Current Practices for Reference Gene Selection in RT-qPCR of Aspergillus: Outlook and Recommendations for the Future
Abstract
:1. Introduction
2. Reference Genes for Gene Expression Analyses of Aspergillus
2.1. Beta-Tubulin
2.1.1. Studies That Validated Beta-Tubulin Expression Stability under the Experimental Conditions Tested
2.1.2. Studies Missing Proper Beta-Tubulin Expression Stability Validation
2.2. Actin
2.2.1. Studies Validating Actin Expression Stability under the Experimental Conditions Tested
2.2.2. Studies Missing Proper Actin Expression Stability Validation
2.3. 18S rRNA
2.3.1. Studies Validating 18S rRNA Expression Stability under the Experimental Conditions Tested
2.3.2. Studies Missing Proper 18S rRNA Expression Stability Validation
2.4. GAPDH
2.4.1. Studies That Validated GAPDH Expression Stability under the Experimental Conditions Tested
2.4.2. Studies Missing Proper GAPDH Expression Stability Validation
2.5. Others
3. Validation of Candidate Reference Genes in Aspergillus
3.1. Validation of hisH4 and cox5 for Studying Aflatoxin Biosynthesis in A. flavus
3.2. Validation of actA, sarA and cox5 for Studying glaA Expression in A. niger
3.3. Reference Genes Currently Validated for Use in Aspergillus
4. Reference Gene-Specific Google Scholar Queries
5. Concluding Remarks and Recommendations
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Anonymous. Etymologia: Aspergillus. Emerg. Infect. Dis. 2006, 12, 1. [Google Scholar] [CrossRef]
- Ashu, E.E.; Xu, J. Strengthening the One Health Agenda: The Role of Molecular Epidemiology in Aspergillus Threat Management. Genes 2018, 9, 359. [Google Scholar] [CrossRef] [Green Version]
- Bennett, J.W. An Overview of the Genus Aspergillus. In Aspergillus: Molecular Biology and Genomics; Caister Academic Press: Poole, UK, 2010; p. 17. [Google Scholar]
- Warris, A.; Verweij, P.E. Clinical implications of environmental sources for Aspergillus. Med. Mycol. 2005, 43 (Suppl. 1), S59–S65. [Google Scholar] [CrossRef] [Green Version]
- Demain, A.L.; Martens, E. Production of valuable compounds by molds and yeasts. J. Antibiot. 2017, 70, 347–360. [Google Scholar] [CrossRef] [Green Version]
- Ashu, E.; Forsythe, A.; Vogan, A.A.; Xu, J. Filamentous Fungi in Fermented Foods. In Fermented Foods: Biochemistry and Biotechnology; CRC Press: Boca Raton, FL, USA, 2015. [Google Scholar] [CrossRef]
- Caceres, I.; Khoury, A.A.; Khoury, R.E.; Lorber, S.; Oswald, I.P.; Khoury, A.E.; Atoui, A.; Puel, O.; Bailly, J.D. Aflatoxin Biosynthesis and Genetic Regulation: A Review. Toxins 2020, 12, 150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martinelli, S.D. Aspergillus nidulans as an experimental organism. Prog. Ind. Microbiol. 1994, 29, 33–58. [Google Scholar] [PubMed]
- Hong, J.S.; Ryu, K.H.; Kwon, S.J.; Kim, J.W.; Kim, K.S.; Park, K.C. Phylogenetics and Gene Structure Dynamics of Polygalacturonase Genes in Aspergillus and Neurospora crassa. Plant Pathol. J. 2013, 29, 234–241. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sugui, J.A.; Kwon-Chung, K.J.; Juvvadi, P.R.; Latge, J.P.; Steinbach, W.J. Aspergillus fumigatus and related species. Cold Spring Harb. Perspect. Med. 2014, 5, a019786. [Google Scholar] [CrossRef] [Green Version]
- Guarro, J.; Xavier, M.O.; Severo, L.C. Differences and similarities amongst pathogenic Aspergillus species. In Aspergillosis: From Diagnosis to Prevention; Alessandro, C.P., Ed.; Springer: Dordrecht, The Netherlands, 2009; p. 25. [Google Scholar]
- Bongomin, F.; Gago, S.; Oladele, R.O.; Denning, D.W. Global and Multi-National Prevalence of Fungal Diseases-Estimate Precision. J. Fungi 2017, 3, 57. [Google Scholar] [CrossRef]
- Vahedi-Shahandashti, R.; Lass-Florl, C. Novel Antifungal Agents and Their Activity against Aspergillus Species. J. Fungi 2020, 6, 213. [Google Scholar] [CrossRef]
- Misch, E.A.; Safdar, N. Updated guidelines for the diagnosis and management of aspergillosis. J. Thorac. Dis. 2016, 8, E1771–E1776. [Google Scholar] [CrossRef]
- Lestrade, P.P.; Bentvelsen, R.G.; Schauwvlieghe, A.; Schalekamp, S.; van der Velden, W.; Kuiper, E.J.; van Paassen, J.; van der Hoven, B.; van der Lee, H.A.; Melchers, W.J.G.; et al. Voriconazole Resistance and Mortality in Invasive Aspergillosis: A Multicenter Retrospective Cohort Study. Clin. Infect. Dis. 2019, 68, 1463–1471. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miao, Y.; Li, J.; Xiao, Z.; Shen, Q.; Zhang, R. Characterization and identification of the xylanolytic enzymes from Aspergillus fumigatus Z5. BMC Microbiol. 2015, 15, 126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dodd, D.; Cann, I.K. Enzymatic deconstruction of xylan for biofuel production. Glob. Chang. Biol. Bioenergy 2009, 1, 2–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huggett, J.; Dheda, K.; Bustin, S.; Zumla, A. Real-Time RT-PCR normalisation; strategies and considerations. Genes Immun. 2005, 6, 279–284. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Green Version]
- Guenin, S.; Mauriat, M.; Pelloux, J.; van Wuytswinkel, O.; Bellini, C.; Gutierrez, L. Normalization of qRT-PCR data: The necessity of adopting a systematic, experimental conditions-specific, validation of references. J. Exp. Bot. 2009, 60, 487–493. [Google Scholar] [CrossRef] [Green Version]
- Baltussen, T.J.H.; Coolen, J.P.M.; Zoll, J.; Verweij, P.E.; Melchers, W.J.G. Gene co-expression analysis identifies gene clusters associated with isotropic and polarized growth in Aspergillus fumigatus conidia. Fungal Genet. Biol. 2018, 116, 62–72. [Google Scholar] [CrossRef]
- Bruns, S.; Seidler, M.; Albrecht, D.; Salvenmoser, S.; Remme, N.; Hertweck, C.; Brakhage, A.A.; Kniemeyer, O.; Muller, F.M. Functional genomic profiling of Aspergillus fumigatus biofilm reveals enhanced production of the mycotoxin gliotoxin. Proteomics 2010, 10, 3097–3107. [Google Scholar] [CrossRef]
- Perrin, R.M.; Fedorova, N.D.; Bok, J.W.; Cramer, R.A.; Wortman, J.R.; Kim, H.S.; Nierman, W.C.; Keller, N.P. Transcriptional regulation of chemical diversity in Aspergillus fumigatus by LaeA. PLoS Pathog. 2007, 3, e030050. [Google Scholar] [CrossRef] [Green Version]
- Ge, Y.; Yu, F.; Tan, Y.; Zhang, X.; Liu, Z. Comparative Transcriptome Sequence Analysis of Sporulation-Related Genes of Aspergillus cristatus in Response to Low and High Osmolarity. Curr. Microbiol. 2017, 74, 806–814. [Google Scholar] [CrossRef]
- Wada, R.; Maruyama, J.; Yamaguchi, H.; Yamamoto, N.; Wagu, Y.; Paoletti, M.; Archer, D.B.; Dyer, P.S.; Kitamoto, K. Presence and functionality of mating type genes in the supposedly asexual filamentous fungus Aspergillus oryzae. Appl. Environ. Microbiol. 2012, 78, 2819–2829. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kojo, T.; Kadooka, C.; Komohara, M.; Onitsuka, S.; Tanimura, M.; Muroi, Y.; Kurazono, S.; Shiraishi, Y.; Oda, K.; Iwashita, K.; et al. Characterization of amylolytic enzyme overproducing mutant of Aspergillus luchuensis obtained by ion beam mutagenesis. J. Gen. Appl. Microbiol. 2018, 63, 339–346. [Google Scholar] [CrossRef] [Green Version]
- Gautam, P.; Upadhyay, S.K.; Hassan, W.; Madan, T.; Sirdeshmukh, R.; Sundaram, C.S.; Gade, W.N.; Basir, S.F.; Singh, Y.; Sarma, P.U. Transcriptomic and proteomic profile of Aspergillus fumigatus on exposure to artemisinin. Mycopathologia 2011, 172, 331–346. [Google Scholar] [CrossRef] [PubMed]
- Bai, Y.; Lan, F.; Yang, W.; Zhang, F.; Yang, K.; Li, Z.; Gao, P.; Wang, S. sRNA profiling in Aspergillus flavus reveals differentially expressed miRNA-like RNAs response to water activity and temperature. Fungal Genet. Biol. 2015, 81, 113–119. [Google Scholar] [CrossRef] [PubMed]
- Chang, P.K.; Scharfenstein, L.L.; Luo, M.; Mahoney, N.; Molyneux, R.J.; Yu, J.; Brown, R.L.; Campbell, B.C. Loss of msnA, a putative stress regulatory gene, in Aspergillus parasiticus and Aspergillus flavus increased production of conidia, aflatoxins and kojic acid. Toxins 2011, 3, 82–104. [Google Scholar] [CrossRef] [Green Version]
- Delomenie, C.; Grentzmann, G.; Oestreicher, N.; Mesnage, R.; Velot, C. Development and validation of a custom microarray for global transcriptome profiling of the fungus Aspergillus nidulans. Curr. Genet. 2016, 62, 897–910. [Google Scholar] [CrossRef] [Green Version]
