Development of 14 Microsatellite Markers for Zoonotic Tapeworm Dibothriocephalus dendriticus (Cestoda: Diphyllobothriidea)
Abstract
:1. Introduction
2. Material and Methods
2.1. Sample Collection and Molecular Genotyping
2.2. Next-Generation Sequencing (NGS) Analysis by the GenoScreen
2.3. PCR Amplification and Sequencing
2.4. Fragment Analysis and Population Genetic Statistics
3. Results
3.1. NGS Analysis
3.2. Validation of Microsatellite Candidates
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Waeschenbach, A.; Brabec, J.; Scholz, T.; Littlewood, D.T.J.; Kuchta, R. The catholic taste of broad tapeworms–multiple routes to human infection. Int. J. Parasitol. 2017, 47, 831–843. [Google Scholar] [CrossRef] [PubMed]
- Kuchta, R.; Brabec, J.; Kubáčková, P.; Scholz, T. Tapeworm Diphyllobothrium dendriticum (Cestoda)-neglected or emerging human parasite? PLoS Negl. Trop. Dis. 2013, 7, e2535. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gibson, D.I.; Bray, R.A.; Harris, E.A. Host-Parasite Database of the Natural History Museum, London. 2005. Available online: http://www.nhm.ac.uk/research-curation/scientific-resources/taxonomy-systematics/host-parasites/index.html (accessed on 1 July 2013).
- Ross, P.; Olpinski, S.; Curtis, M. Relationships between dietary practice and parasite zoonozes in Northern Québec Inuit communities. Études Inuit Stud. 1989, 13, 33–47. [Google Scholar]
- Andersen, K.; Ching, H.L.; Vik, R. A review of freshwater species of Diphyllobothrium with re-descriptions and the distribution of D. dentriticum (Nitzsch, 1824) and D. ditremum (Creplin, 1825) from North America. Can. J. Zool. 1987, 65, 2216–2228. [Google Scholar] [CrossRef]
- Catalano, S.; Lejeune, M.; Tizzani, P.; Verocai, G.G.; Schwantje, H.; Nelson, C.; Duignan, P.J. Helminths of grizzly bears (Ursus arctos) and American black bears (Ursus americanus) in Alberta and British Columbia, Canada. Can. J. Zool. 2015, 93, 765–772. [Google Scholar] [CrossRef]
- Kapel, C.M.O.; Nansen, P. Gastrointestinal helminths of arctic foxes (Alopex lagopus) from different bioclimatological regions in Greenland. J. Parasitol. 1996, 82, 17–24. [Google Scholar] [CrossRef]
- Skírnisson, K.; Eydal, M.; Gunnarsson, E.; Hersteinsson, P. Parasites of the arctic fox (Alopex lagopus) in Iceland. J. Wildl. Dis. 1993, 29, 440–446. [Google Scholar] [CrossRef]
- Wooten, R. The metazoan parasite-fauna of fish from Hanningfield Reservoir, Essex in relation to features of the habitat and host populations. J. Zool. 1973, 171, 323–331. [Google Scholar] [CrossRef]
- Dorucu, M.; Crompton, D.W.; Huntingford, F.A.; Walters, D.E. The ecology of endoparasitic helminth infections of brown trout (Salmo trutta) and rainbow trout (Oncorhynchus mykiss) in Scotland. Folia Parasitol. 1995, 42, 29–35. [Google Scholar]
- Kuklina, M.M.; Kuklin, V.V. Diphylobothrium dendriticum (Cestoda: Diphyllobothriidae) in intestinal tract of the herring gull Larus argentatus: Localization and trophic parameters. Biol. Bull. 2016, 43, 329–334. [Google Scholar] [CrossRef]
