ΕGFR/ERβ-Mediated Cell Morphology and Invasion Capacity Are Associated with Matrix Culture Substrates in Breast Cancer
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Cell Culture
2.3. RNA Isolation, Reverse Transcription and Real-Time qPCR Analysis
2.4. Cell Invasion Assay
2.5. Cell Adhesion Assay
2.6. Gelatin Zymography
2.7. SEM Imaging
3. Results
3.1. EGFR Regulates the Expression of Matrix Macromolecules in Triple-Negative Breast Cancer Cells
3.2. EGFR/ERβ Axis Governs Metastasis-Related Functional Properties in Breast Cancer
3.3. Morphology of Breast Cancer Cells Cultured on Millipore Filter Covered by Type I Collagen (200 µg/mL)
3.4. Morphology of Breast Cancer Cells Cultured on Millipore Filter Covered by Type I Collagen (3000 µg/mL)
3.5. Morphology of Breast Cancer Cells Cultured on Millipore Filter Covered by FN
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Ferlay, J.; Colombet, M.; Soerjomataram, I.; Mathers, C.; Parkin, D.; Piñeros, M.; Znaor, A.; Bray, F. Estimating the global cancer incidence and mortality in 2018: GLOBOCAN sources and methods. Int. J. Cancer 2018, 144, 1941–1953. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carioli, G.; Malvezzi, M.; Rodriguez, T.; Bertuccio, P.; Negri, E.; La Vecchia, C. Trends and predictions to 2020 in breast cancer mortality in Europe. Breast 2017, 36, 89–95. [Google Scholar] [CrossRef]
- Seely, J.M. How Effective Is Mammography as a Screening Tool? Curr. Breast Cancer Rep. 2017, 9, 251–258. [Google Scholar] [CrossRef]
- Moloney, B.M.; O’Loughlin, D.; Elwahab, S.A.; Kerin, M.J. Breast Cancer Detection—A Synopsis of Conventional Modalities and the Potential Role of Microwave Imaging. Diagnostics 2020, 10, 103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Acs, B.; Rantalainen, M.; Hartman, J. Artificial intelligence as the next step towards precision pathology. J. Intern. Med. 2020, 288, 62–81. [Google Scholar] [CrossRef] [Green Version]
- Dillekås, H.; Rogers, M.S.; Straume, O. Are 90% of deaths from cancer caused by metastases? Cancer Med. 2019, 8, 5574–5576. [Google Scholar] [CrossRef] [Green Version]
- Hanahan, D.; Weinberg, R.A. Hallmarks of Cancer: The Next Generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Green Version]
- Carey, L.; Winer, E.; Viale, G.; Cameron, D.; Gianni, L. Triple-negative breast cancer: Disease entity or title of convenience? Nat. Rev. Clin. Oncol. 2010, 7, 683–692. [Google Scholar] [CrossRef]
- Kyriakopoulou, K.; Kefali, E.; Piperigkou, Z.; Bassiony, H.; Karamanos, N.K. Advances in targeting epidermal growth factor receptor signaling pathway in mammary cancer. Cell. Signal. 2018, 51, 99–109. [Google Scholar] [CrossRef]
- Maennling, A.E.; Tur, M.K.; Niebert, M.; Klockenbring, T.; Zeppernick, F.; Gattenlöhner, S.; Meinhold-Heerlein, I.; Hussain, A.F. Molecular Targeting Therapy against EGFR Family in Breast Cancer: Progress and Future Potentials. Cancers 2019, 11, 1826. [Google Scholar] [CrossRef] [Green Version]