- Oosthuizen, J.L.; Gomez, P.; Ruan, J.; Hackett, T.L.; Moore, M.M.; Knight, D.A.; Tebbutt, S.J. Dual organism transcriptomics of airway epithelial cells interacting with conidia of Aspergillus fumigatus. PLoS ONE 2011, 6, e020527. [Google Scholar] [CrossRef] [Green Version]
- Gerin, D.; de Miccolis Angelini, R.M.; Pollastro, S.; Faretra, F. RNA-Seq Reveals OTA-Related Gene Transcriptional Changes in Aspergillus carbonarius. PLoS ONE 2016, 11, e0147089. [Google Scholar] [CrossRef]
- Vandesompele, J.; de Preter, K.; Pattyn, F.; Poppe, B.; van Roy, N.; de Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3. [Google Scholar] [CrossRef] [Green Version]
- Wolff, P.B.; Nielsen, M.L.; Slot, J.C.; Andersen, L.N.; Petersen, L.M.; Isbrandt, T.; Holm, D.K.; Mortensen, U.H.; Nodvig, C.S.; Larsen, T.O.; et al. Acurin A, a novel hybrid compound, biosynthesized by individually translated PKS- and NRPS-encoding genes in Aspergillus aculeatus. Fungal Genet. Biol. 2020, 139, 103378. [Google Scholar] [CrossRef]
- Tani, S.; Kanamasa, S.; Sumitani, J.; Arai, M.; Kawaguchi, T. XlnR-independent signaling pathway regulates both cellulase and xylanase genes in response to cellobiose in Aspergillus aculeatus. Curr. Genet. 2012, 58, 93–104. [Google Scholar] [CrossRef]
- Crespo-Sempere, A.; Gil, J.V.; Martinez-Culebras, P.V. Proteome analysis of the fungus Aspergillus carbonarius under ochratoxin A producing conditions. Int. J. Food Microbiol. 2011, 147, 162–169. [Google Scholar] [CrossRef]
- El Khoury, R.; Choque, E.; El Khoury, A.; Snini, S.P.; Cairns, R.; Andriantsiferana, C.; Mathieu, F. OTA Prevention and Detoxification by Actinobacterial Strains and Activated Carbon Fibers: Preliminary Results. Toxins 2018, 10, 137. [Google Scholar] [CrossRef] [Green Version]
- Wyatt, T.T.; van Leeuwen, M.R.; Wosten, H.A.; Dijksterhuis, J. Mannitol is essential for the development of stress-resistant ascospores in Neosartorya fischeri (Aspergillus fischeri). Fungal Genet. Biol. 2014, 64, 11–24. [Google Scholar] [CrossRef] [Green Version]
- Duran, R.M.; Gregersen, S.; Smith, T.D.; Bhetariya, P.J.; Cary, J.W.; Harris-Coward, P.Y.; Mattison, C.P.; Grimm, C.; Calvo, A.M. The role of Aspergillus flavus veA in the production of extracellular proteins during growth on starch substrates. Appl. Microbiol. Biotechnol. 2014, 98, 5081–5094. [Google Scholar] [CrossRef]
- Liang, D.; Xing, F.; Selvaraj, J.N.; Liu, X.; Wang, L.; Hua, H.; Zhou, L.; Zhao, Y.; Wang, Y.; Liu, Y. Inhibitory Effect of Cinnamaldehyde, Citral, and Eugenol on Aflatoxin Biosynthetic Gene Expression and Aflatoxin B1 Biosynthesis in Aspergillus flavus. J. Food Sci. 2015, 80, M2917–M2924. [Google Scholar] [CrossRef]
- Lappa, I.K.; Dionysopoulou, A.M.; Paramithiotis, S.; Georgiadou, M.; Drosinos, E.H. Dual Transcriptional Profile of Aspergillus flavus during Co-Culture with Listeria monocytogenes and Aflatoxin B1 Production: A Pathogen-Pathogen Interaction. Pathogens 2019, 8, 198. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Verheecke, C.; Liboz, T.; Anson, P.; Zhu, Y.; Mathieu, F. Streptomyces-Aspergillus flavus interactions: Impact on aflatoxin B accumulation. Food Addit. Contam. Part A Chem. Anal. Control. Expo. Risk Assess. 2015, 32, 572–576. [Google Scholar] [CrossRef] [PubMed]
- Han, X.; Qiu, M.; Wang, B.; Yin, W.B.; Nie, X.; Qin, Q.; Ren, S.; Yang, K.; Zhang, F.; Zhuang, Z.; et al. Functional Analysis of the Nitrogen Metabolite Repression Regulator Gene nmrA in Aspergillus flavus. Front. Microbiol. 2016, 7, 1794. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deabes, M.M.; Khalil, W.K.B.; Attallah, A.G.; El-Desouky, T.A.; Naguib, K.M. Impact of Silver Nanoparticles on Gene Expression in Aspergillus Flavus Producer Aflatoxin B1. Open Access Maced. J. Med. Sci. 2018, 6, 600–605. [Google Scholar] [CrossRef] [Green Version]
- Yuan, J.; Chen, Z.; Guo, Z.; Li, D.; Zhang, F.; Shen, J.; Zhang, Y.; Wang, S.; Zhuang, Z. PbsB Regulates Morphogenesis, Aflatoxin B1 Biosynthesis, and Pathogenicity of Aspergillus flavus. Front. Cell Infect. Microbiol. 2018, 8, 162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mayer, Z.; Farber, P.; Geisen, R. Monitoring the production of aflatoxin B1 in wheat by measuring the concentration of nor-1 mRNA. Appl. Environ. Microbiol. 2003, 69, 1154–1158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdel-Hadi, A.; Carter, D.; Magan, N. Temporal monitoring of the nor-1 (aflD) gene of Aspergillus flavus in relation to aflatoxin B (1) production during storage of peanuts under different water activity levels. J. Appl. Microbiol. 2010, 109, 1914–1922. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jamali, M.; Karimipour, M.; Shams-Ghahfarokhi, M.; Amani, A.; Razzaghi-Abyaneh, M. Expression of aflatoxin genes aflO (omtB) and aflQ (ordA) differentiates levels of aflatoxin production by Aspergillus flavus strains from soils of pistachio orchards. Res. Microbiol. 2013, 164, 293–299. [Google Scholar] [CrossRef]
- Mahmoud, M.A. Detection of Aspergillus flavus in stored peanuts using real-time PCR and the expression of aflatoxin genes in toxigenic and atoxigenic A. flavus isolates. Foodborne Pathog. Dis. 2015, 12, 289–296. [Google Scholar] [CrossRef]
- Yin, H.B.; Chen, C.H.; Kollanoor-Johny, A.; Darre, M.J.; Venkitanarayanan, K. Controlling Aspergillus flavus and Aspergillus parasiticus growth and aflatoxin production in poultry feed using carvacrol and trans-cinnamaldehyde. Poult. Sci. 2015, 94, 2183–2190. [Google Scholar] [CrossRef] [PubMed]
- Fattahi, A.; Zaini, F.; Kordbacheh, P.; Rezaie, S.; Safara, M.; Fateh, R.; Farahyar, S.; Kanani, A.; Heidari, M. Evaluation of mRNA Expression Levels of cyp51A and mdr1, Candidate Genes for Voriconazole Resistance in Aspergillus flavus. Jundishapur J. Microbiol. 2015, 8, e26990. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caceres, I.; El Khoury, R.; Medina, A.; Lippi, Y.; Naylies, C.; Atoui, A.; El Khoury, A.; Oswald, I.P.; Bailly, J.D.; Puel, O. Deciphering the Anti-Aflatoxinogenic Properties of Eugenol Using a Large-Scale q-PCR Approach. Toxins 2016, 8, 123. [Google Scholar] [CrossRef] [Green Version]
- Baquiao, A.C.; Rodriges, A.G.; Lopes, E.L.; Tralamazza, S.M.; Zorzete, P.; Correa, B. Expression of Genes by Aflatoxigenic and Nonaflatoxigenic Strains of Aspergillus flavus Isolated from Brazil Nuts. Foodborne Pathog. Dis. 2016, 13, 434–440. [Google Scholar] [CrossRef] [PubMed]
- Caceres, I.; Snini, S.P.; Puel, O.; Mathieu, F. Streptomyces roseolus, A Promising Biocontrol Agent Against Aspergillus flavus, the Main Aflatoxin B (1) Producer. Toxins 2018, 10, 442. [Google Scholar] [CrossRef] [Green Version]
- Devi, M.S.; Sashidhar, R.B. Antiaflatoxigenic effects of selected antifungal peptides. Peptides 2019, 115, 15–26. [Google Scholar] [CrossRef]
- Zhao, Q.; Qiu, Y.; Wang, X.; Gu, Y.; Zhao, Y.; Wang, Y.; Yue, T.; Yuan, Y. Inhibitory Effects of Eurotium cristatum on Growth and Aflatoxin B1 Biosynthesis in Aspergillus flavus. Front. Microbiol. 2020, 11, 921. [Google Scholar] [CrossRef]
- Passone, M.A.; Rosso, L.C.; Etcheverry, M. Influence of sub-lethal antioxidant doses, water potential and temperature on growth, sclerotia, aflatoxins and aflD (=nor-1) expression by Aspergillus flavus RCP08108. Microbiol. Res. 2012, 167, 470–477. [Google Scholar] [CrossRef] [PubMed]
- Lang-Yona, N.; Levin, Y.; Dannemiller, K.C.; Yarden, O.; Peccia, J.; Rudich, Y. Changes in atmospheric CO2 influence the allergenicity of Aspergillus fumigatus. Glob. Chang. Biol. 2013, 19, 2381–2388. [Google Scholar] [CrossRef] [PubMed]
- Jia, X.; Zhang, X.; Hu, Y.; Hu, M.; Tian, S.; Han, X.; Sun, Y.; Han, L. Role of actin depolymerizing factor cofilin in Aspergillus fumigatus oxidative stress response and pathogenesis. Curr. Genet. 2018, 64, 619–634. [Google Scholar] [CrossRef]
- Blosser, S.J.; Cramer, R.A. SREBP-dependent triazole susceptibility in Aspergillus fumigatus is mediated through direct transcriptional regulation of erg11A (cyp51A). Antimicrob. Agents Chemother. 2012, 56, 248–257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nazemi, L.; Hashemi, S.J.; Daie Ghazvini, R.; Saeedi, M.; Khodavaisy, S.; Barac, A.; Modiri, M.; Akbari Dana, M.; Zare Shahrabadi, Z.; Rezaie, S. Investigation of cgrA and cyp51A gene alternations in Aspergillus fumigatus strains exposed to kombucha fermented tea. Curr. Med. Mycol. 2019, 5, 36–42. [Google Scholar] [CrossRef]
