GRK2 Mediated Abnormal Transduction of PGE2-EP4-cAMP-CREB Signaling Induces the Imbalance of Macrophages Polarization in Collagen-Induced Arthritis Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Reagents
2.3. The Establishment of CIA Model
2.4. Cells Isolation and Cell Culture
2.5. Evaluation of Arthritis
2.6. Protein Sample Preparation
2.7. Western Blot Analyses
2.8. Flow Cytometry
2.9. Histological Examination
2.10. Confocal Microscopy
2.11. Small Interfering RNA (siRNA)
2.12. RAW KO Cell Lines and Complementation
2.13. Co-Immunoprecipitation and QPCR
2.14. Statistical Analysis
3. Results
3.1. The Imbalance of Macrophage Polarization in PMs, BMMs and SMs of CIA Mice
3.2. Abnormal PGE2-cAMP-CREB Transduction in CIA Mice
3.3. Abnormal PGE2-cAMP-CREB Signaling Induced Macrophage Imbalance in CIA Mice
3.4. The EP4 Over-Desensitization Resulted in the Abnormal Transduction of PGE2-cAMP-CREB Signaling in CIA Mice
3.5. GRK2-Induced Over-Desensitization of EP4 Involved in Macrophage Polarization
3.6. The Deletion of GRK2 Promoted M2 Polarization through cAMP-CREB Pathway
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Iwamoto, T.; Okamoto, H.; Toyama, Y.; Momohara, S. Molecular aspects of rheumatoid arthritis: Chemokines in the joints of patients. FEBS J. 2008, 275, 4448–4455. [Google Scholar] [CrossRef] [PubMed]
- Burmester, G.R.; Stuhlmüller, B.; Keyszer, G.; Kinne, R.W. Mononuclear phagocytes and rheumatoid synovitis. Mastermind or workhorse in arthritis? Arthritis. Rheum. 1997, 40, 5–18. [Google Scholar] [CrossRef] [PubMed]
- Sack, U.; Stiehl, P.; Geiler, G. Distribution of macrophages in rheumatoid synovial membrane and its association with basic activity. Rheumatol. Int. 1994, 13, 181–186. [Google Scholar] [CrossRef] [PubMed]
- Haringman, J.J.; Gerlag, D.M.; Zwinderman, A.H.; Smeets, T.J.; Kraan, M.C.; Baeten, D.; McInnes, I.B.; Bresnihan, B.; Tak, P.P. Synovial tissue macrophages: A sensitive biomarker for response to treatment in patients with rheumatoid arthritis. Ann. Rheum. Dis. 2005, 64, 834–838. [Google Scholar] [CrossRef]
- Udalova, I.A.; Mantovani, A.; Feldmann, M. Macrophage heterogeneity in the context of rheumatoid arthritis. Nat. Rev. Rheumatol. 2006, 12, 472–485. [Google Scholar] [CrossRef]
- Miossec, P.; Kolls, J.K. Targeting IL-17 and TH17 cells in chronic inflammation. Nat. Rev. Drug Discov. 2012, 11, 763–776. [Google Scholar] [CrossRef]
- Luan, B.; Yoon, Y.S.; Le Lay, J.; Kaestner, K.H.; Hedrick, S.; Montminy, M. CREB pathway links PGE2 signaling with macrophage polarization. Proc. Natl. Acad. Sci. USA 2015, 112, 15642–15647. [Google Scholar] [CrossRef] [Green Version]
- Wu, H.; Wei, W.; Song, L.; Zhang, L.; Chen, Y.; Hu, X. Paeoniflorin induced immune tolerance of mesenteric lymph node lymphocytes via enhancing beta 2-adrenergic receptor desensitization in rats with adjuvant arthritis. Int. Immunopharmacol. 2007, 7, 662–673. [Google Scholar] [CrossRef]
- Chen, J.Y.; Wu, H.X.; Chen, Y.; Zhang, L.L.; Wang, Q.T.; Sun, W.Y.; Wei, W. Paeoniflorin inhibits proliferation of fibroblast-like synoviocytes through suppressing G-protein-coupled receptor kinase 2. Planta Med. 2012, 78, 665–671. [Google Scholar] [CrossRef] [Green Version]
- Métayé, T.; Gibelin, H.; Perdrisot, R.; Kraimps, J.L. Pathophysiological roles of G-protein-coupled receptor kinases. Cell. Signal. 2005, 17, 917–928. [Google Scholar] [CrossRef]