- Masuda, H.; Zhang, D.; Bartholomeusz, C.; Doihara, H.; Hortobagyi, G.N.; Ueno, N.T. Role of epidermal growth factor receptor in breast cancer. Breast Cancer Res. Treat. 2012, 136, 331–345. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Foley, J.; Nickerson, N.K.; Nam, S.; Allen, K.T.; Gilmore, J.L.; Nephew, K.P.; Ii, D.J.R. EGFR signaling in breast cancer: Bad to the bone. Semin. Cell Dev. Biol. 2010, 21, 951–960. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dongre, A.; Weinberg, R.A. New insights into the mechanisms of epithelial–mesenchymal transition and implications for cancer. Nat. Rev. Mol. Cell Biol. 2018, 20, 69–84. [Google Scholar] [CrossRef] [PubMed]
- Ye, X.; Weinberg, R.A. Epithelial–Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 2015, 25, 675–686. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Theocharis, A.D.; Skandalis, S.S.; Gialeli, C.; Karamanos, N.K. Extracellular matrix structure. Adv. Drug Deliv. Rev. 2016, 97, 4–27. [Google Scholar] [CrossRef]
- Duffy, M.J.; Maguire, T.M.; Hill, A.; McDermott, E.; O’Higgins, N. Metalloproteinases: Role in breast carcinogenesis, invasion and metastasis. Breast Cancer Res. 2000, 2, 252–257. [Google Scholar] [CrossRef] [Green Version]
- Insua-Rodríguez, J.; Oskarsson, T. The extracellular matrix in breast cancer. Adv. Drug Deliv. Rev. 2016, 97, 41–55. [Google Scholar] [CrossRef]
- Radisky, E.S. Matrix metalloproteinases as drivers and therapeutic targets in breast cancer. Front. Biosci. 2015, 20, 1144–1163. [Google Scholar] [CrossRef]
- Theocharis, A.D.; Karamanos, N.K. Proteoglycans remodeling in cancer: Underlying molecular mechanisms. Matrix Biol. 2019, 75–76, 220–259. [Google Scholar] [CrossRef]
- Witz, I.P. Tumor–Microenvironment Interactions: Dangerous Liaisons. Adv. Cancer Res. 2008, 100, 203–229. [Google Scholar] [CrossRef]
- Paz, H.; Pathak, N.; Yang, J. Invading one step at a time: The role of invadopodia in tumor metastasis. Oncogene 2013, 33, 4193–4202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eddy, R.J.; Weidmann, M.D.; Sharma, V.P.; Condeelis, J.S. Tumor Cell Invadopodia: Invasive Protrusions that Orchestrate Metastasis. Trends Cell Biol. 2017, 27, 595–607. [Google Scholar] [CrossRef] [PubMed]
- Alblazi, K.M.O.; Siar, C.H. Cellular protrusions--lamellipodia, filopodia, invadopodia and podosomes--and their roles in progression of orofacial tumours: Current understanding. Asian Pac. J. Cancer Prev. 2015, 16, 2187–2191. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jacquemet, G.; Hamidi, H.; Ivaska, J. Filopodia in cell adhesion, 3D migration and cancer cell invasion. Curr. Opin. Cell Biol. 2015, 36, 23–31. [Google Scholar] [CrossRef] [Green Version]
- Suraneni, P.; Rubinstein, B.; Unruh, J.R.; Durnin, M.; Hanein, D.; Li, R. The Arp2/3 complex is required for lamellipodia extension and directional fibroblast cell migration. J. Cell Biol. 2012, 197, 239–251. [Google Scholar] [CrossRef] [Green Version]
- Mattila, P.K.; Lappalainen, P. Filopodia: Molecular architecture and cellular functions. Nat. Rev. Mol. Cell Biol. 2008, 9, 446–454. [Google Scholar] [CrossRef]
- Arjonen, A.; Kaukonen, R.; Ivaska, J. Filopodia and adhesion in cancer cell motility. Cell Adhes. Migr. 2011, 5, 421–430. [Google Scholar] [CrossRef] [Green Version]
- Mittal, R.; Karhu, E.; Wang, J.-S.; Delgado, S.; Zukerman, R.; Mittal, J.; Jhaveri, V.M. Cell communication by tunneling nanotubes: Implications in disease and therapeutic applications. J. Cell. Physiol. 2018, 234, 1130–1146. [Google Scholar] [CrossRef]