- Nascimento, A.M.; Goldman, G.H.; Park, S.; Marras, S.A.; Delmas, G.; Oza, U.; Lolans, K.; Dudley, M.N.; Mann, P.A.; Perlin, D.S. Multiple resistance mechanisms among Aspergillus fumigatus mutants with high-level resistance to itraconazole. Antimicrob. Agents Chemother. 2003, 47, 1719–1726. [Google Scholar] [CrossRef] [Green Version]
- Da Silva Ferreira, M.E.; Malavazi, I.; Savoldi, M.; Brakhage, A.A.; Goldman, M.H.; Kim, H.S.; Nierman, W.C.; Goldman, G.H. Transcriptome analysis of Aspergillus fumigatus exposed to voriconazole. Curr. Genet. 2006, 50, 32–44. [Google Scholar] [CrossRef]
- Power, T.; Ortoneda, M.; Morrissey, J.P.; Dobson, A.D. Differential expression of genes involved in iron metabolism in Aspergillus fumigatus. Int. Microbiol. 2006, 9, 281–287. [Google Scholar]
- Warwas, M.L.; Yeung, J.H.; Indurugalla, D.; Mooers, A.O.; Bennet, A.J.; Moore, M.M. Cloning and characterization of a sialidase from the filamentous fungus, Aspergillus fumigatus. Glycoconj. J. 2010, 27, 533–548. [Google Scholar] [CrossRef]
- Dinamarco, T.M.; Freitas, F.Z.; Almeida, R.S.; Brown, N.A.; dos Reis, T.F.; Ramalho, L.N.; Savoldi, M.; Goldman, M.H.; Bertolini, M.C.; Goldman, G.H. Functional characterization of an Aspergillus fumigatus calcium transporter (PmcA) that is essential for fungal infection. PLoS ONE 2012, 7, e37591. [Google Scholar] [CrossRef] [Green Version]
- Raggam, R.B.; Salzer, H.J.; Marth, E.; Heiling, B.; Paulitsch, A.H.; Buzina, W. Molecular detection and characterisation of fungal heat shock protein 60. Mycoses 2011, 54, e394–e399. [Google Scholar] [CrossRef] [PubMed]
- Blum, G.; Kainzner, B.; Grif, K.; Dietrich, H.; Zeiger, B.; Sonnweber, T.; Lass-Florl, C. In vitro and in vivo role of heat shock protein 90 in Amphotericin B resistance of Aspergillus terreus. Clin. Microbiol. Infect. 2013, 19, 50–55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fraczek, M.G.; Bromley, M.; Buied, A.; Moore, C.B.; Rajendran, R.; Rautemaa, R.; Ramage, G.; Denning, D.W.; Bowyer, P. The cdr1B efflux transporter is associated with non-cyp51a-mediated itraconazole resistance in Aspergillus fumigatus. J. Antimicrob. Chemother. 2013, 68, 1486–1496. [Google Scholar] [CrossRef] [PubMed]
- Kale, S.D.; Ayubi, T.; Chung, D.; Tubau-Juni, N.; Leber, A.; Dang, H.X.; Karyala, S.; Hontecillas, R.; Lawrence, C.B.; Cramer, R.A.; et al. Modulation of Immune Signaling and Metabolism Highlights Host and Fungal Transcriptional Responses in Mouse Models of Invasive Pulmonary Aspergillosis. Sci. Rep. 2017, 7, 17096. [Google Scholar] [CrossRef] [PubMed]
- Da Silva Ferreira, M.E.; Capellaro, J.L.; dos Reis Marques, E.; Malavazi, I.; Perlin, D.; Park, S.; Anderson, J.B.; Colombo, A.L.; Arthington-Skaggs, B.A.; Goldman, M.H.; et al. In vitro evolution of itraconazole resistance in Aspergillus fumigatus involves multiple mechanisms of resistance. Antimicrob. Agents Chemother. 2004, 48, 4405–4413. [Google Scholar] [CrossRef] [Green Version]
- Kurucz, V.; Kruger, T.; Antal, K.; Dietl, A.M.; Haas, H.; Pocsi, I.; Kniemeyer, O.; Emri, T. Additional oxidative stress reroutes the global response of Aspergillus fumigatus to iron depletion. BMC Genom. 2018, 19, 357. [Google Scholar] [CrossRef] [PubMed]
- Gravelat, F.N.; Doedt, T.; Chiang, L.Y.; Liu, H.; Filler, S.G.; Patterson, T.F.; Sheppard, D.C. In vivo analysis of Aspergillus fumigatus developmental gene expression determined by real-time reverse transcription-PCR. Infect. Immun. 2008, 76, 3632–3639. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jimenez-Ortigosa, C.; Aimanianda, V.; Muszkieta, L.; Mouyna, I.; Alsteens, D.; Pire, S.; Beau, R.; Krappmann, S.; Beauvais, A.; Dufrene, Y.F.; et al. Chitin synthases with a myosin motor-like domain control the resistance of Aspergillus fumigatus to echinocandins. Antimicrob. Agents Chemother. 2012, 56, 6121–6131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kadooka, C.; Nakamura, E.; Mori, K.; Okutsu, K.; Yoshizaki, Y.; Takamine, K.; Goto, M.; Tamaki, H.; Futagami, T. LaeA Controls Citric Acid Production through Regulation of the Citrate Exporter-Encoding cexA Gene in Aspergillus luchuensis mut. kawachii. Appl. Environ. Microbiol. 2020, 86. [Google Scholar] [CrossRef] [PubMed]
- Trevisan, G.L.; Oliveira, E.H.; Peres, N.T.; Cruz, A.H.; Martinez-Rossi, N.M.; Rossi, A. Transcription of Aspergillus nidulans pacC is modulated by alternative RNA splicing of palB. FEBS Lett. 2011, 585, 3442–3445. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, L.; Song, Y.; Cao, J.; Wang, S.; Wei, H.; Jiang, H.; Lu, L. Osmotic stabilizer-coupled suppression of NDR defects is dependent on the calcium-calcineurin signaling cascade in Aspergillus nidulans. Cell. Signal. 2011, 23, 1750–1757. [Google Scholar] [CrossRef]
- Alam, M.K.; El-Ganiny, A.M.; Afroz, S.; Sanders, D.A.; Liu, J.; Kaminskyj, S.G. Aspergillus nidulans galactofuranose biosynthesis affects antifungal drug sensitivity. Fungal Genet. Biol. 2012, 49, 1033–1043. [Google Scholar] [CrossRef]
- Liu, F.F.; Pu, L.; Zheng, Q.Q.; Zhang, Y.W.; Gao, R.S.; Xu, X.S.; Zhang, S.Z.; Lu, L. Calcium signaling mediates antifungal activity of triazole drugs in the Aspergilli. Fungal Genet. Biol. 2015, 81, 182–190. [Google Scholar] [CrossRef]
- Semighini, C.P.; Marins, M.; Goldman, M.H.; Goldman, G.H. Quantitative analysis of the relative transcript levels of ABC transporter Atr genes in Aspergillus nidulans by real-time reverse transcription-PCR assay. Appl. Environ. Microbiol. 2002, 68, 1351–1357. [Google Scholar] [CrossRef] [Green Version]
- Georgakopoulos, P.; Lockington, R.A.; Kelly, J.M. SAGA complex components and acetate repression in Aspergillus nidulans. G3 2012, 2, 1357–1367. [Google Scholar] [CrossRef] [Green Version]
- Rohrig, J.; Kastner, C.; Fischer, R. Light inhibits spore germination through phytochrome in Aspergillus nidulans. Curr. Genet. 2013, 59, 55–62. [Google Scholar] [CrossRef]
- Hunter, A.J.; Morris, T.A.; Jin, B.; Saint, C.P.; Kelly, J.M. Deletion of creB in Aspergillus oryzae increases secreted hydrolytic enzyme activity. Appl. Environ. Microbiol. 2013, 79, 5480–5487. [Google Scholar] [CrossRef] [Green Version]
- Szilagyi, M.; Miskei, M.; Karanyi, Z.; Lenkey, B.; Pocsi, I.; Emri, T. Transcriptome changes initiated by carbon starvation in Aspergillus nidulans. Microbiology 2013, 159, 176–190. [Google Scholar] [CrossRef] [Green Version]
- Xiao, L.; Sun, Q.; Lian, B. A Global View of Gene Expression of Aspergillus nidulans on Responding to the Deficiency in Soluble Potassium. Curr. Microbiol. 2016, 72, 410–419. [Google Scholar] [CrossRef]
- Guerriero, G.; Silvestrini, L.; Obersriebnig, M.; Hausman, J.F.; Strauss, J.; Ezcurra, I. A WDR Gene Is a Conserved Member of a Chitin Synthase Gene Cluster and Influences the Cell Wall in Aspergillus nidulans. Int. J. Mol. Sci. 2016, 17, 1031. [Google Scholar] [CrossRef] [Green Version]
- Cui, S.; Wang, T.; Hu, H.; Liu, L.; Song, A.; Chen, H. Investigating the expression of F10 and G11 xylanases in Aspergillus niger A09 with qPCR. Can. J. Microbiol. 2016, 62, 744–752. [Google Scholar] [CrossRef] [PubMed]
- Chutrakul, C.; Panchanawaporn, S.; Jeennor, S.; Anantayanon, J.; Vorapreeda, T.; Vichai, V.; Laoteng, K. Functional Characterization of Novel U6 RNA Polymerase III Promoters: Their Implication for CRISPR-Cas9-Mediated Gene Editing in Aspergillus oryzae. Curr. Microbiol. 2019, 76, 1443–1451. [Google Scholar] [CrossRef]
- Svanstrom, A.; van Leeuwen, M.R.; Dijksterhuis, J.; Melin, P. Trehalose synthesis in Aspergillus niger: Characterization of six homologous genes, all with conserved orthologs in related species. BMC Microbiol. 2014, 14, 90. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hou, L.; Liu, L.; Zhang, H.; Zhang, L.; Zhang, L.; Zhang, J.; Gao, Q.; Wang, D. Functional analysis of the mitochondrial alternative oxidase gene (aox1) from Aspergillus niger CGMCC 10142 and its effects on citric acid production. Appl. Microbiol. Biotechnol. 2018, 102, 7981–7995. [Google Scholar] [CrossRef]
