The Impact of SLC2A8 RNA Interference on Glucose Uptake and the Transcriptome of Human Trophoblast Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Lentivirus Vector Construction and Virus Generation
2.2. In Vitro SLC2A8 RNAi of Human Trophoblast Cells
2.3. RNA Extraction and qPCR
2.4. Glucose Uptake Assay
2.5. RNAseq and Data Analysis
2.6. Quality Control and Mapping Processes
2.7. Transcriptome Profiling of Protein-Coding Genes
2.8. qPCR Validation of the RNAseq Results
3. Results
3.1. SLC2A8 RNAi in ACH-3P Cells
3.2. RNAseq Statistics
3.3. SLC2A8 Deficiency Alters Trophectodermal Gene Expression
3.4. Validation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hay, W.W. Placental-Fetal Glucose Exchange and Fetal Glucose Metabolism. Trans. Am. Clin. Climatol. Assoc. 2006, 117, 321–339, discussion 339–340. [Google Scholar]
- Hauguel, S.; Desmaizieres, V.; Challier, J.C. Glucose Uptake, Utilization, and Transfer by the Human Placenta as Functions of Maternal Glucose Concentration. Pediatr. Res. 1986, 20, 269–273. [Google Scholar] [CrossRef]
- Zeng, Z.; Liu, F.; Li, S. Metabolic Adaptations in Pregnancy: A Review. Ann. Nutr. Metab. 2017, 70, 59–65. [Google Scholar] [CrossRef]
- Anand, R.S.; Ganguli, S.; Sperling, M.A. Effect of Insulin-Induced Maternal Hypoglycemia on Glucose Turnover in Maternal and Fetal Sheep. Am. J. Physiol.-Endocrinol. Metab. 1980, 238, E524–E532. [Google Scholar] [CrossRef]
- Marconi, A.M.; Cetin, I.; Davoli, E.; Baggiani, A.M.; Fanelli, R.; Fennessey, P.V.; Battaglia, F.C.; Pardi, G. An Evaluation of Fetal Glucogenesis in Intrauterine Growth-Retarded Pregnancies. Metabolism 1993, 42, 860–864. [Google Scholar] [CrossRef]
- Illsley, N.P. Glucose Transporters in the Human Placenta. Placenta 2000, 21, 14–22. [Google Scholar] [CrossRef]
- Stanirowski, P.J.; Szukiewicz, D.; Pazura-Turowska, M.; Sawicki, W.; Cendrowski, K. Placental Expression of Glucose Transporter Proteins in Pregnancies Complicated by Gestational and Pregestational Diabetes Mellitus. Can. J. Diabetes 2018, 42, 209–217. [Google Scholar] [CrossRef]
- Navale, A.M.; Paranjape, A.N. Glucose Transporters: Physiological and Pathological Roles. Biophys. Rev. 2016, 8, 5–9. [Google Scholar] [CrossRef]
- Illsley, N.P.; Baumann, M.U. Human Placental Glucose Transport in Fetoplacental Growth and Metabolism. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165359. [Google Scholar] [CrossRef]
- Jansson, T.; Ylvén, K.; Wennergren, M.; Powell, T.L. Glucose Transport and System A Activity in Syncytiotrophoblast Microvillous and Basal Plasma Membranes in Intrauterine Growth Restriction. Placenta 2002, 23, 392–399. [Google Scholar] [CrossRef]
- Jansson, T.; Wennergren, M.; Illsley, N.P. Glucose Transporter Protein Expression in Human Placenta throughout Gestation and in Intrauterine Growth Retardation. J. Clin. Endocrinol. Metab. 1993, 77, 1554–1562. [Google Scholar] [CrossRef]