- Karamanou, K.; Franchi, M.; Vynios, D.; Brézillon, S. Epithelial-to-mesenchymal transition and invadopodia markers in breast cancer: Lumican a key regulator. Semin. Cancer Biol. 2020, 62, 125–133. [Google Scholar] [CrossRef]
- Franchi, M.; Masola, V.; Bellin, G.; Onisto, M.; Karamanos, K.-A.; Piperigkou, Z. Collagen Fiber Array of Peritumoral Stroma Influences Epithelial-to-Mesenchymal Transition and Invasive Potential of Mammary Cancer Cells. J. Clin. Med. 2019, 8, 213. [Google Scholar] [CrossRef] [Green Version]
- Sahu, P.; Jena, S.R.; Samanta, L. Tunneling Nanotubes: A Versatile Target for Cancer Therapy. Curr. Cancer Drug Targets 2018, 18, 514–521. [Google Scholar] [CrossRef] [PubMed]
- Karamanos, N.K.; Theocharis, A.D.; Neill, T.; Iozzo, R.V. Matrix modeling and remodeling: A biological interplay regulating tissue homeostasis and diseases. Matrix Biol. 2019, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Chowdhury, S.R.; Busra, M.F.M.; Lokanathan, Y.; Ng, M.H.; Law, J.X.; Cletus, U.C.; Idrus, R.B.H. Collagen Type I: A Versatile Biomaterial. Adv. Exp. Med. Biol. 2018, 389–414. [Google Scholar] [CrossRef]
- Karamanos, N.K.; Piperigkou, Z.; Theocharis, A.D.; Watanabe, H.; Franchi, M.; Baud, S.; Brézillon, S.; Götte, M.; Passi, A.; Vigetti, D.; et al. Proteoglycan Chemical Diversity Drives Multifunctional Cell Regulation and Therapeutics. Chem. Rev. 2018, 118, 9152–9232. [Google Scholar] [CrossRef]
- Multhaupt, H.A.; Leitinger, B.; Gullberg, D.; Couchman, J.R. Extracellular matrix component signaling in cancer. Adv. Drug Deliv. Rev. 2016, 97, 28–40. [Google Scholar] [CrossRef] [Green Version]
- Piperigkou, Z.; Bouris, P.; Onisto, M.; Franchi, M.; Kletsas, D.; Theocharis, A.D.; Karamanos, N.K. Estrogen receptor beta modulates breast cancer cells functional properties, signaling and expression of matrix molecules. Matrix Biol. 2016, 56, 4–23. [Google Scholar] [CrossRef]
- Franchi, M.; Piperigkou, Z.; Riti, E.; Masola, V.; Onisto, M.; Karamanos, N.K. Long filopodia and tunneling nanotubes define new phenotypes of breast cancer cells in 3D cultures. Matrix Biol. Plus. 2020, 100026. [Google Scholar] [CrossRef]
- De Wever, O.; Hendrix, A.; De Boeck, A.; Westbroek, W.; Braems, G.; Emami, S.; Sabbah, M.; Gespach, C.; Bracke, M. Modeling and quantification of cancer cell invasion through collagen type I matrices. Int. J. Dev. Biol. 2010, 54, 887–896. [Google Scholar] [CrossRef]
- Chen, J.; Han, Q.; Pei, D. EMT and MET as paradigms for cell fate switching. J. Mol. Cell Biol. 2011, 4, 66–69. [Google Scholar] [CrossRef] [Green Version]
- Mobley, J.L.; Shimizu, Y. Measurement of Cellular Adhesion Under Static Conditions. Curr. Protoc. Immunol. 2000, 37, 37. [Google Scholar] [CrossRef]
- Bourd-Boittin, K.; Fridman, R.; Fanchon, S.; Septier, M.; Goldberg, M.; Menashi, S. Matrix metalloproteinase inhibition impairs the processing, formation and mineralization of dental tissues during mouse molar development. Exp. Cell Res. 2005, 304, 493–505. [Google Scholar] [CrossRef] [PubMed]
- Theocharis, A.D.; Manou, D.; Karamanos, N.K. The extracellular matrix as a multitasking player in disease. FEBS J. 2019, 286, 2830–2869. [Google Scholar] [CrossRef] [Green Version]
- Piperigkou, Z.; Manou, D.; Karamanou, K.; Theocharis, A.D. Strategies to Target Matrix Metalloproteinases as Therapeutic Approach in Cancer. Adv. Struct. Saf. Stud. 2018, 325–348. [Google Scholar] [CrossRef]