- Valtonen, E.T.; Pulkkinen, K.; Poulin, R.; Julkunen, M. The structure of parasite component communities in brackish water fishes of the northeastern Baltic Sea. Parasitology 2001, 122, 471–481. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuhn, J.A.; Kristoffersen, R.; Knudsen, R.; Jakobsen, J.; Marcogliese, D.J.; Locke, S.A.; Primicerio, R.; Amundsen, P.A. Parasite communities of two three-spined stickleback populations in subarctic Norway-effects of small spatial-scale host introduction. Parasitol. Res. 2015, 114, 1327–1339. [Google Scholar] [CrossRef] [Green Version]
- Kuhn, J.A.; Frainer, A.; Knudsen, R.; Kristoffersen, R.; Amundsen, P.A. Effects of fish species composition on Diphyllobothrium spp. infections in brown trout-is three-spined stickleback a key species? J. Fish Dis. 2016, 39, 1313–1323. [Google Scholar] [CrossRef]
- Henricson, J. The dynamics of infection of Diphyllobothrium dendriticum (Nitsch) and D. ditremum (Creplin) in the char Salvelinus alpinus (L.) in Sweden. J. Fish Biol. 1978, 13, 51–71. [Google Scholar] [CrossRef]
- Schlötterer, C. The evolution of molecular markers–just a matter of fashion? Nat. Rev. Genet. 2004, 5, 63–69. [Google Scholar] [CrossRef] [PubMed]
- Bazsalovicsová, E.; Koleničová, A.; Králová-Hromadová, I.; Minárik, G.; Šoltys, K.; Kuchta, R.; Štefka, J. Development of microsatellite loci in zoonotic tapeworm Dibothriocephalus latus (Linnaeus, 1758), Lühe, 1899 (syn. Diphyllobothrium latum) using microsatellite library screening. Mol. Biochem. Parasitol. 2018, 225, 1–3. [Google Scholar] [PubMed]
- Wicht, B.; Yanagida, T.; Scholz, T.; Ito, A.; Jiménez, J.A.; Brabec, J. Multiplex PCR for differential identification of broad tapeworms (Cestoda: Diphyllobothrium) infecting humans. J. Clinic. Microbiol. 2010, 48, 3111–3116. [Google Scholar] [CrossRef] [Green Version]
- Meglécz, E.; Costedoat, C.; Dubut, V.; Gilles, A.; Malausa, T.; Pech, N.; Martin, J.F. QDD: A user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics 2010, 26, 403–404. [Google Scholar] [CrossRef] [Green Version]
- Peakall, R.; Smouse, P.E. GenAIEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Green Version]
- Radačovská, A.; Bazsalovicsová, E.; Blasco Costa, I.; Orosová, M.; Gustinelli, A.; Králová-Hromadová, I. Occurrence of Dibothriocephalus latus in European perch from Alpine lakes, an important focus of diphyllobothriosis in Europe. Rev. Suisse Zool. 2019, 126, 219–225. [Google Scholar]
- Moks, E.; Jõgisalu, I.; Saarma, U.; Talvik, H.; Järvis, T.; Valdmann, H. Helminthologic survey of the wolf (Canis lupus) in Estonia, with an emphasis on Echinococcus granulosus. J. Wildl. Dis. 2006, 42, 359–365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stanciu, C.; Trifan, A.; Singeap, A.; Sfarti, C.; Cojocariu, C.; Luca, M. Diphyllobothrium latum identified by capsule endoscopy-an unusual cause of iron-deficiency anaemia. J. Gastrointestin. Liver. Dis. 2009, 18, 142. [Google Scholar] [PubMed]
- Králová-Hromadová, I.; Bazsalovicsová, E.; Institute of Parasitology, Slovak Academy of Sciences, Košice, Slovakia; Skírnisson, K.; Institute for Experimental Pathology, University of Iceland, Reykjavík, Iceland. Unpublished Data, 2020.
- Hickey, M.D.; Harris, J.R. Progress of the Diphyllobothrium epizootic at Poulaphouca Reservoir, Co. Wicklow, Ireland. J. Helminthol. 1947, 22, 13–28. [Google Scholar] [CrossRef] [PubMed]
