Lim, S.Y.; Dilley, R.J. Comparative Analysis of Paracrine Factor Expression in Human Adult Mesenchymal Stem Cells Derived from Bone Marrow, Adipose, and Dermal Tissue. Stem Cells Dev. 2012, 21, 2189–2203. [Google Scholar] [CrossRef] [PubMed]
- Mine, T.; Harada, K.; Matsumoto, T.; Yamana, H.; Shirouzu, K.; Itoh, K.; Yamada, A. CDw108 expression during T-cell development. Tissue Antigens 2000, 55, 429–436. [Google Scholar] [CrossRef] [PubMed]
- Pasterkamp, R.J.; Peschon, J.J.; Spriggs, M.K.; Kolodkin, A.L. Semaphorin 7A promotes axon outgrowth through integrins and MAPKs. Nature 2003, 424, 398–405. [Google Scholar] [CrossRef]
- Kruger, R.P.; Aurandt, J.; Guan, K.-L. Semaphorins command cells to move. Nat. Rev. Mol. Cell Biol. 2005, 6, 789–800. [Google Scholar] [CrossRef]
- Yazdani, U.; Terman, J.R. The semaphorins. Genome Biol. 2006, 7, 211. [Google Scholar] [CrossRef]
- Gomme, P.T.; McCann, K.B.; Bertolini, J. Transferrin: Structure, function and potential therapeutic actions. Drug Discov. Today 2005, 10, 267–273. [Google Scholar] [CrossRef]
- Brandsma, M.E.; Diao, H.; Wang, X.; Kohalmi, S.E.; Jevnikar, A.M.; Ma, S. Plant-derived recombinant human serum transferrin demonstrates multiple functions. Plant Biotechnol. J. 2010, 8, 489–505. [Google Scholar] [CrossRef]
- Ren, Z.; Huang, J.; Zhou, C.; Jia, L.; Li, M.; Liang, X.; Zeng, H. Transferrin and antioxidants partly prevented mouse oocyte oxidative damage induced by exposure of cumulus-oocyte complexes to endometrioma fluid. J. Ovarian Res. 2020, 13, 139. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Forbes, M.E.; Fuller, G.N.; Li, J.; Yang, X.; Zhang, W. IGFBP2: Integrative hub of developmental and oncogenic signaling network. Oncogene 2020, 39, 2243–2257. [Google Scholar] [CrossRef] [PubMed]
- Shen, F.; Song, C.; Liu, Y.; Zhang, J.; Song, S.W. IGFBP2 promotes neural stem cell maintenance and proliferation differentially associated with glioblastoma subtypes. Brain Res. 2019, 1704, 174–186. [Google Scholar] [CrossRef] [PubMed]
- Huynh, H.; Zheng, J.; Umikawa, M.; Zhang, C.; Silvany, R.; Iizuka, S.; Holzenberger, M.; Zhang, W.; Zhang, C.C. IGF binding protein 2 supports the survival and cycling of hematopoietic stem cells. Blood 2011, 118, 3236–3243. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Gulbranson, D.R.; Hou, Z.; Bolin, J.M.; Ruotti, V.; Probasco, M.D.; Smuga-Otto, K.; Howden, S.; Diol, N.R.; Propson, N.; et al. Chemically defined conditions for human iPSC derivation and culture. Nat. Methods 2011, 8, 424–429. [Google Scholar] [CrossRef]
- Mochizuki, M.; Sagara, H.; Nakahara, T. Type I collagen facilitates safe and reliable expansion of human dental pulp stem cells in xenogeneic serum-free culture. Stem Cell Res. Ther. 2020, 11, 267. [Google Scholar] [CrossRef]
- Kong, R.; Liu, H.; Shi, Y.; Man, Q.; Liu, S. COL14A1 promotes self-renewal of human liver cancer stem cells through activation of ERK signaling. J. Bio-X Res. 2021, 4, 10–17. [Google Scholar] [CrossRef]
- Xie, Y.; Su, N.; Yang, J.; Tan, Q.; Huang, S.; Jin, M.; Ni, Z.; Zhang, B.; Zhang, D.; Luo, F.; et al. FGF/FGFR signaling in health and disease. Signal Transduct. Target. Ther. 2020, 5, 181. [Google Scholar] [CrossRef]
- Iram, T.; Kern, F.; Kaur, A.; Myneni, S.; Morningstar, A.R.; Shin, H.; Garcia, M.A.; Yerra, L.; Palovics, R.; Yang, A.C.; et al. Young CSF restores oligodendrogenesis and memory in aged mice via Fgf. Nature 2022, 605, 509–515. [Google Scholar] [CrossRef]
- Rifkin, D.B. Latent Transforming Growth Factor-β (TGF-β) Binding Proteins: Orchestrators of TGF-β Availability. J. Biol. Chem. 2005, 280, 7409–7412. [Google Scholar] [CrossRef]
- Robertson, I.B.; Horiguchi, M.; Zilberberg, L.; Dabovic, B.; Hadjiolova, K.; Rifkin, D.B. Latent TGF-β-binding proteins. Matrix Biol. 2015, 47, 44–53. [Google Scholar] [CrossRef]