- Heerboth, S.; Housman, G.; Leary, M.; Longacre, M.; Byler, S.; Lapinska, K.; Willbanks, A.; Sarkar, S. EMT and tumor metastasis. Clin. Transl. Med. 2015, 4, 6. [Google Scholar] [CrossRef] [PubMed]
- Aiello, N.M.; Kang, Y. Context-dependent EMT programs in cancer metastasis. J. Exp. Med. 2019, 216, 1016–1026. [Google Scholar] [CrossRef] [Green Version]
- Huang, R.Y.-J.; Wong, M.K.; Tan, T.Z.; Kuay, K.T.; Ng, A.H.C.; Chung, V.Y.; Chu, Y.-S.; Matsumura, N.; Lai, H.-C.; Lee, Y.F.; et al. An EMT spectrum defines an anoikis-resistant and spheroidogenic intermediate mesenchymal state that is sensitive to e-cadherin restoration by a src-kinase inhibitor, saracatinib (AZD0530). Cell Death Dis. 2013, 4, e915. [Google Scholar] [CrossRef]
- Strauss, R.; Li, Z.-Y.; Liu, Y.; Beyer, I.; Persson, J.; Sova, P.; Moller, T.; Pesonen, S.; Hemminki, A.; Hamerlik, P.; et al. Analysis of Epithelial and Mesenchymal Markers in Ovarian Cancer Reveals Phenotypic Heterogeneity and Plasticity. PLoS ONE 2011, 6, e16186. [Google Scholar] [CrossRef]
- Schliekelman, M.J.; Taguchi, A.; Zhu, J.; Dai, X.; Rodriguez, J.; Celiktas, M.; Zhang, Q.; Chin, A.; Wong, C.-H.; Wang, H.; et al. Molecular portraits of epithelial, mesenchymal, and hybrid States in lung adenocarcinoma and their relevance to survival. Cancer Res. 2015, 75, 1789–1800. [Google Scholar] [CrossRef] [Green Version]
- Thiery, J.P.; Acloque, H.; Huang, R.Y.; Nieto, A.M. Epithelial-Mesenchymal Transitions in Development and Disease. Cell 2009, 139, 871–890. [Google Scholar] [CrossRef]
- Brabletz, S. To differentiate or not — routes towards metastasis. Nat. Rev. Cancer 2012, 12, 425–436. [Google Scholar] [CrossRef]
- Pastushenko, I.; Blanpain, C. EMT Transition States during Tumor Progression and Metastasis. Trends Cell Biol. 2019, 29, 212–226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ren, F.; Tang, R.; Zhang, D.; Madushi, W.M.; Luo, D.; Dang, Y.; Li, Z.; Wei, K.; Chen, G. Overexpression of MMP Family Members Functions as Prognostic Biomarker for Breast Cancer Patients: A Systematic Review and Meta-Analysis. PLoS ONE 2015, 10, e0135544. [Google Scholar] [CrossRef] [PubMed]
- Piperigkou, Z.; Karamanos, N.K. Estrogen receptor-mediated targeting of the extracellular matrix network in cancer. Semin. Cancer Biol. 2020, 62, 116–124. [Google Scholar] [CrossRef] [PubMed]
- Linnemann, J.R.; Meixner, L.K.; Miura, H.; Scheel, C.H. An Organotypic 3D Assay for Primary Human Mammary Epithelial Cells that Recapitulates Branching Morphogenesis. Hum. Respir. Syncytial Virus. 2017, 1612, 125–137. [Google Scholar] [CrossRef] [Green Version]
- Luparello, C. Aspects of Collagen Changes in Breast Cancer. J. Carcinog. Mutagen. 2013, S13. [Google Scholar] [CrossRef] [Green Version]
- Rijal, G.; Li, W. 3D scaffolds in breast cancer research. Biomaterials 2016, 81, 135–156. [Google Scholar] [CrossRef]
- Ravi, M.; Paramesh, V.; Kaviya, S.; Anuradha, E.; Solomon, F.P. 3D Cell Culture Systems: Advantages and Applications. J. Cell. Physiol. 2014, 230, 16–26. [Google Scholar] [CrossRef]
- Hubbard, B.; Buczek-Thomas, J.A.; Nugent, M.A.; Smith, M.L. Fibronectin Fiber Extension Decreases Cell Spreading and Migration. J. Cell. Physiol. 2015, 231, 1728–1736. [Google Scholar] [CrossRef]