Methodology | Purpose of the Method | No. T | No. S | Origin and Number of Dd Specimens Involved in the Analysis |
---|---|---|---|---|
Microsatellite library screening | Identification of candidate microsatellite loci | - | 128 | Norway; Lake Takvatn; brown trout Salmo trutta; 11 specimens |
PCR amplification | Validation of amplification effectiveness of designed primers | 128 | 126 | Norway; Lake Takvatn; brown trout S. trutta; 3 specimens |
Sanger sequencing | Confirmation of a presence of declared repetitive motifs | 126 | 92 | PCR products obtained after PCR amplification were sequenced |
Fragment analysis | Primary testing of heterozygosity of candidate loci | 40 | 17 | Norway; Lake Kalandsvatn; brown trout S. trutta; 8 specimens |
Statistical tests | Heterozygosity tests and calculation of HW equilibrium | 17 | 14 | Norway; Lake Takvatn; brown trout S. trutta; 6 specimens |
Norway; Lake Kalandsvatn; brown trout S. trutta; 6 specimens | ||||
Iceland; Lake Hafravatn; brown trout S. trutta; 6 specimens | ||||
Iceland; Lake Þingvallavatn; Arctic charr Salvelinus alpinus; 6 specimens |
Locus | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) | Repeat Motif | PCR Product Size (bp) a | Number of Alleles b |
---|---|---|---|---|---|
Dd_2 | CCGACAACAACGCTCTAATCC | TGCCATTCAGCAAGGTGGAA | (act)n | ~210 | 19 |
Dd_17 | ACGCTACTGCATAGATCGAGG | GCATAACGCGCCAGAAACAA | (ac)n | ~240 | 5 |
Dd_23 | CACACGCAGAAGTCTAGTTGAC | TGTTAGCTTACTTCCGTGGCT | (ac)n | ~140 | 5 |
Dd_25 | GTTATCCTACGTTGGGCTCCT | ATCTGGTTGGGAGAAACAACT | (ac)n | ~90 | 3 |
Dd_33 | TGTTTGCTCCAGTGCCTCG | CTAGCAGCATCAGCAGTGGA | (acgc)n | ~270 | 6 |
Dd_38 | ACTATCACGATGCGCTGACA | ATCCTTTGTTCCCTGAGCAG | (ag)n | ~250 | 5 |
Dd_43 | CAGTCTTTCCGGGTGAAGCT | GGTAGCTGCAGTACCGATCA | (aat)n | ~210 | 8 |
Dd_47 | ACTTCGGATTACTTCATTAACTCAGT | TGGTGAACGAAGTCAAACTATGC | (agg)n | ~190 | 10 |
Dd_49 | ACGTCTGACGACAACTTGGG | AAGACCCTGGCCAATACACG | (at)n | ~190 | 6 |
Dd_57 | AACATGCGAGTCCCAGGAAG | AGCAACGATCTACCGTAAAGCA | (aag)n | ~120 | 8 |
Dd_78 | GCTTTCGGCCATTTGTGGTC | GGGACAATAGGCAGGGTCTG | (ag)n | ~270 | 4 |
Dd_84 | AGAGGTAATTCATCGAGTTCTCTGA | TGACTGTGTACATCCGGTCG | (agg)n | ~240 | 6 |
Dd_95 | CGTTCACGCTCCAATGATCC | AGAGCTTGCTGATGATGGCT | (ag)n | ~190 | 3 |
Dd_114 | ACTTCAGGTAATCTCCGTGTCC | CTAGCGCCAATGGGTAGCTT | (aaat)n | ~130 | 5 |
D. dendriticus Population | Locus | Na | Ne | Ho | He | uHe | DF | Signif. |
---|---|---|---|---|---|---|---|---|
Iceland | DD_2 | 8 | 6.00 | 1.00 | 0.83 | 0.91 | 28 | * |
Lake Hafravatn | DD_17 | 3 | 1.67 | 0.50 | 0.40 | 0.44 | 3 | ns |
(IS-HA) | DD_23 | 3 | 2.67 | 0.17 | 0.63 | 0.68 | 3 | * |
DD_25 | 2 | 1.60 | 0.50 | 0.38 | 0.41 | 1 | ns | |
DD_33 | 3 | 2.88 | 0.50 | 0.65 | 0.71 | 3 | * | |
DD_38 | 1 | 1.00 | 0.00 | 0.00 | 0.00 | x | x | |
DD_43 | 3 | 2.88 | 0.50 | 0.65 | 0.71 | 3 | * | |
DD_47 | 5 | 3.79 | 0.67 | 0.74 | 0.80 | 10 | ns | |
DD_49 | 4 | 3.27 | 0.67 | 0.69 | 0.76 | 6 | ns | |
DD_57 | 3 | 2.32 | 0.33 | 0.57 | 0.62 | 3 | ns | |
DD_78 | 4 | 2.48 | 0.50 | 0.60 | 0.65 | 6 | ns | |
DD_84 | 4 | 3.43 | 0.83 | 0.71 | 0.77 | 6 | ns | |
DD_95 | 2 | 1.47 | 0.40 | 0.32 | 0.36 | 1 | ns | |
DD_114 | 3 | 2.88 | 0.83 | 0.65 | 0.71 | 3 | ns | |
Iceland | DD_2 | 11 | 10.29 | 1.00 | 0.90 | 0.98 | 55 | ns |
