Genome-Wide Analysis and Expression Profiles of the VOZ Gene Family in Quinoa (Chenopodium quinoa)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and Stress Treatments
2.2. Genome-Wide Identification and Chromosomal Location of the VOZ Genes in Quinoa
2.3. Phylogenetic Analysis
2.4. Gene Structure and Conserved Motif Analysis
2.5. Protein Structure Analysis of CqVOZs
2.6. RNA Extraction and qRT-PCR Analysis
3. Results
3.1. Identification and Characterization of CqVOZ Gene Family
3.2. Phylogenetic Analysis of CqVOZ Genes
3.3. Gene Structures and Conserved Motifs of CqVOZs
3.4. Analysis of CqVOZ Protein Structures
3.5. CqVOZs Expression Profiling in Different Tissues
3.6. Expression Analysis of CqVOZs under Abiotic Stress Treatments
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sarwar, R.; Geng, R.; Li, L.; Shan, Y.; Zhu, K.-M.; Wang, J.; Tan, X.-L. Genome-Wide Prediction, Functional Divergence, and Characterization of Stress-Responsive BZR Transcription Factors in B. napus. Front. Plant Sci. 2022, 12, 790655. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.-K. Abiotic Stress Signaling and Responses in Plants. Cell 2016, 167, 313–324. [Google Scholar] [CrossRef]
- Ohama, N.; Sato, H.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Transcriptional Regulatory Network of Plant Heat Stress Response. Trends Plant Sci. 2018, 22, 53–65. [Google Scholar] [CrossRef]
- Gupta, B.; Huang, B. Mechanism of Salinity Tolerance in Plants: Physiological, Biochemical, and Molecular Characterization. Int. J. Genom. 2014, 2014, 701596. [Google Scholar] [CrossRef]
- Khan, S.-A.; Li, M.-Z.; Wang, S.-M.; Yin, H.-J. Revisiting the Role of Plant Transcription Factors in the Battle against Abiotic Stress. Int. J. Mol. Sci. 2018, 19, 1634. [Google Scholar] [CrossRef]
- Baillo, E.H.; Kimotho, R.N.; Zhang, Z.; Xu, P. Transcription Factors Associated with Abiotic and Biotic Stress Tolerance and Their Potential for Crops Improvement. Genes 2019, 10, 771. [Google Scholar] [CrossRef]
- Wang, H.; Wang, H.; Shao, H.; Tang, X. Recent advances in utilizing transcription factors to improve plant abiotic stress tolerance by transgenic technology. Front. Plant Sci. 2016, 7, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Jin, J.; Tian, F.; Yang, D.-C.; Meng, Y.-Q.; Kong, L.; Luo, J.; Gao, G. PlantTFDB 4.0: Toward a central hub for transcription factors and regulatory interactions in plants. Nucleic Acids Res. 2017, 45, D1040–D1045. [Google Scholar] [CrossRef]
- Liu, L.; Zhang, Z.; Dong, J.; Wang, T. Overexpression of MtWRKY76 increases both salt and drought tolerance in Medicago truncatula. Environ. Exp. Bot. 2016, 123, 50–58. [Google Scholar] [CrossRef]
- Lee, H.G.; Seo, P.J. The MYB96-HHP module integrates cold and abscisic acid signaling to activate the CBF-COR pathway in Arabidopsis. Plant J. 2015, 82, 962–977. [Google Scholar] [CrossRef] [PubMed]
- Shahnejat-Bushehri, S.; Tarkowska, D.; Sakuraba, Y.; Balazadeh, S. Arabidopsis NAC transcription factor JUB1 regulates GA/BR metabolism and signalling. Nat. Plants 2016, 2, 16013. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Yang, Y.; Liu, D.; Wang, X.; Zhang, L. Transcription factor TabHLH49 positively regulates dehydrin WZY2 gene expression and enhances drought stress tolerance in wheat. BMC Plant Biol. 2020, 20, 259. [Google Scholar] [CrossRef] [PubMed]
- Liang, Y.; Xia, J.; Jiang, Y.; Bao, Y.; Chen, H.; Wang, D.; Zhang, D.; Yu, J.; Cang, J. Genome-Wide Identification and Analysis of bZIP Gene Family and Resistance of TaABI5 (TabZIP96) under Freezing Stress in Wheat (Triticum aestivum). Int. J. Mol. Sci. 2022, 23, 2351. [Google Scholar] [CrossRef]