- Conklin, M.W.; Eickhoff, J.C.; Riching, K.M.; Pehlke, C.A.; Eliceiri, K.W.; Provenzano, P.P.; Friedl, A.; Keely, P. Aligned Collagen Is a Prognostic Signature for Survival in Human Breast Carcinoma. Am. J. Pathol. 2011, 178, 1221–1232. [Google Scholar] [CrossRef]
- Eliceiri, K.W.; Conklin, M.W.; Bredfeldt, J.S.; Mackie, T.R.; Liu, Y.; Keely, P.J. Automated quantification of aligned collagen for human breast carcinoma prognosis. J. Pathol. Inform. 2014, 5, 28. [Google Scholar] [CrossRef]
- Provenzano, P.P.; Inman, D.R.; Eliceiri, K.W.; Knittel, J.G.; Yan, L.; Rueden, C.T.; White, J.; Keely, P. Collagen density promotes mammary tumor initiation and progression. BMC Med. 2008, 6, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Winograd-Katz, S.E.; Fässler, R.; Geiger, B.; Legate, K.R. The integrin adhesome: From genes and proteins to human disease. Nat. Rev. Mol. Cell Biol. 2014, 15, 273–288. [Google Scholar] [CrossRef] [PubMed]
- Ramage, L. Integrins and extracellular matrix in mechanotransduction. Cell Health Cytoskelet. 2011, 1. [Google Scholar] [CrossRef] [Green Version]
- Danen, E.H.J.; Sonneveld, P.; Brakebusch, C.; Fässler, R.; Sonnenberg, A. The fibronectin-binding integrins α5β1 and αvβ3 differentially modulate RhoA–GTP loading, organization of cell matrix adhesions, and fibronectin fibrillogenesis. J. Cell Biol. 2002, 159, 1071–1086. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kapp, T.G.; Rechenmacher, F.; Neubauer, S.; Maltsev, O.V.; Cavalcanti-Adam, E.A.; Zarka, R.; Reuning, U.; Notni, J.; Wester, H.-J.; Mas-Moruno, C.; et al. A Comprehensive Evaluation of the Activity and Selectivity Profile of Ligands for RGD-binding Integrins. Sci. Rep. 2017, 7, 39805. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schiller, H.B.; Hermann, M.-R.; Polleux, J.; Vignaud, T.; Zanivan, S.; Friedel, C.C.; Sun, Z.; Raducanu, A.; Gottschalk, K.-E.; Théry, M.; et al. β1- and αv-class integrins cooperate to regulate myosin II during rigidity sensing of fibronectin-based microenvironments. Nat. Cell Biol. 2013, 15, 625–636. [Google Scholar] [CrossRef] [PubMed]
- Franchi, M.; Piperigkou, Z.; Karamanos, K.-A.; Franchi, L.; Masola, V. Extracellular Matrix-Mediated Breast Cancer Cells Morphological Alterations, Invasiveness, and Microvesicles/Exosomes Release. Cells 2020, 9, 2031. [Google Scholar] [CrossRef]
- Bharadwaj, M.; Strohmeyer, N.; Colo, G.P.; Helenius, J.; Beerenwinkel, N.; Schiller, H.B.; Fässler, R.; Müller, D.J. αV-class integrins exert dual roles on α5β1 integrins to strengthen adhesion to fibronectin. Nat. Commun. 2017, 8, 14348. [Google Scholar] [CrossRef]
- Strohmeyer, N.; Bharadwaj, M.; Costell, M.; Fässler, R.; Müller, D.J. Fibronectin-bound α5β1 integrins sense load and signal to reinforce adhesion in less than a second. Nat. Mater. 2017, 16, 1262–1270. [Google Scholar] [CrossRef]
- Kechagia, J.Z.; Ivaska, J.; Roca-Cusachs, P. Integrins as biomechanical sensors of the microenvironment. Nat. Rev. Mol. Cell Biol. 2019, 20, 457–473. [Google Scholar] [CrossRef]