- Arentshorst, M.; de Lange, D.; Park, J.; Lagendijk, E.L.; Alazi, E.; van den Hondel, C.; Ram, A.F.J. Functional analysis of three putative galactofuranosyltransferases with redundant functions in galactofuranosylation in Aspergillus niger. Arch. Microbiol. 2020, 202, 197–203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lv, Y.; Xiao, J.; Pan, L. Type III polyketide synthase is involved in the biosynthesis of protocatechuic acid in Aspergillus niger. Biotechnol. Lett. 2014, 36, 2303–2310. [Google Scholar] [CrossRef]
- Khosravi, C.; Kun, R.S.; Visser, J.; Aguilar-Pontes, M.V.; de Vries, R.P.; Battaglia, E. In vivo functional analysis of L-rhamnose metabolic pathway in Aspergillus niger: A tool to identify the potential inducer of RhaR. BMC Microbiol. 2017, 17, 214. [Google Scholar] [CrossRef] [Green Version]
- Omony, J.; Mach-Aigner, A.R.; van Straten, G.; van Boxtel, A.J. Quantitative modeling and analytic assessment of the transcription dynamics of the XlnR regulon in Aspergillus niger. BMC Syst. Biol. 2016, 10, 13. [Google Scholar] [CrossRef] [Green Version]
- Yunes, N.B.S.; Oliveira, R.C.; Reis, T.A.; Baquiao, A.C.; Rocha, L.O.; Correa, B. Effect of temperature on growth, gene expression, and aflatoxin production by Aspergillus nomius isolated from Brazil nuts. Mycotoxin Res. 2019. [Google Scholar] [CrossRef] [PubMed]
- Fernandez, E.Q.; Moyer, D.L.; Maiyuran, S.; Labaro, A.; Brody, H. Vector-Initiated transitive RNA interference in the filamentous fungus Aspergillus oryzae. Fungal Genet. Biol. 2012, 49, 294–301. [Google Scholar] [CrossRef]
- Tsujii, M.; Okuda, S.; Ishi, K.; Madokoro, K.; Takeuchi, M.; Yamagata, Y. A long natural-antisense RNA is accumulated in the conidia of Aspergillus oryzae. Biosci. Biotechnol. Biochem. 2016, 80, 386–398. [Google Scholar] [CrossRef] [PubMed]
- Tamano, K.; Bruno, K.S.; Karagiosis, S.A.; Culley, D.E.; Deng, S.; Collett, J.R.; Umemura, M.; Koike, H.; Baker, S.E.; Machida, M. Increased production of fatty acids and triglycerides in Aspergillus oryzae by enhancing expressions of fatty acid synthesis-related genes. Appl. Microbiol. Biotechnol. 2013, 97, 269–281. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, A.; Sano, M.; Oda, K.; Hisada, H.; Hata, Y.; Ohashi, S. The glucoamylase-encoding gene (glaB) is expressed in solid-state culture with a low water content. Biosci. Biotechnol. Biochem. 2007, 71, 1797–1799. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oda, K.; Kobayashi, A.; Ohashi, S.; Sano, M. Aspergillus oryzae laeA regulates kojic acid synthesis genes. Biosci. Biotechnol. Biochem. 2011, 75, 1832–1834. [Google Scholar] [CrossRef] [Green Version]
- Jin, F.J.; Han, P.; Zhuang, M.; Zhang, Z.M.; Jin, L.; Koyama, Y. Comparative proteomic analysis: SclR is importantly involved in carbohydrate metabolism in Aspergillus oryzae. Appl. Microbiol. Biotechnol. 2018, 102, 319–332. [Google Scholar] [CrossRef] [PubMed]
- Chang, P.K. Lack of interaction between AFLR and AFLJ contributes to nonaflatoxigenicity of Aspergillus sojae. J. Biotechnol. 2004, 107, 245–253. [Google Scholar] [CrossRef]
- Kondo, T.; Sakurada, M.; Okamoto, S.; Ono, M.; Tsukigi, H.; Suzuki, A.; Nagasawa, H.; Sakuda, S. Effects of aflastatin A, an inhibitor of aflatoxin production, on aflatoxin biosynthetic pathway and glucose metabolism in Aspergillus parasiticus. J. Antibiot. 2001, 54, 650–657. [Google Scholar] [CrossRef] [Green Version]
- Akbari Dana, M.; Kordbacheh, P.; Daei Ghazvini, R.; Moazeni, M.; Nazemi, L.; Rezaie, S. Inhibitory effect of vitamin C on Aspergillus parasiticus growth and aflatoxin gene expression. Curr. Med. Mycol. 2018, 4, 10–14. [Google Scholar] [CrossRef]
- Ghanbari, R.; Rezaie, S.; Noorbakhsh, F.; Khaniki, G.J.; Soleimani, M.; Aghaee, E.M. Biocontrol effect of Kluyveromyces lactis on aflatoxin expression and production in Aspergillus parasiticus. FEMS Microbiol. Lett. 2019, 366. [Google Scholar] [CrossRef]
- Lozano-Ojalvo, D.; Rodriguez, A.; Bernaldez, V.; Cordoba, J.J.; Rodriguez, M. Influence of temperature and substrate conditions on the omt-1 gene expression of Aspergillus parasiticus in relation to its aflatoxin production. Int. J. Food Microbiol. 2013, 166, 263–269. [Google Scholar] [CrossRef] [PubMed]
- Sorrentino, F.; Roy, I.; Keshavarz, T. Impact of linoleic acid supplementation on lovastatin production in Aspergillus terreus cultures. Appl. Microbiol. Biotechnol. 2010, 88, 65–73. [Google Scholar] [CrossRef] [PubMed]
- El-Sayed, A.S.A.; Mohamed, N.Z.; Safan, S.; Yassin, M.A.; Shaban, L.; Shindia, A.A.; Shad Ali, G.; Sitohy, M.Z. Restoring the Taxol biosynthetic machinery of Aspergillus terreus by Podocarpus gracilior Pilger microbiome, with retrieving the ribosome biogenesis proteins of WD40 superfamily. Sci. Rep. 2019, 9, 11534. [Google Scholar] [CrossRef] [Green Version]
- Gil-Serna, J.; Patino, B.; Cortes, L.; Gonzalez-Jaen, M.T.; Vazquez, C. Mechanisms involved in reduction of ochratoxin A produced by Aspergillus westerdijkiae using Debaryomyces hansenii CYC 1244. Int. J. Food Microbiol. 2011, 151, 113–118. [Google Scholar] [CrossRef]
- Sartori, D.; Massi, F.P.; Ferranti, L.S.; Fungaro, M.H. Identification of Genes Differentially Expressed Between Ochratoxin-Producing and Non-Producing Strains of Aspergillus westerdijkiae. Indian J. Microbiol. 2014, 54, 41–45. [Google Scholar] [CrossRef] [Green Version]
- Suleman, E.; Somai, B.M. Validation of hisH4 and cox5 reference genes for RT-qPCR analysis of gene expression in Aspergillus flavus under aflatoxin conducive and non-conducive conditions. Microbiol. Res. 2012, 167, 487–492. [Google Scholar] [CrossRef] [PubMed]
- Oakley, B.R. Tubulins in Aspergillus nidulans. Fungal Genet. Biol. 2004, 41, 420–427. [Google Scholar] [CrossRef]
- Begerow, D.; John, B.; Oberwinkler, F. Evolutionary relationships among beta-tubulin gene sequences of basidiomycetous fungi. Mycol. Res. 2004, 108, 1257–1263. [Google Scholar] [CrossRef]
- Msiska, Z.; Morton, J.B. Isolation and sequence analysis of a beta-tubulin gene from arbuscular mycorrhizal fungi. Mycorrhiza 2009, 19, 501–513. [Google Scholar] [CrossRef]
- Zhao, Z.; Liu, H.; Luo, Y.; Zhou, S.; An, L.; Wang, C.; Jin, Q.; Zhou, M.; Xu, J.R. Molecular evolution and functional divergence of tubulin superfamily in the fungal tree of life. Sci. Rep. 2014, 4, 6746. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oakley, B.R.; Morris, N.R. A beta-tubulin mutation in Aspergillus nidulans that blocks microtubule function without blocking assembly. Cell 1981, 24, 837–845. [Google Scholar] [CrossRef]
- Lopez de Haro, M.S.; Alvarez, L.; Nieto, A. Testosterone induces the expression of the uteroglobin gene in rabbit epididymis. Biochem. J. 1988, 250, 647–651. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shigemasa, K.; Tanimoto, H.; Sakata, K.; Nagai, N.; Parmley, T.H.; Ohama, K.; O’Brien, T.J. Induction of matrix metalloprotease-7 is common in mucinous ovarian tumors including early stage disease. Med. Oncol. 2000, 17, 52–58. [Google Scholar] [CrossRef] [PubMed]
- Andersen, C.L.; Jensen, J.L.; Orntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [Green Version]
- Yu, J.; Chang, P.K.; Ehrlich, K.C.; Cary, J.W.; Bhatnagar, D.; Cleveland, T.E.; Payne, G.A.; Linz, J.E.; Woloshuk, C.P.; Bennett, J.W. Clustered pathway genes in aflatoxin biosynthesis. Appl. Environ. Microbiol. 2004, 70, 1253–1262. [Google Scholar] [CrossRef] [Green Version]
- Duran, R.M.; Cary, J.W.; Calvo, A.M. Production of cyclopiazonic acid, aflatrem, and aflatoxin by Aspergillus flavus is regulated by veA, a gene necessary for sclerotial formation. Appl. Microbiol. Biotechnol. 2007, 73, 1158–1168. [Google Scholar] [CrossRef]
- Zhuang, Z.; Lohmar, J.M.; Satterlee, T.; Cary, J.W.; Calvo, A.M. The Master Transcription Factor mtfA Governs Aflatoxin Production, Morphological Development and Pathogenicity in the Fungus Aspergillus flavus. Toxins 2016, 8, 29. [Google Scholar] [CrossRef] [PubMed]