- Simpson, I.A.; Dwyer, D.; Malide, D.; Moley, K.H.; Travis, A.; Vannucci, S.J. The Facilitative Glucose Transporter GLUT3: 20 Years of Distinction. Am. J. Physiol. Endocrinol. Metab. 2008, 295, 242–253. [Google Scholar] [CrossRef] [PubMed]
- Brown, K.; Heller, D.S.; Zamudio, S.; Illsley, N.P. Glucose Transporter 3 (GLUT3) Protein Expression in Human Placenta across Gestation. Placenta 2011, 32, 1041–1049. [Google Scholar] [CrossRef] [PubMed]
- Lynch, C.S.; Kennedy, V.C.; Tanner, A.R.; Ali, A.; Winger, Q.A.; Rozance, P.J.; Anthony, R.V. Impact of Placental SLC2A3 Deficiency during the First-Half of Gestation. Int. J. Mol. Sci. 2022, 23, 12530. [Google Scholar] [CrossRef]
- Janzen, C.; Lei, M.Y.Y.; Cho, J.; Sullivan, P.; Shin, B.C.; Devaskar, S.U. Placental Glucose Transporter 3 (GLUT3) Is up-Regulated in Human Pregnancies Complicated by Late-Onset Intrauterine Growth Restriction. Placenta 2013, 34, 1072–1078. [Google Scholar] [CrossRef]
- Meschia, G.; Battaglia, F.C.; Hay, W.W.; Sparks, J.W. Utilization of Substrates by the Ovine Placenta in Vivo. Fed. Proc. 1980, 39, 245–249. [Google Scholar]
- Bell, A.W.; Kennaugh, J.M.; Battaglia, F.C.; Makowski, E.L.; Meschia, G. Metabolic and Circulatory Studies of Fetal Lamb at Midgestation. Am. J. Physiol.-Endocrinol. Metab. 1986, 250, E538–E544. [Google Scholar] [CrossRef]
- Schmidt, S.; Joost, H.G.; Schürmann, A. GLUT8, the Enigmatic Intracellular Hexose Transporter. Am. J. Physiol. Endocrinol. Metab. 2009, 296, 614–618. [Google Scholar] [CrossRef]
- Carayannopoulos, M.O.; Chi, M.M.Y.; Cui, Y.; Pingsterhaus, J.M.; McKnight, R.A.; Mueckler, M.; Devaskar, S.U.; Moley, K.H. GLUT8 Is a Glucose Transporter Responsible for Insulin-Stimulated Glucose Uptake in the Blastocyst. Proc. Natl. Acad. Sci. USA 2000, 97, 7313–7318. [Google Scholar] [CrossRef]
- Pinto, A.B.; Carayannopoulos, M.O.; Hoehn, A.; Dowd, L.; Moley, K.H. Glucose Transporter 8 Expression and Translocation Are Critical for Murine Blastocyst Survival. Biol. Reprod. 2002, 66, 1729–1733. [Google Scholar] [CrossRef]
- Membrez, M.; Hummler, E.; Beermann, F.; Haefliger, J.-A.; Savioz, R.; Pedrazzini, T.; Thorens, B. GLUT8 Is Dispensable for Embryonic Development but Influences Hippocampal Neurogenesis and Heart Function. Mol. Cell. Biol. 2006, 26, 4268–4276. [Google Scholar] [CrossRef]
- Gawlik, V.; Schmidt, S.; Scheepers, A.; Wennemuth, G.; Augustin, R.; Aumüller, G.; Moser, M.; Al-Hasani, H.; Kluge, R.; Joost, H.G.; et al. Targeted Disruption of Slc2a8 (GLUT8) Reduces Motility and Mitochondrial Potential of Spermatozoa. Mol. Membr. Biol. 2008, 25, 224–235. [Google Scholar] [CrossRef]
- Limesand, S.W.; Regnault, T.R.H.; Hay, W.W. Characterization of Glucose Transporter 8 (GLUT8) in the Ovine Placenta of Normal and Growth Restricted Fetuses. Placenta 2004, 25, 70–77. [Google Scholar] [CrossRef]