- Su, C.-T.; Urban, Z. LTBP4 in Health and Disease. Genes 2021, 12, 795. [Google Scholar] [CrossRef]
- Hu, B.-Y.; Weick, J.P.; Yu, J.; Ma, L.-X.; Zhang, X.-Q.; Thomson, J.A.; Zhang, S.-C. Neural differentiation of human induced pluripotent stem cells follows developmental principles but with variable potency. Proc. Natl. Acad. Sci. USA 2010, 107, 4335–4340. [Google Scholar] [CrossRef]
- Aminzadeh, M.A.; Rogers, R.G.; Fournier, M.; Tobin, R.E.; Guan, X.; Childers, M.K.; Andres, A.M.; Taylor, D.J.; Ibrahim, A.; Ding, X.; et al. Exosome-Mediated Benefits of Cell Therapy in Mouse and Human Models of Duchenne Muscular Dystrophy. Stem Cell Rep. 2018, 10, 942–955. [Google Scholar] [CrossRef]
hiPSC-hPBMC-mTeSR-0.5%PG concentration (P-mT-0.5PG) |
hiPSC-fibroblast-mTeSR-0.5%PG concentration (F-mT-0.5PG) |
hiPSC-hPBMC-E8-0.3%PG concentration (P-E8-0.3PG) |
hiPSC-fibroblast-E8-0.3%PG concentration (F-E8-0.3PG) |
hiPSC-hPBMC-mTeSR-0.5%PG concentration-Day4 (P-mT-0.5PG-D4) |
hiPSC-hPBMC-mTeSR-0.5%PG concentration-Day5 (P-mT-0.5PG-D5) |
hiPSC-hPBMC-mTeSR-0.5%PG concentration-Day6 (P-mT-0.5PG-D6) |
hiPSC-hPBMC-mTeSR-0.2%PG concentration (P-mT-0.2PG) |
hiPSC-hPBMC-mTeSR-1%PG concentration (P-mT-1PG) |
hiPSC-hPBMC-mTeSR-Suspension (P-mT-Susp) |
hiPSC-hPBMC-mTeSR-modified-Suspension (P-mT-MSusp) |
hiPSC-fibroblast-mTeSR-2D (F-mT-2D) |
Gene | Primer ID | Primer Sequence | Tm (°C) |
---|---|---|---|
SOX2 | SOX2-F1 | CAACCAGAAAAACAGCCC | 52 |
SOX2-R1 | TCTCCGACAAAAGTTTCC | ||
REX1 | REX1-F | GTTTCGTGTGTCCCTTTC | 52 |
REX1-R | CTTTCCCTCTTGTTCATTC | ||
OCT4 | OCT4-F | AAAGAGAAAGCGAACCAG | 52 |
OCT4-R | CCACATCCTTCTCGAGCC | ||
NANOG | NANOG-F1 | TGTGATTTGTGGGCCTGA | 52 |
NANOG-R1 | GTGGGTTGTTTGCCTTTG | ||
UTF1 | UTF1-F | CTCCCAGCGAACCAG | 52 |
UTF1-R | GCGTCCGCAGACTTC | ||
hTERT | hTERT-F | GGAGCAAGTTGCAAAGCATTG | 60 |
hTERT-R | TCCCACGACGTAGTCCATGTT | ||
DNMT3B | DNMT3B-F | GGAGCCACGACGTAACAA | 60 |
DNMT3B-R | GGCATCCGTCATCTTTCA | ||
hEID2 | hEID2-F | GAAGCCTGCAGAGCAAGG | 60 |
hEID2-R | ATATCGAGGTCCACCCTGTG | ||
hCAPN10 | hCAP-F | GGAGGTGACCACAGATGACC | 60 |
hCAP-R | GTAAGGGGAGCCAGAACACA | ||
hZNF324B | hZNF-F | GAGAATGGCCACGAGCTTT | 60 |
hZNF-R | TTTACACTGTGGCAGGCATC |
Sample | Particles/mL | Mean Diameter | ||
---|---|---|---|---|
1 | hiPSC-F-2D-mTeSR | 1.02 × 108 ± 9.04 × 106 | 100.00 | nm |
2 | hiPSC-F-0.3%PG-E8 | 2.07 × 108 ± 8.35 × 106 | 88.00 | nm |
3 | hiPSC-P-0.3%PG-E8 | 9.21 × 107 ± 1.02 × 107 | 101.1 | nm |
4 | hiPSC-P-0.5%PG-mTeSR | 1.67 × 108 ± 1.02 × 107 | 176.4 | nm |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cui, M.; Wu, W.; Li, Q.; Qi, G.; Liu, X.; Bai, J.; Chen, M.; Li, P.; Sun, X. Unlocking the Potential of Human-Induced Pluripotent Stem Cells: Cellular Responses and Secretome Profiles in Peptide Hydrogel 3D Culture. Cells 2024, 13, 143. https://doi.org/10.3390/cells13020143
Cui M, Wu W, Li Q, Qi G, Liu X, Bai J, Chen M, Li P, Sun X. Unlocking the Potential of Human-Induced Pluripotent Stem Cells: Cellular Responses and Secretome Profiles in Peptide Hydrogel 3D Culture. Cells. 2024; 13(2):143. https://doi.org/10.3390/cells13020143
Chicago/Turabian StyleCui, Muyun, Wei Wu, Quan Li, Guangyan Qi, Xuming Liu, Jianfa Bai, Mingshun Chen, Ping Li, and Xiuzhi (Susan) Sun. 2024. "Unlocking the Potential of Human-Induced Pluripotent Stem Cells: Cellular Responses and Secretome Profiles in Peptide Hydrogel 3D Culture" Cells 13, no. 2: 143. https://doi.org/10.3390/cells13020143
APA StyleCui, M., Wu, W., Li, Q., Qi, G., Liu, X., Bai, J., Chen, M., Li, P., & Sun, X. (2024). Unlocking the Potential of Human-Induced Pluripotent Stem Cells: Cellular Responses and Secretome Profiles in Peptide Hydrogel 3D Culture. Cells, 13(2), 143. https://doi.org/10.3390/cells13020143