- Baidya, S.; Duran, R.M.; Lohmar, J.M.; Harris-Coward, P.Y.; Cary, J.W.; Hong, S.Y.; Roze, L.V.; Linz, J.E.; Calvo, A.M. VeA is associated with the response to oxidative stress in the aflatoxin producer Aspergillus flavus. Eukaryot. Cell 2014, 13, 1095–1103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chang, P.K.; Yu, J.; Yu, J.H. AflT, a MFS transporter-encoding gene located in the aflatoxin gene cluster, does not have a significant role in aflatoxin secretion. Fungal Genet. Biol. 2004, 41, 911–920. [Google Scholar] [CrossRef]
- Degola, F.; Berni, E.; Dall’Asta, C.; Spotti, E.; Marchelli, R.; Ferrero, I.; Restivo, F.M. A multiplex RT-PCR approach to detect aflatoxigenic strains of Aspergillus flavus. J. Appl. Microbiol. 2007, 103, 409–417. [Google Scholar] [CrossRef]
- Howard, S.J.; Pasqualotto, A.C.; Denning, D.W. Azole resistance in allergic bronchopulmonary aspergillosis and Aspergillus bronchitis. Clin. Microbiol. Infect. 2010, 16, 683–688. [Google Scholar] [CrossRef] [PubMed]
- Mellado, E.; Alcazar-Fuoli, L.; Cuenca-Estrella, M.; Rodriguez-Tudela, J.L. Role of Aspergillus lentulus 14-alpha sterol demethylase (Cyp51A) in azole drug susceptibility. Antimicrob. Agents Chemother. 2011, 55, 5459–5468. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krishnan-Natesan, S.; Chandrasekar, P.H.; Alangaden, G.J.; Manavathu, E.K. Molecular characterisation of cyp51A and cyp51B genes coding for P450 14alpha-lanosterol demethylases A (CYP51Ap) and B (CYP51Bp) from voriconazole-resistant laboratory isolates of Aspergillus flavus. Int. J. Antimicrob. Agents 2008, 32, 519–524. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Sun, Y.; Chen, W.; Liu, W.; Wan, Z.; Bu, D.; Li, R. The T788G mutation in the cyp51C gene confers voriconazole resistance in Aspergillus flavus causing aspergillosis. Antimicrob. Agents Chemother. 2012, 56, 2598–2603. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dominguez, R.; Holmes, K.C. Actin structure and function. Annu. Rev. Biophys. 2011, 40, 169–186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Levi, A.; Eldridge, J.D.; Paterson, B.M. Molecular cloning of a gene sequence regulated by nerve growth factor. Science 1985, 229, 393–395. [Google Scholar] [CrossRef] [Green Version]
- Shang, E.S.; Champion, C.I.; Wu, X.Y.; Skare, J.T.; Blanco, D.R.; Miller, J.N.; Lovett, M.A. Comparison of protection in rabbits against host-adapted and cultivated Borrelia burgdorferi following infection-derived immunity or immunization with outer membrane vesicles or outer surface protein A. Infect. Immun. 2000, 68, 4189–4199. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Humphries, S.E.; Whittall, R.; Minty, A.; Buckingham, M.; Williamson, R. There are approximately 20 actin gene in the human genome. Nucleic Acids Res. 1981, 9, 4895–4908. [Google Scholar] [CrossRef]
- Cox, G.M.; Rude, T.H.; Dykstra, C.C.; Perfect, J.R. The actin gene from Cryptococcus neoformans: Structure and phylogenetic analysis. J. Med. Vet. Mycol. 1995, 33, 261–266. [Google Scholar] [CrossRef] [PubMed]
- Fidel, S.; Doonan, J.H.; Morris, N.R. Aspergillus nidulans contains a single actin gene which has unique intron locations and encodes a gamma-actin. Gene 1988, 70, 283–293. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Barbacioru, C.; Hyland, F.; Xiao, W.; Hunkapiller, K.L.; Blake, J.; Chan, F.; Gonzalez, C.; Zhang, L.; Samaha, R.R. Large scale real-time PCR validation on gene expression measurements from two commercial long-oligonucleotide microarrays. BMC Genom. 2006, 7, 59. [Google Scholar] [CrossRef] [Green Version]
- Barrios-Gonzalez, J.; Miranda, R.U. Biotechnological production and applications of statins. Appl. Microbiol. Biotechnol. 2010, 85, 869–883. [Google Scholar] [CrossRef]
- Kennedy, J.; Auclair, K.; Kendrew, S.G.; Park, C.; Vederas, J.C.; Hutchinson, C.R. Modulation of polyketide synthase activity by accessory proteins during lovastatin biosynthesis. Science 1999, 284, 1368–1372. [Google Scholar] [CrossRef]
- Sakuda, S.; Ikeda, H.; Nakamura, T.; Kawachi, R.; Kondo, T.; Ono, M.; Sakurada, M.; Inagaki, H.; Ito, R.; Nagasawa, H. Blasticidin A derivatives with highly specific inhibitory activity toward aflatoxin production in Aspergillus parasiticus. J. Antibiot. 2000, 53, 1378–1384. [Google Scholar] [CrossRef] [Green Version]
- Ono, M.; Sakuda, S.; Suzuki, A.; Isogai, A. Aflastatin A, a novel inhibitor of aflatoxin production by aflatoxigenic fungi. J. Antibiot. 1997, 50, 111–118. [Google Scholar] [CrossRef] [Green Version]
- Lockington, R.A.; Sealy-Lewis, H.M.; Scazzocchio, C.; Davies, R.W. Cloning and characterization of the ethanol utilization regulon in Aspergillus nidulans. Gene 1985, 33, 137–149. [Google Scholar] [CrossRef]
- Sandeman, R.A.; Hynes, M.J. Isolation of the facA (acetyl-coenzyme A synthetase) and acuE (malate synthase) genes of Aspergillus nidulans. Mol. Gen. Genet. 1989, 218, 87–92. [Google Scholar] [CrossRef]
- Reiber, K.; Reeves, E.P.; Neville, C.M.; Winkler, R.; Gebhardt, P.; Kavanagh, K.; Doyle, S. The expression of selected non-ribosomal peptide synthetases in Aspergillus fumigatus is controlled by the availability of free iron. FEMS Microbiol. Lett. 2005, 248, 83–91. [Google Scholar] [CrossRef] [Green Version]
- Herrera, M.L.; Vallor, A.C.; Gelfond, J.A.; Patterson, T.F.; Wickes, B.L. Strain-Dependent variation in 18S ribosomal DNA Copy numbers in Aspergillus fumigatus. J. Clin. Microbiol. 2009, 47, 1325–1332. [Google Scholar] [CrossRef] [Green Version]
- Guoth, M.; Murgia, A.; Smith, R.M.; Prystowsky, M.B.; Cooke, N.E.; Haddad, J.G. Cell surface vitamin D-binding protein (GC-globulin) is acquired from plasma. Endocrinology 1990, 127, 2313–2321. [Google Scholar] [CrossRef]
- Gerard, C.J.; Andrejka, L.M.; Macina, R.A. Mitochondrial ATP synthase 6 as an endogenous control in the quantitative RT-PCR analysis of clinical cancer samples. Mol. Diagn. 2000, 5, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Nicholls, C.; Li, H.; Liu, J.P. GAPDH: A common enzyme with uncommon functions. Clin. Exp. Pharmacol. Physiol. 2012, 39, 674–679. [Google Scholar] [CrossRef] [PubMed]
- Mitsuzawa, H.; Kimura, M.; Kanda, E.; Ishihama, A. Glyceraldehyde-3-phosphate dehydrogenase and actin associate with RNA polymerase II and interact with its Rpb7 subunit. FEBS Lett. 2005, 579, 48–52. [Google Scholar] [CrossRef] [Green Version]
- Lee, M.N.; Ha, S.H.; Kim, J.; Koh, A.; Lee, C.S.; Kim, J.H.; Jeon, H.; Kim, D.H.; Suh, P.G.; Ryu, S.H. Glycolytic flux signals to mTOR through glyceraldehyde-3-phosphate dehydrogenase-mediated regulation of Rheb. Mol. Cell. Biol. 2009, 29, 3991–4001. [Google Scholar] [CrossRef] [Green Version]
- Tajima, H.; Tsuchiya, K.; Yamada, M.; Kondo, K.; Katsube, N.; Ishitani, R. Over-Expression of GAPDH induces apoptosis in COS-7 cells transfected with cloned GAPDH cDNAs. Neuroreport 1999, 10, 2029–2033. [Google Scholar] [CrossRef]
- Oikarinen, A.; Makela, J.; Vuorio, T.; Vuorio, E. Comparison on collagen gene expression in the developing chick embryo tendon and heart. Tissue and development time-dependent action of dexamethasone. Biochim. Biophys. Acta 1991, 1089, 40–46. [Google Scholar] [CrossRef]
- Robbins, M.; McKinney, M. Transcriptional regulation of neuromodulin (GAP-43) in mouse neuroblastoma clone N1E-115 as evaluated by the RT/PCR method. Brain Res. Mol. Brain Res. 1992, 13, 83–92. [Google Scholar] [CrossRef]
- De Groot, P.W.; Brandt, B.W.; Horiuchi, H.; Ram, A.F.; de Koster, C.G.; Klis, F.M. Comprehensive genomic analysis of cell wall genes in Aspergillus nidulans. Fungal Genet. Biol. 2009, 46 (Suppl. 1), S72–S81. [Google Scholar] [CrossRef] [Green Version]
- Teepe, A.G.; Loprete, D.M.; He, Z.; Hoggard, T.A.; Hill, T.W. The protein kinase C orthologue PkcA plays a role in cell wall integrity and polarized growth in Aspergillus nidulans. Fungal Genet. Biol. 2007, 44, 554–562. [Google Scholar] [CrossRef] [PubMed]
- Futagami, T.; Nakao, S.; Kido, Y.; Oka, T.; Kajiwara, Y.; Takashita, H.; Omori, T.; Furukawa, K.; Goto, M. Putative stress sensors WscA and WscB are involved in hypo-osmotic and acidic pH stress tolerance in Aspergillus nidulans. Eukaryot. Cell 2011, 10, 1504–1515. [Google Scholar] [CrossRef] [Green Version]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-Based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Mach-Aigner, A.R.; Omony, J.; Jovanovic, B.; van Boxtel, A.J.; de Graaff, L.H. d-Xylose concentration-dependent hydrolase expression profiles and the function of CreA and XlnR in Aspergillus niger. Appl. Environ. Microbiol. 2012, 78, 3145–3155. [Google Scholar] [CrossRef] [Green Version]