- Baker, C.M.; Goetzmann, L.N.; Cantlon, J.D.; Jeckel, K.M.; Winger, Q.A.; Anthony, R.V. Development of Ovine Chorionic Somatomammotropin Hormone-Deficient Pregnancies. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2016, 310, R837–R846. [Google Scholar] [CrossRef]
- Jeckel, K.M.; Boyarko, A.C.; Bouma, G.J.; Winger, Q.A.; Anthony, R.V. Chorionic Somatomammotropin Impacts Early Fetal Growth and Placental Gene Expression. J. Endocrinol. 2018, 237, 301–310. [Google Scholar] [CrossRef]
- Ali, A.; Anthony, R.V.; Bouma, G.J.; Winger, Q.A. LIN28-Let-7 Axis Regulates Genes in Immortalized Human Trophoblast Cells by Targeting the ARID3B-Complex. FASEB J. 2019, 33, 12348–12363. [Google Scholar] [CrossRef]
- Gates, K.C.; Goetzmann, L.N.; Cantlon, J.D.; Jeckel, K.M.; Anthony, R.V. Effect of Proline Rich 15-Deficiency on Trophoblast Viability and Survival. PLoS ONE 2017, 12, e0174976. [Google Scholar] [CrossRef] [PubMed]
- Hiden, U.; Wadsack, C.; Prutsch, N.; Gauster, M.; Weiss, U.; Frank, H.-G.; Schmitz, U.; Fast-Hirsch, C.; Hengstschläger, M.; Pötgens, A.; et al. The First Trimester Human Trophoblast Cell Line ACH-3P: A Novel Tool to Study Autocrine/Paracrine Regulatory Loops of Human Trophoblast Subpopulations–TNF-Alpha Stimulates MMP15 Expression. BMC Dev. Biol. 2007, 7, 137. [Google Scholar] [CrossRef] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.-C.; Mendell, J.T.; Salzberg, S.L. StringTie Enables Improved Reconstruction of a Transcriptome from RNA-Seq Reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef]
- Frazee, A.C.; Pertea, G.; Jaffe, A.E.; Langmead, B.; Salzberg, S.L.; Leek, J.T. Ballgown Bridges the Gap between Transcriptome Assembly and Expression Analysis. Nat. Biotechnol. 2015, 33, 243–246. [Google Scholar] [CrossRef]
- Lipka, A.; Jastrzebski, J.P.; Paukszto, L.; Makowczenko, K.G.; Lopienska-Biernat, E.; Gowkielewicz, M.; Lepiarczyk, E.; Wiszpolska, M.; Majewski, M.K.; Majewska, M. Sex-Biased LncRNA Signature in Fetal Growth Restriction (FGR). Cells 2021, 10, 921. [Google Scholar] [CrossRef]
- Majewska, M.; Lipka, A.; Paukszto, L.; Jastrzebski, J.P.; Myszczynski, K.; Gowkielewicz, M.; Jozwik, M.; Majewski, M.K. Transcriptome Profile of the Human Placenta. Funct. Integr. Genom. 2017, 17, 551–563. [Google Scholar] [CrossRef]
- Majewska, M.; Lipka, A.; Paukszto, L.; Jastrzebski, J.P.; Szeszko, K.; Gowkielewicz, M.; Lepiarczyk, E.; Jozwik, M.; Majewski, M.K. Placenta Transcriptome Profiling in Intrauterine Growth Restriction (IUGR). Int. J. Mol. Sci. 2019, 20, 1510. [Google Scholar] [CrossRef]
- Reimand, J.; Arak, T.; Adler, P.; Kolberg, L.; Reisberg, S.; Peterson, H.; Vilo, J. G:Profiler—A Web Server for Functional Interpretation of Gene Lists. Nucleic Acids Res. 2016, 44, W83–W89. [Google Scholar] [CrossRef] [PubMed]
- Hay, W.W.; Molina, R.A.; DiGiacomo, J.E.; Meschia, G. Model of Placental Glucose Consumption and Glucose Transfer. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 1990, 258, R569–R577. [Google Scholar] [CrossRef] [PubMed]