- Doyle, A.D.; Yamada, K.M. Mechanosensing via cell-matrix adhesions in 3D microenvironments. Exp. Cell Res. 2016, 343, 60–66. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Acerbi, I.; Cassereau, L.; Dean, I.; Shi, Q.; Au, A.; Park, C.; Chen, Y.Y.; Liphardt, J.; Hwang, E.S.; Weaver, V.M. Human breast cancer invasion and aggression correlates with ECM stiffening and immune cell infiltration. Integr. Biol. 2015, 7, 1120–1134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barcus, C.; Keely, P.J.; Eliceiri, K.W.; Schuler, L.A. Stiff Collagen Matrices Increase Tumorigenic Prolactin Signaling in Breast Cancer Cells. J. Biol. Chem. 2013, 288, 12722–12732. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heusermann, W.; Hean, J.; Trojer, D.; Steib, E.; Von Bueren, S.; Graff-Meyer, A.; Genoud, C.; Martin, K.; Pizzato, N.; Voshol, J.; et al. Exosomes surf on filopodia to enter cells at endocytic hot spots, traffic within endosomes, and are targeted to the ER. J. Cell Biol. 2016, 213, 173–184. [Google Scholar] [CrossRef]
- Ariazi, J.; Benowitz, A.; De Biasi, V.; Boer, M.L.D.; Cherqui, S.; Cui, H.; Douillet, N.; Eugenin, E.A.; Favre, D.; Goodman, S.; et al. Tunneling Nanotubes and Gap Junctions–Their Role in Long-Range Intercellular Communication during Development, Health, and Disease Conditions. Front. Mol. Neurosci. 2017, 10, 333. [Google Scholar] [CrossRef]
- Thayanithy, V.; Dickson, E.L.; Steer, C.; Subramanian, S.; Lou, E. Tumor-stromal cross talk: Direct cell-to-cell transfer of oncogenic microRNAs via tunneling nanotubes. Transl. Res. 2014, 164, 359–365. [Google Scholar] [CrossRef] [Green Version]
- Desir, S.; Wong, P.; Turbyville, T.; Chen, D.; Shetty, M.; Clark, C.; Zhai, E.; Romin, Y.; Manova, K.; Starr, T.K.; et al. Intercellular Transfer of Oncogenic KRAS via Tunneling Nanotubes Introduces Intracellular Mutational Heterogeneity in Colon Cancer Cells. Cancers 2019, 11, 892. [Google Scholar] [CrossRef] [Green Version]
- Pasquier, J.; Guerrouahen, B.S.; Althawadi, H.; Ghiabi, P.; Maleki, M.; Abu-Kaoud, N.; Jacob, A.; Mirshahi, M.; Galas, L.; Rafii, S.; et al. Preferential transfer of mitochondria from endothelial to cancer cells through tunneling nanotubes modulates chemoresistance. J. Transl. Med. 2013, 11, 94. [Google Scholar] [CrossRef] [Green Version]
Gene | Primer Sequence (5′-3′) | Tannealing (°C) | |
---|---|---|---|
MMP7 | F | GCTGGCTCATGCCTTTGC | 60 |
R | TCCTCATCGAAGTGAGCATCTC | ||
MT1-MMP | F | CATGGGCAGCGATGAAGTCT | 60 |
R | CCAGTATTTGTTCCCCTTGTAGAAGTA | ||
ACTB | F | TCAAGATCATTGCTCCTCCTGAG | 60 |
R | ACATCTGCTGGAAGGTGGACA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kyriakopoulou, K.; Riti, E.; Piperigkou, Z.; Koutroumanou Sarri, K.; Bassiony, H.; Franchi, M.; Karamanos, N.K. ΕGFR/ERβ-Mediated Cell Morphology and Invasion Capacity Are Associated with Matrix Culture Substrates in Breast Cancer. Cells 2020, 9, 2256. https://doi.org/10.3390/cells9102256
Kyriakopoulou K, Riti E, Piperigkou Z, Koutroumanou Sarri K, Bassiony H, Franchi M, Karamanos NK. ΕGFR/ERβ-Mediated Cell Morphology and Invasion Capacity Are Associated with Matrix Culture Substrates in Breast Cancer. Cells. 2020; 9(10):2256. https://doi.org/10.3390/cells9102256
Chicago/Turabian StyleKyriakopoulou, Konstantina, Eirini Riti, Zoi Piperigkou, Konstantina Koutroumanou Sarri, Heba Bassiony, Marco Franchi, and Nikos K. Karamanos. 2020. "ΕGFR/ERβ-Mediated Cell Morphology and Invasion Capacity Are Associated with Matrix Culture Substrates in Breast Cancer" Cells 9, no. 10: 2256. https://doi.org/10.3390/cells9102256