- Omony, J.; de Graaff, L.H.; van Straten, G.; van Boxtel, A.J. Modeling and analysis of the dynamic behavior of the XlnR regulon in Aspergillus niger. BMC Syst. Biol. 2011, 5 (Suppl. 1), S14. [Google Scholar] [CrossRef] [Green Version]
- Bohle, K.; Jungebloud, A.; Gocke, Y.; Dalpiaz, A.; Cordes, C.; Horn, H.; Hempel, D.C. Selection of reference genes for normalisation of specific gene quantification data of Aspergillus niger. J. Biotechnol. 2007, 132, 353–358. [Google Scholar] [CrossRef] [PubMed]
- Ogasawara, H.; Obata, H.; Hata, Y.; Takahashi, S.; Gomi, K. Crawler, a novel Tc1/mariner-type transposable element in Aspergillus oryzae transposes under stress conditions. Fungal Genet. Biol. 2009, 46, 441–449. [Google Scholar] [CrossRef]
- Taylor, S.; Wakem, M.; Dijkman, G.; Alsarraj, M.; Nguyen, M. A practical approach to RT-qPCR-Publishing data that conform to the MIQE guidelines. Methods 2010, 50, S1–S5. [Google Scholar] [CrossRef] [PubMed]
- Setiawan, A.N.; Lokman, P.M. The use of reference gene selection programs to study the silvering transformation in a freshwater eel Anguilla australis: A cautionary tale. BMC Mol. Biol. 2010, 11, 75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Das, P.; Pandey, P.; Harishankar, A.; Chandy, M.; Bhattacharya, S.; Chakrabarti, A. Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species. Indian J. Med. Microbiol. 2017, 35, 381–388. [Google Scholar] [CrossRef]
- Shakeel, M.; Rodriguez, A.; Tahir, U.B.; Jin, F. Gene expression studies of reference genes for quantitative real-time PCR: An overview in insects. Biotechnol. Lett. 2018, 40, 227–236. [Google Scholar] [CrossRef] [PubMed]
- Xie, M.; Zhong, Y.; Lin, L.; Zhang, G.; Su, W.; Ni, W.; Qu, M.; Chen, H. Evaluation of reference genes for quantitative real-time PCR normalization in the scarab beetle Holotrichia oblita. PLoS ONE 2020, 15, e0240972. [Google Scholar] [CrossRef] [PubMed]
- Deng, Y.; Zhao, H.; Yang, S.; Zhang, L.; Zhang, L.; Hou, C. Screening and Validation of Reference Genes for RT-qPCR Under Different Honey Bee Viral Infections and dsRNA Treatment. Front. Microbiol. 2020, 11, 1715. [Google Scholar] [CrossRef]
- Wang, Z.; Meng, Q.; Zhu, X.; Sun, S.; Liu, A.; Gao, S.; Gou, Y. Identification and Evaluation of Reference Genes for Normalization of Gene Expression in Developmental Stages, Sexes, and Tissues of Diaphania caesalis (Lepidoptera, Pyralidae). J. Insect Sci. 2020, 20. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Kong, X.; Liu, S.; Huang, H.; Chen, Z.; Xu, Y. Selection of Reference Genes for Quantitative Real-Time PCR in Chrysoperla nipponensis (Neuroptera: Chrysopidae) Under Tissues in Reproduction and Diapause. J. Insect Sci. 2020, 20. [Google Scholar] [CrossRef]
- Zhang, Y.; Chen, J.; Chen, G.; Ma, C.; Chen, H.; Gao, X.; Tian, Z.; Cui, S.; Tian, Z.; Guo, J.; et al. Identification and Validation of Reference Genes for Quantitative Gene Expression Analysis in Ophraella communa. Front. Physiol. 2020, 11, 355. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Dong, Y.; Yu, Y.; Xing, Y.; Li, X.; Zhang, X.; Hou, X.; Sun, X. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plants under differential biotic stresses. Sci. Rep. 2020, 10, 2429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, P.; Wang, J.; Wen, J. Selection of reference genes for tissue/organ samples of adults of Eucryptorrhynchus scrobiculatus. PLoS ONE 2020, 15, e0228308. [Google Scholar] [CrossRef] [Green Version]
- Wang, G.; Tian, C.; Wang, Y.; Wan, F.; Hu, L.; Xiong, A.; Tian, J. Selection of reliable reference genes for quantitative RT-PCR in garlic under salt stress. Peer J. 2019, 7, e7319. [Google Scholar] [CrossRef] [PubMed]
- Basu, S.; Pereira, A.E.; Pinheiro, D.H.; Wang, H.; Valencia-Jimenez, A.; Siegfried, B.D.; Louis, J.; Zhou, X.; Velez, A.M. Evaluation of reference genes for real-time quantitative PCR analysis in southern corn rootworm, Diabrotica undecimpunctata howardi (Barber). Sci. Rep. 2019, 9, 10703. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Liu, F.; Huang, W.; Sun, Q.; Huang, X. Identification of reliable reference genes for qRT-PCR in the ephemeral plant Arabidopsis pumila based on full-length transcriptome data. Sci. Rep. 2019, 9, 8408. [Google Scholar] [CrossRef]
- Zhao, Z.; Wang, L.; Yue, D.; Ye, B.; Li, P.; Zhang, B.; Fan, Q. Evaluation of Reference Genes for Normalization of RT-qPCR Gene Expression Data for Trichoplusia ni Cells During Antheraea pernyi (Lepidoptera: Saturniidae) Multicapsid Nucleopolyhedrovirus (AnpeNPV) Infection. J. Insect Sci. 2019, 19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ju, W.; Smith, A.O.; Sun, T.; Zhao, P.; Jiang, Y.; Liu, L.; Zhang, T.; Qi, K.; Qiao, J.; Xu, K.; et al. Validation of Housekeeping Genes as Reference for Reverse-Transcription-qPCR Analysis in Busulfan-Injured Microvascular Endothelial Cells. Biomed. Res. Int. 2018, 2018, 4953806. [Google Scholar] [CrossRef]
- Garcia-Reina, A.; Rodriguez-Garcia, M.J.; Galian, J. Validation of reference genes for quantitative real-time PCR in tiger beetles across sexes, body parts, sexual maturity and immune challenge. Sci. Rep. 2018, 8, 10743. [Google Scholar] [CrossRef]
- Ariizumi, T.; Murata, S.; Fujisawa, S.; Isezaki, M.; Maekawa, N.; Okagawa, T.; Sato, T.; Oishi, E.; Taneno, A.; Konnai, S.; et al. Selection of reference genes for quantitative PCR analysis in poultry red mite (Dermanyssus gallinae). J. Vet. Med. Sci. 2021, 83, 558–565. [Google Scholar] [CrossRef] [PubMed]
Species | Reference Gene | Validation (Y/N) | Experimental Conditions | Ref. |
---|---|---|---|---|
A. aculeatus | Actin | N | Minimal media (MM) for 3, 5 and 7 days | [34] |
Histone 3 | ||||
GAPDH | Y | MM with 1% (w/v) polypeptone, 1% (w/v) glucose, 1% (w/v) avicel, 1% (w/v) xylose, or 1% (w/v) arabinose for 3 h or 6 h | [35] | |
A. carbonarius | 18S rRNA | N | Czapek-Dox Modified Yeast Agar (CYA) medium in the dark at 30 °C for 2 days | [36] |
Calmodulin | N | Co-culture with the actinobacterial strain, SN7, on International Streptomyces Project-2 (ISP2) media at 28 °C for 4 days | [37] | |
Ubiquitin-conjugating Enzyme | Y | MM at 25 °C, without shaking (ochratoxin A (OTA)-inducing conditions) for 4, 6 and 8 days in the dark | [32] | |
A. cristatus | Actin | N | Cellulose membrane on malt yeast agar (MYA) and on 17% NaCl MYA media for 5 days at 28 °C in the dark, after which mycelia were fixed (extraction from 7-day mycelia) | [24] |
A. fischeri | Beta-tubulin | Y | Growth on a hydrophobic polyvinylidene fluoride (PVDF) membrane on top of oatmeal agar for 3, 6 or 30 days (wildtype only) | [38] |
Histone 3 | ||||
A. flavus | 18S rRNA | N | Glucose minimal media (GMM) containing 1% starch or 24 g/400 mL ground corn seed at 30 °C for 24, 48 and 72 h with shaking at 250 rpm | [39] |
18S rRNA | N | Yeast extract sucrose (YES) medium at 37 °C for 1.5 days and at 28 °C for 3 days, in the dark | [28] | |
18S rRNA | N | YES media supplemented with 0.40 mmol/L of cinnamaldehyde, 0.56 mmol/L of citral, and 0.80 mmol/L of eugenol for 7 days | [40] | |
18S rRNA | Y | Co-culture with Listeria monocytogenes in malt extract broth (MEB) at 25 °C and 30 °C for 7 days | [41] | |
Beta-tubulin | ||||
Calmodulin | ||||
Actin | N | Co-incubation with soil isolates of Streptomyces on ISP2 medium at 28 °C | [42] | |
Beta-tubulin | ||||
Actin | N | (1) Potato dextrose agar (PDA) or GMM supplemented with NH4+ for 48 h (2) GMM supplemented with 50 mM ammonium or NaNO2 for 30 h | [43] | |
Actin | N | YES media containing 1.5 mg/100 mL silver nanoparticles at 28 °C for 14 days | [44] | |
Beta-tubulin | ||||
Actin | N | YES or yeast peptone dextrose (YPD) media for 5 and 7 days, respectively, at 37 °C in the dark | [45] | |
Beta-tubulin | Y | Inoculated onto 25 g of wheat and grown at 30 °C in open petri dishes with wetted filter paper for 9 days | [46] | |