- Burton, G.J.; Fowden, A.L. Review: The Placenta and Developmental Programming: Balancing Fetal Nutrient Demands with Maternal Resource Allocation. Placenta 2012, 33, S23–S27. [Google Scholar] [CrossRef] [PubMed]
- Hay, W.W. Energy and Substrate Requirements of the Placenta and Fetus. Proc. Nutr. Soc. 1991, 50, 321–336. [Google Scholar] [CrossRef]
- Vaughan, O.R.; Sferruzzi-Perri, A.N.; Coan, P.M.; Fowden, A.L. Environmental Regulation of Placental Phenotype: Implications for Fetal Growth. Reprod. Fertil. Dev. 2012, 24, 80–96. [Google Scholar] [CrossRef] [PubMed]
- Doege, H.; Schürmann, A.; Bahrenberg, G.; Brauers, A.; Joost, H.G. GLUT8, a Novel Member of the Sugar Transport Facilitator Family with Glucose Transport Activity. J. Biol. Chem. 2000, 275, 16275–16280. [Google Scholar] [CrossRef]
- Sankar, R.; Thamotharan, S.; Shin, D.; Moley, K.H.; Devaskar, S.U. Insulin-Responsive Glucose Transporters-GLUT8 and GLUT4 Are Expressed in the Developing Mammalian Brain. Mol. Brain Res. 2002, 107, 157–165. [Google Scholar] [CrossRef]
- Janzen, C.; Lei, M.Y.Y.; Jeong, I.S.D.; Ganguly, A.; Sullivan, P.; Paharkova, V.; Capodanno, G.; Nakamura, H.; Perry, A.; Shin, B.-C.; et al. Humanin (HN) and Glucose Transporter 8 (GLUT8) in Pregnancies Complicated by Intrauterine Growth Restriction. PLoS ONE 2018, 13, e0193583. [Google Scholar] [CrossRef]
- Stanirowski, P.J.; Lipa, M.; Bomba-Opoń, D.; Wielgoś, M. Expression of Placental Glucose Transporter Proteins in Pregnancies Complicated by Fetal Growth Disorders. In Advances in Protein Chemistry and Structural Biology; Elsevier: Amsterdam, The Netherlands, 2021; Volume 123, pp. 95–131. ISBN 9780128220870. [Google Scholar]
- Alexander, C.M.; Martin, J.A.; Oxman, E.; Kasza, I.; Senn, K.A.; Dvinge, H. Alternative Splicing and Cleavage of GLUT8. Mol. Cell Biol. 2020, 41, e00480-20. [Google Scholar] [CrossRef]
- Pagliarini, D.J.; Rutter, J. Hallmarks of a New Era in Mitochondrial Biochemistry. Genes. Dev. 2013, 27, 2615–2627. [Google Scholar] [CrossRef]
- Modesti, L.; Danese, A.; Angela Maria Vitto, V.; Ramaccini, D.; Aguiari, G.; Gafà, R.; Lanza, G.; Giorgi, C.; Pinton, P. Mitochondrial Ca2+ Signaling in Health, Disease and Therapy. Cells 2021, 10, 1317. [Google Scholar] [CrossRef]
- Saneto, R.P. Mitochondrial Diseases: Expanding the Diagnosis in the Era of Genetic Testing. J. Transl. Genet. Genom. 2020, 4, 384–428. [Google Scholar] [CrossRef]
- Henriques, B.J.; Katrine Jentoft Olsen, R.; Gomes, C.M.; Bross, P. Electron Transfer Flavoprotein and Its Role in Mitochondrial Energy Metabolism in Health and Disease. Gene 2021, 776, 145407. [Google Scholar] [CrossRef] [PubMed]
- Mallik, B.; Frank, C.A. Roles for Mitochondrial Complex I Subunits in Regulating Synaptic Transmission and Growth. Front. Neurosci. 2022, 16, 846425. [Google Scholar] [CrossRef] [PubMed]