Lake Þingvallavatn | DD_17 | 3 | 2.67 | 0.67 | 0.63 | 0.68 | 3 | ns |
(IS-PI) | DD_23 | 3 | 2.32 | 1.00 | 0.57 | 0.62 | 3 | ns |
DD_25 | 3 | 2.17 | 0.20 | 0.54 | 0.60 | 3 | ns | |
DD_33 | 3 | 1.67 | 0.50 | 0.40 | 0.44 | 3 | ns | |
DD_38 | 1 | 1.00 | 0.00 | 0.00 | 0.00 | x | x | |
DD_43 | 6 | 3.79 | 0.67 | 0.74 | 0.80 | 15 | ns | |
DD_47 | 6 | 4.17 | 0.80 | 0.76 | 0.84 | 15 | ns | |
DD_49 | 4 | 1.71 | 0.33 | 0.42 | 0.45 | 6 | ns | |
DD_57 | 7 | 5.54 | 0.67 | 0.82 | 0.89 | 21 | ns | |
DD_78 | 4 | 2.40 | 0.50 | 0.58 | 0.64 | 6 | ns | |
DD_84 | 5 | 4.00 | 1.00 | 0.75 | 0.82 | 10 | ns | |
DD_95 | 2 | 1.60 | 0.17 | 0.38 | 0.41 | 1 | ns | |
DD_114 | 3 | 2.67 | 0.83 | 0.63 | 0.68 | 3 | ns | |
Norway | DD_2 | 5 | 4.50 | 1.00 | 0.78 | 0.85 | 10 | ns |
Lake Kalandsvatn | DD_17 | 4 | 3.79 | 0.83 | 0.74 | 0.80 | 6 | ns |
(NO-KA) | DD_23 | 3 | 2.18 | 0.67 | 0.54 | 0.59 | 3 | ns |
DD_25 | 2 | 1.80 | 0.67 | 0.44 | 0.48 | 1 | ns | |
DD_33 | 3 | 1.95 | 0.67 | 0.49 | 0.53 | 3 | ns | |
DD_38 | 4 | 4.00 | 1.00 | 0.75 | 0.82 | 6 | ** | |
DD_43 | 4 | 3.43 | 0.67 | 0.71 | 0.77 | 6 | ns | |
DD_47 | 5 | 3.79 | 0.83 | 0.74 | 0.80 | 10 | ns | |
DD_49 | 3 | 2.67 | 0.83 | 0.63 | 0.68 | 3 | ns | |
DD_57 | 4 | 3.27 | 1.00 | 0.69 | 0.76 | 6 | ns | |
DD_78 | 3 | 2.32 | 0.83 | 0.57 | 0.62 | 3 | ns | |
DD_84 | 2 | 1.18 | 0.17 | 0.15 | 0.17 | 1 | ns | |
DD_95 | 3 | 2.67 | 1.00 | 0.63 | 0.68 | 3 | ns | |
DD_114 | 3 | 2.32 | 0.83 | 0.57 | 0.62 | 3 | ns | |
Norway | DD_2 | 4 | 3.27 | 0.83 | 0.69 | 0.76 | 6 | ns |
Lake Takvatn | DD_17 | 3 | 1.85 | 0.60 | 0.46 | 0.51 | 3 | ns |
(NO-TA) | DD_23 | 3 | 3.00 | 0.83 | 0.67 | 0.73 | 3 | ns |
DD_25 | 2 | 1.80 | 0.33 | 0.44 | 0.48 | 1 | ns | |
DD_33 | 2 | 1.38 | 0.33 | 0.28 | 0.30 | 1 | ns | |
DD_38 | 3 | 2.18 | 0.83 | 0.54 | 0.59 | 3 | ns | |
DD_43 | 3 | 1.85 | 0.20 | 0.46 | 0.51 | 3 | ns | |
DD_47 | 4 | 3.13 | 1.00 | 0.68 | 0.74 | 6 | ns | |
DD_49 | 3 | 2.57 | 0.67 | 0.61 | 0.67 | 3 | ns | |
DD_57 | 3 | 2.00 | 0.67 | 0.50 | 0.55 | 3 | ns | |
DD_78 | 3 | 1.67 | 0.33 | 0.40 | 0.44 | 3 | ns | |
DD_84 | 1 | 1.00 | 0.00 | 0.00 | 0.00 | x | x | |
DD_95 | 1 | 1.00 | 0.00 | 0.00 | 0.00 | x | x | |
DD_114 | 2 | 1.60 | 0.50 | 0.38 | 0.41 | 1 | ns |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bazsalovicsová, E.; Minárik, G.; Šoltys, K.; Radačovská, A.; Kuhn, J.A.; Karlsbakk, E.; Skírnisson, K.; Králová-Hromadová, I. Development of 14 Microsatellite Markers for Zoonotic Tapeworm Dibothriocephalus dendriticus (Cestoda: Diphyllobothriidea). Genes 2020, 11, 782. https://doi.org/10.3390/genes11070782
Bazsalovicsová E, Minárik G, Šoltys K, Radačovská A, Kuhn JA, Karlsbakk E, Skírnisson K, Králová-Hromadová I. Development of 14 Microsatellite Markers for Zoonotic Tapeworm Dibothriocephalus dendriticus (Cestoda: Diphyllobothriidea). Genes. 2020; 11(7):782. https://doi.org/10.3390/genes11070782
Chicago/Turabian StyleBazsalovicsová, Eva, Gabriel Minárik, Katarína Šoltys, Alžbeta Radačovská, Jesper A. Kuhn, Egil Karlsbakk, Karl Skírnisson, and Ivica Králová-Hromadová. 2020. "Development of 14 Microsatellite Markers for Zoonotic Tapeworm Dibothriocephalus dendriticus (Cestoda: Diphyllobothriidea)" Genes 11, no. 7: 782. https://doi.org/10.3390/genes11070782