Beta-tubulin | N | Peanut samples for 6 weeks at 25 °C in polyethylene sandwich boxes containing glycerol/water solutions to maintain the equilibrium relative humidity conditions | [47] | |
Beta-tubulin * | N | YES or yeast extract peptone (YEP) media at 28 °C for 4 days | [48] | |
Beta-tubulin | N | Sucrose magnesium sulphate potassium nitrate yeast (SMKY) liquid media 25 °C for 7 days | [49] | |
Beta-tubulin * | N | Treatment or no treatment with the subinhibitory concentrations of carvacrol or trans-cinnamaldehyde in potato dextrose broth (PDB) at 25 °C for 5 days | [50] | |
Beta-tubulin | N | Liquid media at 30 °C with constant shaking at 120 rpm for 20 to 24 h | [51] | |
Beta-tubulin | Y | Malt extract agar (MEA) media supplemented with 0.5 mM eugenol for 4 days at 27 °C in the dark | [52] | |
GAPDH | ||||
Beta-tubulin | N | Coconut agar at 25 °C for 2 or 7 days | [53] | |
Calmodulin | ||||
Beta-tubulin | Y | Co-incubation with Streptomyces roseolus on ISP2 medium at 30 °C for 4 days at a relative humidity of 80% in a Vötsch chamber | [54] | |
GAPDH | ||||
Beta-tubulin * | Y | YES medium containing one of four antifungal peptides: PPD1, 66-10, 77-3, or D4E1 | [55] | |
Beta-tubulin | N | PDB containing 30% (v/v) of Eurotium cristatum culture filtrate for 3 days in the dark at 28 ± 2 °C with shaking at 120 r/min | [56] | |
ITS1 | N | Cultures of differing water potential were supplemented with different antioxidant concentrations at 20 °C and 28 °C for 72 h | [57] | |
ITS4 | ||||
A. fumigatus | 18S rRNA | Y | Treatment with 125 μg/mL artemisinin or solvent for 3 h in Roswell Park Memorial Institute (RPMI) 1640 medium at 37 °C | [27] |
18S rRNA | N | PDA with different carbon dioxide concentrations and on Czapek media with different C: N ratios for 48 h and 5 days | [58] | |
18S rRNA | N | Liquid Aspergillus minimal media (AMM) at 37 °C for 18 h with shaking at 200 rpm | [59] | |
Actin | N | (1) GMM at 25 °C for 60 days with shaking at 280 rpm (2) High iron liquid media or low iron liquid media at 37 °C for 24 h with shaking at 280 rpm | [23] | |
Actin | N | Biofilm growth at 37 °C in minimal essential medium (MEM) supplemented with 5% v/v fetal calf serum (FCS) or 5% v/v phosphate-buffered saline (PBS) for 24 h and 48 h | [22] | |
Actin | N | (1) CBS 144.89 and ΔsrbA: Treatment with MIC50 of fluconazole or voriconazole in liquid GMM at 37 °C with shaking at 300 rpm CBS 144.89, ΔsrbA and pniiA-erg11A-ΔsrbA: Liquid GMM plus 20 mM NO3 for 12 h and liquid GMM plus 20 mM NH4 at 37 °C with shaking at 300 rpm | [60] | |
GAPDH | ||||
tefA | ||||
Actin | Y | Mandels’ salt solution with 1% oat spelts xylan for 0, 2, 4, 6 and 17 h | [16] | |
Histone H4 | ||||
Actin | N | RPMI medium at 37 °C for 0, 2, 4, 6, and 8 h | [21] | |
Actin | N | Treatment with 24,700, 12,300 and 6170 µg/mL kombucha during growth in RPMI medium at 35 °C for 48 h | [61] | |
Beta-tubulin | N | Yeast extract-peptone-dextrose (YEPD) media with 10 μg/mL (H11-20) or 100 μg/mL of itraconazole for 8 h at 37 °C | [62] | |
Beta-tubulin | N | Treatment with 0.5 μg of voriconazole or without voriconazole in yeast glucose (YG) medium for 30, 60, 120, and 240 min | [63] | |
Beta-tubulin | N | AMM containing 0, 1, 10, 100, 1000 μM of FeSO4 at 37 °C for 24 h with 150 rpm shaking | [64] | |
Beta-tubulin | N | MEM supplemented with 10% (v/v) human serum (male) and 50 μM FeCl3 at 37 °C for 6 h | [65] | |
Beta-tubulin | N | Growth in mouse lung alveoli for 4 h or 14 h | [66] | |
Beta-tubulin * | N | Four formed fungi balls or 2 mL of fungal suspension in NaCl incubated for 3 h at 25, 30, 35 and 40 °C | [67] | |
Beta-tubulin * | N | Treatment with sub-lethal and lethal amphotericin B (AmB) concentrations in Sabouraud medium for 24 h at 37 °C with shaking | [68] | |
Beta-tubulin | N | Treatment with 4 mg/L itraconazole or dimethyl sulfoxide in Vogel’s medium at 37 °C with shaking at 250 rpm for 14 to 16 h | [69] | |
Beta-tubulin | N | Growth in mouse lungs subcutaneously injected with 40 mg/kg Kenalog 1 day, or intraperitoneally with 175 mg/kg of cyclophosphamide 2 days prior to inoculation | [70] | |
tefA | ||||
GAPDH | N | Exposure of A. fumigatus to human airway epithelial cells or human bronchial epithelial cells | [31] | |
GAPDH | N | Treatment with 10 ng/mL of itraconazole (CEA17) or 5 μg/mL of itraconazole (mutant strains) in YG medium supplemented with 1.2 g/L of uracil and uridine for 24 h at 37 °C | [71] | |
Putative 1,3-beta-glucan synthase catalytic subunit | N | Barrat’s minimal nitrate medium in the presence or absence of oxidative stress and/or iron-limitation for 33 h and 50 h | [72] | |
TEF1 | N | in vitro: (1) YPD media for 4 h, 8 h and 1 to 7 days at 37 °C, (2) YPD media for 24 h at 37 °C (3) YPD or RPMI medium for 24 h and 72 h at 37 °C, (4) YPD medium for 5 to 8 days at 37 °C in vivo: (1) Mouse lung incubation for 4 h, 8 h, and 1 to 7 days, (2) mouse lung incubation for 24 h and 72 h, (3) mouse lung incubation for 5 to 8 days | [73] | |
TEF1 | N | Growth in a glucose (3%)-yeast extract (YE; 1%) liquid medium at 37 °C for 16 h | [74] | |
A. luchuensis | Actin | N | Growth on rice as rice koji and sampling at the stages in the process of shimaishigoto (40 °C, 30 h) and dekoji (40 h) | [26] |
Actin | N | Citric acid production (CAP) medium at 30 °C for 0 h or 12 h with shaking at 163 rpm | [75] | |
A. nidulans | Actin | N | Low or high inorganic phosphate yeast extract medium (YEM) and MM at 37 °C for 17 h with shaking at 200 rpm | [76] |
Beta-tubulin | ||||
Actin | Y | Yeast extract-agar-glucose (YAG) supplemented with 15% polyethylene glycol (PEG) (w/v) compared to YAG without supplementation for 2 days | [77] | |
Actin | N | Complete medium (CM) or MM with inducing or non-inducing supplements at 28 °C for 16 h with 250 rpm shaking | [78] | |
Actin | N | YAG supplemented with 5 mM uridine and 10 mM uracil (YUU) at 37 °C for 24 h | [79] | |
Actin | Y | MM supplemented with 0.1% fructose and 5 mM urea at 30 °C for 15 h with shaking at 150 rpm | [30] | |
GAPDH | ||||
Beta-tubulin | N | YG medium in the presence or absence of drugs (camptothecin, imazalil, itraconazole, hygromycin, and 4-nitroquinoline oxide) for 8 h | [80] | |
Beta-tubulin | N | 3% lactose MM for 18 h, after which a source of induction and/or repression was added, and cultures incubated for 4 h | [81] | |
Beta-tubulin | N | MM with exposure to light or darkness at 23 °C for 24 h (spores) or 30 °C for 40 h in distilled water (conidia) | [82] | |
Histone 2B | ||||
Beta-tubulin * | N | MM supplemented with 50 mM ethyl methyl ketone or 1% glucose at 37 °C for 16 h to 18 h with shaking at 150 rpm | [83] | |
EEF-3 Elongation Factor | N | Glucose-free minimal nitrate medium or minimal nitrate medium at 37 °C for 4 h or 24 h | [84] | |
NAPDH | N | Modified MMPKRUU medium under K sufficient or deficient conditions at 37 °C for 24 h with shaking at 220 rpm | [85] | |
Putative ribosomal protein L37 | Y | Liquid MM under standard conditions | [86] | |
Putative ribosomal protein L3 | ||||
A. niger | 18S rRNA | N | PDA supplemented with different carbon and nitrogen sources | [87] |
18S rRNA * | N | Subculturing of transformants in the presence of 1.25 mg/mL of 5-fluoroorotic acid with uridine and uracil | [88] | |
Actin | N | Liquid AMM for 0, 3, 6, 12 and 72 h and on AMM plates for 5 days | [89] | |
Actin | N | Liquefied corn starch medium at 35 °C for 72 h with shaking at 330 rpm | [90] | |
GAPDH | ||||
Actin | N | CM for 25 h | [91] | |
GAPDH | N | Glucose maltose polypeptone yeast extract (GMPY) media at 30 °C and 250 rpm for 2 days | [92] | |
Histone H2B | N | MM supplemented with L-rhamnose or L-rhamnonate at 30 °C with shaking at 250 rpm | [93] | |
Histone-encoding Gene | Y | Growth in bioreactors on sorbitol as the carbon source with 1 mM D-xylose or 50 mM D-xylose | [94] | |
A. nomius | Calmodulin | N | Coconut agar at 25, 30 and 35 °C for 7 days | [95] |
A. oryzae | 18S rRNA * | N | Subculturing of transformants in the presence of 1.25 mg/mL of 5-fluoroorotic acid with uridine and uracil | [88] |
Actin | N | MM whole culture broth grown on a cellulose nitrate filter for 42 to 48 h until pigmented conidiospores present | [96] | |
Actin | N | DPY agar medium for 48 h | [25] | |