- Kovářová, N.; Čížková Vrbacká, A.; Pecina, P.; Stránecký, V.; Pronicka, E.; Kmoch, S.; Houštěk, J. Adaptation of Respiratory Chain Biogenesis to Cytochrome c Oxidase Deficiency Caused by SURF1 Gene Mutations. Biochim. Biophys. Acta Mol. Basis Dis. 2012, 1822, 1114–1124. [Google Scholar] [CrossRef] [PubMed]
- Brischigliaro, M.; Zeviani, M. Cytochrome c Oxidase Deficiency. Biochim. Biophys. Acta Bioenerg. 2021, 1862, 148335. [Google Scholar] [CrossRef] [PubMed]
- Kubala, J.M.; Laursen, K.B.; Schreiner, R.; Williams, R.M.; van der Mijn, J.C.; Crowley, M.J.; Mongan, N.P.; Nanus, D.M.; Heller, D.A.; Gudas, L.J. NDUFA4L2 Reduces Mitochondrial Respiration Resulting in Defective Lysosomal Trafficking in Clear Cell Renal Cell Carcinoma. Cancer Biol. Ther. 2023, 24, 2170669. [Google Scholar] [CrossRef] [PubMed]
- Steinhauser, C.B.; Lambo, C.A.; Askelson, K.; Burns, G.W.; Behura, S.K.; Spencer, T.E.; Bazer, F.W.; Satterfield, M.C. Placental Transcriptome Adaptations to Maternal Nutrient Restriction in Sheep. Int. J. Mol. Sci. 2021, 22, 7654. [Google Scholar] [CrossRef] [PubMed]
- Pendleton, A.L.; Antolic, A.T.; Kelly, A.C.; Davis, M.A.; Camacho, L.E.; Doubleday, K.; Anderson, M.J.; Langlais, P.R.; Lynch, R.M.; Limesand, S.W. Lower Oxygen Consumption and Complex I Activity in Mitochondria Isolated from Skeletal Muscle of Fetal Sheep with Intrauterine Growth Restriction. Am. J. Physiol. Endocrinol. Metab. 2020, 319, E67–E80. [Google Scholar] [CrossRef] [PubMed]
- Pendleton, A.L.; Wesolowski, S.R.; Regnault, T.R.H.; Lynch, R.M.; Limesand, S.W. Dimming the Powerhouse: Mitochondrial Dysfunction in the Liver and Skeletal Muscle of Intrauterine Growth Restricted Fetuses. Front. Endocrinol. 2021, 12, 612888. [Google Scholar] [CrossRef] [PubMed]
- Floyd, B.J.; Wilkerson, E.M.; Veling, M.T.; Minogue, C.E.; Xia, C.; Beebe, E.T.; Wrobel, R.L.; Cho, H.; Kremer, L.S.; Alston, C.L.; et al. Mitochondrial Protein Interaction Mapping Identifies New Regulators of Respiratory Chain Function of the Project and Its Design HHS Public Access. Mol. Cell 2016, 63, 621–632. [Google Scholar] [CrossRef] [PubMed]
- Sanglard, L.P.; Nascimento, M.; Moriel, P.; Sommer, J.; Ashwell, M.; Poore, M.H.; Duarte, M.D.S.; Serão, N.V.L. Impact of Energy Restriction during Late Gestation on the Muscle and Blood Transcriptome of Beef Calves after Preconditioning. BMC Genom. 2018, 19, 702. [Google Scholar] [CrossRef]
- Ahmad, S.; Drag, M.H.; Salleh, S.M.; Cai, Z.; Nielsen, M.O. Transcriptomics Analysis of Differentially Expressed Genes in Subcutaneous and Perirenal Adipose Tissue of Sheep as Affected by Their Pre- and Early Postnatal Malnutrition Histories. BMC Genom. 2021, 22, 338. [Google Scholar] [CrossRef]
- Jones, R.; Peña, J.; Mystal, E.; Marsit, C.; Lee, M.J.; Stone, J.; Lambertini, L. Mitochondrial and Glycolysis-Regulatory Gene Expression Profiles Are Associated with Intrauterine Growth Restriction. J. Matern.-Fetal Neonatal Med. 2020, 33, 1336–1345. [Google Scholar] [CrossRef]