- Singhmar, P.; Huo, X.; Eijkelkamp, N.; Berciano, S.R.; Baameur, F.; Mei, F.C.; Zhu, Y.; Cheng, X.; Hawke, D.; Mayor, F., Jr.; et al. Critical role for Epac1 in inflammatory pain controlled by GRK2-mediated phosphorylation of Epac1. Proc. Natl. Acad. Sci. USA 2016, 113, 3036–3041. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Degos, V.; Peineau, S.; Nijboer, C.; Kaindl, A.M.; Sigaut, S.; Favrais, G.; Plaisant, F.; Teissier, N.; Gouadon, E.; Lombet, A.; et al. G protein-coupled receptor kinase 2 and group I metabotropic glutamate receptors mediate inflammation-induced sensitization to excitotoxic neurodegeneration. Ann. Neurol. 2013, 73, 667–678. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Wang, L.; Wu, L.; Zhang, M.; Hu, S.; Wang, R.; Han, Y.; Wu, Y.; Zhang, L.; Wang, X.; et al. Paroxetine alleviates T lymphocyte activation and infiltration to joints of collagen-induced arthritis. Sci. Rep. 2017, 7, 45364. [Google Scholar] [CrossRef] [PubMed]
- Pfleger, J.; Gresham, K.; Koch, W.J. G protein-coupled receptor kinases as therapeutic targets in the heart. Nat. Rev. Cardiol. 2019, 16, 612–622. [Google Scholar] [CrossRef] [PubMed]
- Jia, X.Y.; Chang, Y.; Wei, F.; Dai, X.; Wu, Y.J.; Sun, X.J.; Xu, S.; Wu, H.X.; Wang, C.; Yang, X.Z.; et al. CP-25 reverses prostaglandin E4 receptor desensitization-induced fibroblast-like synoviocyte dysfunction via the G protein-coupled receptor kinase 2 in autoimmune arthritis. Acta Pharmacol. Sin. 2019, 40, 1029–1039. [Google Scholar] [CrossRef]
- Yang, X.; Zhao, Y.; Jia, X.; Wang, C.; Wu, Y.; Zhang, L.; Chang, Y.; Wei, W. CP 25 combined with MTX/ LEF ameliorates the progression of adjuvant induced arthritis by the inhibition on GRK2 translocation. Biomed. Pharmacother. 2019, 110, 834–843. [Google Scholar] [CrossRef]
- Chen, J.; Wang, Y.; Wu, H.; Yan, S.; Chang, Y.; Wei, W. A Modified Compound from Paeoniflorin, CP-25, Suppressed Immune Responses and Synovium Inflammation in Collagen-Induced Arthritis Mice. Front. Pharmacol. 2018, 9, 563. [Google Scholar] [CrossRef] [Green Version]
- Weischenfeldt, J.; Porse, B. Bone marrow-derived macrophages (BMM): Isolation and applications. CSH Protoc. 2008, 12, pdb-prot5080. [Google Scholar] [CrossRef] [Green Version]
- Tu, J.; Hong, W.; Guo, Y.; Zhang, P.; Fang, Y.; Wang, X.; Chen, X.; Lu, S.; Wei, W. Ontogeny of synovial macrophages and the roles of synovial macrophages from different origins in arthritis. Front. Immunol. 2019, 10, 1146. [Google Scholar] [CrossRef]
- Cong, L.; Ran, F.A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P.D.; Wu, X.; Jiang, W.; Marraffini, L.A.; et al. Multiplex genome engineering using CRI SPR/Cas systems. Science 2013, 339, 819–823. [Google Scholar] [CrossRef] [Green Version]
- Shu, J.L.; Zhang, X.Z.; Han, L.; Zhang, F.; Wu, Y.J.; Tang, X.Y.; Wang, C.; Tai, Y.; Wang, Q.T.; Chen, J.Y.; et al. Paeoniflorin-6′-O-benzene sulfonate alleviates collagen induced arthritis in mice by downregulating BAFF-TRAF2- NF-κB signaling comparison with biological agents. Acta Pharmacol. Sin. 2019, 40, 801–813. [Google Scholar] [CrossRef] [PubMed]
- Screaton, R.A.; Conkright, M.D.; Katoh, Y.; Best, J.L.; Canettieri, G.; Jeffries, S.; Guzman, E.; Niessen, S.; Yates, J.R., III; Takemori, H.; et al. The CREB coactivator TORC2 functions as a calcium- and cAMP-sensitive coincidence detector. Cell 2004, 119, 61–74. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ambarus, C.A.; Noordenbos, T.; de Hair, M.J.; Tak, P.P.; Baeten, D.L. Intimal lining layer macrophages but not synovial sublining macrophages display an IL-10 polarized-like phenotype in chronic synovitis. Arthritis Res. Ther. 2012, 14, R74. [Google Scholar] [CrossRef] [Green Version]