Actin | N | PDA medium at 30 °C for 7 days | [97] | |
Beta-tubulin | N | Modified Czapek–Dox (CD) minimal agar at 30 °C for 48 h with 200 rpm shaking | [98] | |
Beta-tubulin * | N | (1) α-amylase transcripts: Inducing (1% sorbitol plus 1% starch), non-inducing (1% sorbitol), and repressing (1% sorbitol plus 1% starch plus 2% sucrose) conditions for 48 h (2) glucoamylase A transcripts: Inducing conditions (in 1% starch) or repressing conditions (in 2% sucrose) at 30 °C for 24 h | [83] | |
Histone H1 | N | Growth on 5 g of wheat bran containing 2, 3, 4, 6 or 8 mL of water at 30 °C for 48 h | [99] | |
Histone H1 | N | MM at 30 °C for 5 days | [100] | |
Histone H2A | N | DPY liquid medium at 30 °C for 2 days | [101] | |
A. parasiticus | 18S rRNA * | N | Adye and Mateles (1964) medium for 48 h and 72 h | [102] |
18S rRNA | N | Stationary phase culture growth in PDB 30 °C for 4 days in the dark | [29] | |
Actin | Y | Treatment with 0, 0.25, 0.5 or l.0 μg/mL aflastatin A for 1.5 to 3.5 days in PDB at 27 °C | [103] | |
Actin | N | RPMI medium containing 25 or 50 mg/mL of vitamin C for 3 days at 28 °C | [104] | |
Actin | Y | Co-incubation with Kluyveromyces lactis at 30 °C for 48 h | [105] | |
Beta-tubulin * | N | YES or YEP media at 28 °C for 4 days | [48] | |
Beta-tubulin | N | Yeast extract sucrose peptone (YESP) medium modified with 1% sodium nitrate (YESP-N) or 1% tryptophan (YESP-T) at 10, 15, 25, 30 and 37 °C for 96 h with shaking at 100 rpm | [106] | |
Beta-tubulin * | N | Treatment or no treatment with the subinhibitory concentrations of carvacrol or trans-cinnamaldehyde in PDB at 25 °C for 5 days | [50] | |
Beta-tubulin * | Y | YES medium containing one of four antifungal peptides: PPD1, 66-10, 77-3, or D4E1 | [55] | |
A. sojae | 18S rRNA * | N | Adye and Mateles (1964) medium for 48 h and 72 h | [102] |
A. terreus | Actin | Y | Lovastatin production media at 27 °C for 10 days with shaking at 220 rpm | [107] |
Actin | N | MID medium for 10 days after which 0.5, 1.0, 3.0 and 5.0% (w/v) of surface sterilised Podocarpus. gracilior leaves were added and incubated together for 20 days | [108] | |
Beta-tubulin * | N | Four formed fungi balls or 2 mL of fungal suspension in NaCl incubated for 3 h at 25, 30, 35 and 40 °C | [67] | |
Beta-tubulin * | N | Treatment with sublethal and lethal concentrations of AmB in Sabouraud media at 37 °C for 24 h with slight shaking | [68] | |
A. westerdijkiae | Beta-tubulin | N | CYA in the presence or absence of Debaryomyces hansenii at 28 °C for 3 and 7 days | [109] |
GAPDH | N | YES medium at 25 °C for 96 h | [110] |
Species | Reference Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Experimental Conditions | Ref. |
---|---|---|---|---|---|
A. aculeatus | GAPDH | TACCGCTGCCCAGAACATCA | GGAGTGGCTGTCACCGTTCA | Minimal media (MM) with 1% (w/v) polypeptone, 1% (w/v) glucose, 1% (w/v) avicel, 1% (w/v) xylose, or 1% (w/v) arabinose for 3 h or 6 h | [35] |
A. carbonarius | Ubiquitin-conjugating Enzyme | CCGAAGGTCAACTTCACCAC | GGCATATTTGCGAGTCCATT | MM at 25 °C, without shaking (ochratoxin A (OTA)-inducing) conditions, for 4, 6 and 8 days in the dark | [32] |
A. fischeri | Beta-tubulin | GCTCTTCCGTCCCGATAACTT | CCTTGGCCCAGTTGTTACCA | Growth on a hydrophobic polyvinylidene fluoride (PVDF) membrane on top of oatmeal agar for 3, 6 or 30 days (wildtype only) | [38] |
Histone 3 | CAAGAAGCCTCACCGCTACAAG | GACTTCTGGTAGCGACGGATTT | |||
A. flavus | 18S rRNA | GCAAATTACCCAATCCCGACAC | GAATTACCGCGGCTGCTG | Co-culture with Listeria monocytogenes in malt extract broth (MEB) at 25 °C and 30 °C for 7 days | [41] |
Beta-tubulin | CGCATGAACGTCTACTTCAACGAG | AGTTGTTACCAGCAGCGGACT | |||
Calmodulin | CTTCCCCGAATTCCTTACC | TCACGGATCATCTCATCGAC | |||
Beta-tubulin | CTTGTTGACCAGGTTGTCGAT * | GTCGCAGCCCTCAGCCT* | Inoculated onto 25 g of wheat and grown at 30 °C in open petri dishes with wetted filter paper for 9 days | [46] | |
Beta-tubulin | AACGTCTACTTCAACGAGGCCA | GTACCAGGCTCAAGATCAACGAG | Malt extract agar (MEA) media supplemented with 0.5 mM eugenol for 4 days at 27 °C in the dark | [52] | |
GAPDH | CGTGTTGTTGACCTCATTGCCT | GGTGACCTGATAATCCGGGAAC | |||
Beta-tubulin | AACGTCTACTTCAACGAGGCCA | GTACCAGGCTCAAGATCAACGAG | Co-incubation with Streptomyces roseolus on International Streptomyces Project-2 (ISP2) medium at 30 °C for 4 days at a relative humidity of 80% in a Vötsch chamber | [54] | |
GAPDH | CGTGTTGTTGACCTCATTGCCT | GGTGACCTGATAATCCGGGAAC | |||
Beta-tubulin | TCTCCAAGATCCGTGAGGAG | TTCAGGTCACCGTAAGAGGG | Yeast extract sucrose (YES) medium containing one of four antifungal peptides: PPD1, 66-10, 77-3, or D4E1 | [55] | |
Cytochrome C oxidase Subunit V | CGTCATTCACTTGTTCGCTAAG | CCTTGGCATACTCGTTGGAAG | Sucrose low salts (SLS), SLS supplemented with 117 mM ammonium sulphate, and lactose low salts, at acidic or alkaline pH | [111] | |
Histone H4 | TCGTCGTGGTGGTGTCAAG | TTGGCGTGCTCAGTGTAGG | |||
A. fumigatus | 18S rRNA | TCTTGTTAAACCCTGTCGTGCTGG | GTGTACAAAGGGCAGGGACGTAAT | Treatment with 125 μg/mL artemisinin or solvent for 3 h in Roswell Park Memorial Institute (RPMI) 1640 medium at 37 °C | [27] |
Actin | TGCCCTTGCTCCCTCGTCTA | ACCGCTCTCGTCGTACTCCT | Mandels’ salt solution with 1% oat spelts xylan for 0, 2, 4, 6 and 17 h | [16] | |
Histone H4 | GCTCGTCGTGGTGGTGTCAA | TGGCGTGCTCAGTGTAGGTG | |||
A. nidulans | Actin | TCAATCCCAAGTCCAACC (Tm 57 °C) | TACGACCGGAAGCATACA (Tm 57 °C) | Yeast extract-agar-glucose (YAG) supplemented with 15% polyethylene glycol (PEG) (w/v) compared to YAG without supplementation for 2 days | [77] |
AATGGTTCGGGTATGTGC (Tm 60 °C) | ACGCTTGGACTGTGCCTC (Tm 60 °C) | ||||
Actin-like protein | GTACGATGAGAGCGGTCCTT | CAGAAAATACGCGACAACGA | MM supplemented with 0.1% fructose and 5 mM urea at 30 °C for 15 h with shaking at 150 rpm | [30] | |
GAPDH | CGACAACGAGTGGGGTTACT | GGCATCAACCTTGGAGATGT | |||
Calmodulin | CCGAGTACAAGGAAGCTTTCTC | GAATCATCTCGTCGACTTCGTCGTCAGT | WB/MM supplemented with high, low or no iron for 24, 48 and 72 h | [144] | |
Putative ribosomal protein L3 | TTCCTCGCAAGACTCACAAG | TTGTGGTTGCAAGAGGTACG | Liquid MM under standard conditions | [86] | |
Putative ribosomal protein L37 | CGCCACAACAAAACTCACAC | TCTCGCTCCAGTTGTACTTGC | |||
A. niger | Actin | GGTCTGGAGAGCGGTGGTAT | cactgcGAAGAAGGAGCAAGAGCAGtG | glaA-inducing and -non-inducing conditions in modified Vogel-Medium with stir speeds and pH from 400–1000 per min and 3.0 to 5.5, respectively | [160] |
Cytochrome C oxidase Subunit V | GACCAAGGAGTGGCAGGAG | gaactgGGTGGGAGGCAGCAGtTC | |||
Secretion Associated Binding Protein | gaacctACGGGTAAGGGCAAGGtTC | TCGCAACAATAAAGTCAACAGC | |||
Histone-encoding Gene | ATCTTGCGTGACAACATCCA | CACCCTCAAGGAAGGTCTTG | Growth in bioreactors on sorbitol as the carbon source with 1 mM D-xylose or 50 mM D-xylose | [94] | |
A. parasiticus | Actin | CTTGACTTCGAGCAGGAGAT | TCTGGATACGGTCGGAGATA | Treatment with or without 1.0 μM of blasticidin A in potato dextrose broth (PDB) at 27 °C for 2 days | [140] |
Actin | CGCGGATACACCTTCTCCACTA * | ACGTAGCAGAGCTTCTCCTTGA * | Treatment with 0, 0.25, 0.5 or l.0 μg/mL aflastatin A for 1.5 to 3.5 days in PDB at 27 °C | [103] | |
Actin | NA | NA | Co-incubation with Kluyveromyces lactis at 30 °C for 48 h | [105] | |
Beta-tubulin | TCTCCAAGATCCGTGAGGAG | TTCAGGTCACCGTAAGAGGG | YES medium containing one of four antifungal peptides: PPD1, 66-10, 77-3, or D4E1 | [55] | |
A. terreus | Actin | TCGTGACTTGACCGACTACC | TGATGTCACGGACGATTTCA | Lovastatin production media at 27 °C for 10 days with shaking at 220 rpm | [107] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Archer, M.; Xu, J. Current Practices for Reference Gene Selection in RT-qPCR of Aspergillus: Outlook and Recommendations for the Future. Genes 2021, 12, 960. https://doi.org/10.3390/genes12070960
Archer M, Xu J. Current Practices for Reference Gene Selection in RT-qPCR of Aspergillus: Outlook and Recommendations for the Future. Genes. 2021; 12(7):960. https://doi.org/10.3390/genes12070960
Chicago/Turabian StyleArcher, Meagan, and Jianping Xu. 2021. "Current Practices for Reference Gene Selection in RT-qPCR of Aspergillus: Outlook and Recommendations for the Future" Genes 12, no. 7: 960. https://doi.org/10.3390/genes12070960