- Bender, T.; Martinou, J.C. The Mitochondrial Pyruvate Carrier in Health and Disease: To Carry or Not to Carry? Biochim. Biophys. Acta Mol. Cell Res. 2016, 1863, 2436–2442. [Google Scholar] [CrossRef] [PubMed]
- Feng, J.; Ma, Y.; Chen, Z.; Hu, J.; Yang, Q.; Ding, G. Mitochondrial Pyruvate Carrier 2 Mediates Mitochondrial Dysfunction and Apoptosis in High Glucose-Treated Podocytes. Life Sci. 2019, 237, 116941. [Google Scholar] [CrossRef]
- Venkatesan, R.; Sah-Teli, S.K.; Awoniyi, L.O.; Jiang, G.; Prus, P.; Kastaniotis, A.J.; Hiltunen, J.K.; Wierenga, R.K.; Chen, Z. Insights into Mitochondrial Fatty Acid Synthesis from the Structure of Heterotetrameric 3-Ketoacyl-ACP Reductase/3R-Hydroxyacyl-CoA Dehydrogenase. Nat. Commun. 2014, 5, 4805. [Google Scholar] [CrossRef]
- Hiltunen, J.K.; Autio, K.J.; Schonauer, M.S.; Kursu, V.A.S.; Dieckmann, C.L.; Kastaniotis, A.J. Mitochondrial Fatty Acid Synthesis and Respiration. Biochim. Biophys. Acta Bioenerg. 2010, 1797, 1195–1202. [Google Scholar] [CrossRef]
- Blackburn, P.; Gass, J.; Pinto e Vairo, F.; Farnham, K.; Atwal, H.; Macklin, S.; Klee, E.; Atwal, P. Maple Syrup Urine Disease: Mechanisms and Management. Appl. Clin. Genet. 2017, 10, 57–66. [Google Scholar] [CrossRef]
- Phillips, I.R.; Veeravalli, S.; Khadayate, S.; Shephard, E.A. Metabolomic and Transcriptomic Analyses of Fmo5-/- Mice Reveal Roles for Flavin-Containing Monooxygenase 5 (FMO5) in NRF2-Mediated Oxidative Stress Response, Unfolded Protein Response, Lipid Homeostasis, and Carbohydrate and One-Carbon Metabolism. PLoS ONE 2023, 18, e0286692. [Google Scholar] [CrossRef] [PubMed]
- Al-Khallaf, H. Isocitrate Dehydrogenases in Physiology and Cancer: Biochemical and Molecular Insight. Cell Biosci. 2017, 7, 37. [Google Scholar] [CrossRef] [PubMed]
- Hay, W.W., Jr.; Meznarich, H.K. Effect of Maternal Glucose Concentration on Uteroplacental Glucose Consumption and Transfer in Pregnant Sheep. Proc. Soc. Exp. Biol. Med. 1989, 190, 63–69. [Google Scholar] [CrossRef] [PubMed]
- Simmons, M.A.; Battaglia, F.C.; Meschia, G. Placental Transfer of Glucose. J. Dev. Physiol. 1979, 1, 227–243. [Google Scholar] [PubMed]
- Wu, F.; Tian, F.-J.; Lin, Y. Oxidative Stress in Placenta: Health and Diseases. Biomed. Res. Int. 2015, 2015, 293271. [Google Scholar] [CrossRef] [PubMed]
- Ball, E.; Bulmer, J.N.; Ayis, S.; Lyall, F.; Robson, S.C. Late Sporadic Miscarriage Is Associated with Abnormalities in Spiral Artery Transformation and Trophoblast Invasion. J. Pathol. 2006, 208, 535–542. [Google Scholar] [CrossRef] [PubMed]
- Kadyrov, M.; Kingdom, J.C.P.; Huppertz, B. Divergent Trophoblast Invasion and Apoptosis in Placental Bed Spiral Arteries from Pregnancies Complicated by Maternal Anemia and Early-Onset Preeclampsia/Intrauterine Growth Restriction. Am. J. Obstet. Gynecol. 2006, 194, 557–563. [Google Scholar] [CrossRef] [PubMed]