- Soler Palacios, B.; Estrada-Capetillo, L.; Izquierdo, E.; Criado, G.; Nieto, C.; Municio, C.; González-Alvaro, I.; Sánchez-Mateos, P.; Pablos, J.L.; Corbí, A.L.; et al. Macrophages from the synovium of active rheumatoid arthritis exhibit an activin A-dependent proinflammatory profile. J. Pathol. 2015, 235, 515–526. [Google Scholar] [CrossRef] [PubMed]
- Premont, R.T.; Gainetdinov, R.R. Physiological roles of G protein-coupled receptor kinases and arrestins. Annu. Rev. Physiol. 2007, 69, 511–534. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Apel, F.; Zychlinsky, A.; Kenny, E.F. The role of neutrophil extracellular traps in rheumatic diseases. Nat. Rev. Rheumatol. 2018, 14, 467–475. [Google Scholar] [CrossRef] [PubMed]
- Minami, M.; Shimizu, K.; Okamoto, Y.; Folco, E.; Ilasaca, M.L.; Feinberg, M.W.; Aikawa, M.; Libby, P. Prostaglandin E receptor type 4-associated protein interacts directly with NF-kappaB1 and attenuates macrophage activation. J. Biol. Chem. 2008, 283, 9692–9703. [Google Scholar] [CrossRef] [Green Version]
- McCoy, J.M.; Wicks, J.R.; Audoly, L.P. The role of prostaglandin E2 receptors in the pathogenesis of rheumatoid arthritis. J. Clin. Investig. 2002, 110, 651–658. [Google Scholar] [CrossRef]
- Penela, P.; Murga, C.; Ribas, C.; Lafarga, V.; Mayor Jr, F. The complex G protein-coupled receptor kinase 2 (GRK2) interactome unveils new physiopathological targets. (Translated from eng). Br. J. Pharmacol. 2012, 160, 821–832. [Google Scholar] [CrossRef] [Green Version]
- Pierce, K.L.; Premont, R.T.; Lefkowitz, R.J. Seven-transmembrane receptors. Nat. Rev. Mol. Cell Biol. 2002, 3, 639–650. (In English) [Google Scholar] [CrossRef]
NO. | 5′ | STEM | 3′ |
---|---|---|---|
Adrbk1-sgRNA(05985-2)-a | CACCg | CTTGGTGGAGTTCTACGAAG | |
Adrbk1-sgRNA(05985-2)-b | aaac | CTTCGTAGAACTCCACCAAG | c |
Adrbk1-sgRNA(05986-1)-a | CACCg | AGATTTGTCAGAACCTCCGA | |
Adrbk1-sgRNA(05986-1)-b | aaac | TCGGAGGTTCTGACAAATCT | c |
Adrbk1-sgRNA(05987-1)-a | CACCg | AGTCAAAGATCTCTCGGCTG | |
Adrbk1-sgRNA(05987-1)-b | aaac | CAGCCGAGAGATCTTTGACT | c |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, X.; Li, S.; Zhao, Y.; Li, S.; Zhao, T.; Tai, Y.; Zhang, B.; Wang, X.; Wang, C.; Chen, J.; et al. GRK2 Mediated Abnormal Transduction of PGE2-EP4-cAMP-CREB Signaling Induces the Imbalance of Macrophages Polarization in Collagen-Induced Arthritis Mice. Cells 2019, 8, 1596. https://doi.org/10.3390/cells8121596
Yang X, Li S, Zhao Y, Li S, Zhao T, Tai Y, Zhang B, Wang X, Wang C, Chen J, et al. GRK2 Mediated Abnormal Transduction of PGE2-EP4-cAMP-CREB Signaling Induces the Imbalance of Macrophages Polarization in Collagen-Induced Arthritis Mice. Cells. 2019; 8(12):1596. https://doi.org/10.3390/cells8121596
Chicago/Turabian StyleYang, Xuezhi, Susu Li, Yingjie Zhao, Siyu Li, Tianjiao Zhao, Yu Tai, Bingjie Zhang, Xinwei Wang, Chun Wang, Jingyu Chen, and et al. 2019. "GRK2 Mediated Abnormal Transduction of PGE2-EP4-cAMP-CREB Signaling Induces the Imbalance of Macrophages Polarization in Collagen-Induced Arthritis Mice" Cells 8, no. 12: 1596. https://doi.org/10.3390/cells8121596