- Cleal, J.K.; Poore, K.R.; Lewis, R.M. The Placental Exposome, Placental Epigenetic Adaptations and Lifelong Cardio-Metabolic Health. Mol. Aspects Med. 2022, 87, 101095. [Google Scholar] [CrossRef] [PubMed]
Gene | Accession Number | Oligo Name | Oligonucleotide Sequence (5′ → 3′) |
---|---|---|---|
SLC2A8 | Y17801.1 | 650 F | CCGGGCTTCTCATGTGCTTCATGCCTTCAAGAGAGGCATGAAGCACATGAGAAGCTTTTTG |
650 R | AATTCAAAAAGCTTCTCATGTGCTTCATGCCTCTCTTGAAGGCATGAAGCACATGAGAAGC | ||
817 F | CCGGGCATCTACAAGCCCTTCATCATTCAAGAGATGATGAAGGGCTTGTAGATGCTTTTTG | ||
817 R | AATTCAAAAAGCATCTACAAGCCCTTCATCATCTCTTGAATGATGAAGGGCTTGTAGATGC | ||
1452 F | CCGGGGAAAGACTCTGGAACAAATCTTCAAGAGAGATTTGTTCCAGAGTCTTTCCTTTTTG | ||
1452 R | AATTCAAAAAGGAAAGACTCTGGAACAAATCTCTCTTGAAGATTTGTTCCAGAGTCTTTCC | ||
1863 F | CCGGGCCTTATCGGGAAGGAAATTTTTCAAGAGAAAATTTCCTTCCCGATAAGGCTTTTTG | ||
1863 R | AATTCAAAAAGCCTTATCGGGAAGGAAATTTTCTCTTGAAAAATTTCCTTCCCGATAAGGC |
Gene | Accession Number | Fwd (5′ → 3′) | Rev (5′ → 3′) | Amplicon Size (bp) |
---|---|---|---|---|
SLC2A8 | Y17801.1 | ATGTGCTTCATGCCCGAGACC | TGGATGACACCCACGACGA | 311 |
RPS15 | NM_001018 | TTCCGCAAGTTCACCTACC | CGGGCCGGGCATGCTTTACG | 361 |
Control ACH-3P Cells | SLC2A8-Deficient ACH-3P Cells | |||||||
---|---|---|---|---|---|---|---|---|
1 | 2 | 3 | 4 | 1 | 2 | 3 | 4 | |
Row reads | 101,985,422 | 119,212,310 | 117,319,316 | 122,204,792 | 122,233,048 | 138,670,320 | 127,242,242 | 1.01 × 108 |
Mapped reads | 58,421,944 | 67,375,772 | 65,818,390 | 66,997,252 | 67,896,148 | 74,225,838 | 69,811,368 | 54,391,282 |
Uniquely mapped reads | 56,626,194 | 65,017,284 | 63,508,560 | 64,650,006 | 65,217,452 | 71,508,530 | 67,218,322 | 52,358,886 |
Multi-mapped reads | 1,789,424 | 2,348,664 | 2,301,056 | 2,338,934 | 2,668,114 | 2,706,906 | 2,584,922 | 2,024,950 |
Too many loci | 6326 | 9824 | 8774 | 8312 | 10,582 | 10,402 | 8124 | 7446 |
Expressed transcripts | 58,147 | 60,405 | 59,872 | 60,476 | 60,606 | 62,106 | 61,764 | 58,481 |
Expressed genes | 24,084 | 25,154 | 24,971 | 24,909 | 24,910 | 25,194 | 24,965 | 24,357 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lipka, A.; Paukszto, Ł.; Kennedy, V.C.; Tanner, A.R.; Majewska, M.; Anthony, R.V. The Impact of SLC2A8 RNA Interference on Glucose Uptake and the Transcriptome of Human Trophoblast Cells. Cells 2024, 13, 391. https://doi.org/10.3390/cells13050391
Lipka A, Paukszto Ł, Kennedy VC, Tanner AR, Majewska M, Anthony RV. The Impact of SLC2A8 RNA Interference on Glucose Uptake and the Transcriptome of Human Trophoblast Cells. Cells. 2024; 13(5):391. https://doi.org/10.3390/cells13050391
Chicago/Turabian StyleLipka, Aleksandra, Łukasz Paukszto, Victoria C. Kennedy, Amelia R. Tanner, Marta Majewska, and Russell V. Anthony. 2024. "The Impact of SLC2A8 RNA Interference on Glucose Uptake and the Transcriptome of Human Trophoblast Cells" Cells 13, no. 5: 391. https://doi.org/10.3390/cells13050391