- Mitsuda, N.; Hisabori, T.; Takeyasu, K.; Sato, M.H. VOZ.; Isolation and Characterization of Novel Vascular Plant Transcription Factors with a One-Zinc Finger from Arabidopsis thaliana. Plant Cell Physiol. 2004, 45, 845–854. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Zheng, J.-C.; Wang, T.-T.; Min, D.-H.; Wei, W.-L.; Chen, J.; Zhou, Y.-B.; Chen, M.; Xu, Z.-S.; Ma, Y.-Z. Expression Analyses of Soybean VOZ Transcription Factors and the Role of GmVOZ1G in Drought and Salt Stress Tolerance. Int. J. Mol. Sci. 2020, 21, 2177. [Google Scholar] [CrossRef] [PubMed]
- Prasad, K.V.S.K.; Xing, D.; Reddy, A.S.N. Vascular Plant One-Zinc-Finger (VOZ) Transcription Factors Are Positive Regulators of Salt Tolerance in Arabidopsis. Int. J. Mol. Sci. 2018, 19, 3731. [Google Scholar] [CrossRef] [PubMed]
- Rehman, S.U.; Qanmber, G.; Tahir, M.H.N.; Irshad, A.; Fiaz, S.; Ahmad, F.; Ali, Z.; Sajjad, M.; Shees, M.; Usman, M.; et al. Characterization of Vascular plant One-Zinc finger (VOZ) in soybean (Glycine max and Glycine soja) and their expression analyses under drought condition. PLoS ONE 2021, 16, e0253836. [Google Scholar] [CrossRef] [PubMed]
- Celesnik, H.; Ali, G.S.; Robison, F.M.; Reddy, A.S.N. Arabidopsis thaliana VOZ (Vascular plant One-Zinc finger) transcription factors are required for proper regulation of flowering time. Biol. Open 2013, 2, 424–431. [Google Scholar] [CrossRef] [PubMed]
- Yasui, Y.; Mukougawa, K.; Uemoto, M.; Yokofuji, A.; Suzuri, R.; Nishitani, A.; Kohchi, T. The Phytochrome-Interacting VASCULAR PLANT ONE–ZINC FINGER1 and VOZ2 Redundantly Regulate Flowering in Arabidopsis. Plant Cell 2012, 24, 3248–3263. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Choudhary, P.; Gupta, M.; Nath, U. VASCULAR PLANT ONE-ZINC FINGER1 (VOZ1) and VOZ2 Interact with CONSTANS and Promote Photoperiodic Flowering Transition. Plant Physiol. 2018, 176, 2917–2930. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Wang, R.; Fang, H.; Zhang, C.; Zhang, F.; Hao, Z.; You, X.; Shi, X.; Park, C.H.; Hua, K.; et al. Two VOZ transcription factors link an E3 ligase and an NLR immune receptor to modulate immunity in rice. Mol. Plant 2021, 14, 253–266. [Google Scholar] [CrossRef] [PubMed]
- Nakai, Y.; Fujiwara, S.; Kubo, Y.; Sato, M.H. Overexpression of VOZ2 confers biotic stress tolerance but decreases abiotic stress resistance in Arabidopsis. Plant Signal. Behav. 2013, 8, e23358. [Google Scholar] [CrossRef] [PubMed]
- Nakai, Y.; Nakahira, Y.; Sumida, H.; Takebayashi, K.; Nagasawa, Y.; Yamasaki, K.; Akiyama, M.; Ohme-Takagi, M.; Fujiwara, S.; Shiina, T.; et al. Vascular plant one-zinc-finger protein 1/2 transcription factors regulate abiotic and biotic stress responses in Arabidopsis. Plant J. 2013, 73, 761–775. [Google Scholar] [CrossRef] [PubMed]
- Selote, D.; Matthiadis, A.; Gillikin, J.W.; Sato, M.H.; Long, T.A. The E3 ligase BRUTUS facilitates degradation of VOZ1/2 transcription factors. Plant Cell Environ. 2018, 41, 2463–2474. [Google Scholar] [CrossRef] [PubMed]
- Song, C.; Lee, J.; Kim, T.; Hong, J.C.; Lim, C.O. VOZ1, a transcriptional repressor of DREB2C, mediates heat stress responses in Arabidopsis. Planta 2018, 247, 1439–1448. [Google Scholar] [CrossRef]
- Koguchi, M.; Yamasaki, K.; Hirano, T.; Sato, M.H. Vascular plant one-zinc-finger protein 2 is localized both to the nucleus and stress granules under heat stress in Arabidopsis. Plant Signal. Behav. 2017, 12, e1295907. [Google Scholar] [CrossRef]
- Gao, B.; Chen, M.; Li, X.; Liang, Y.; Zhu, F.; Liu, T.; Zhang, D.; Wood, A.J.; Oliver, M.J.; Zhang, J. Evolution by duplication: Paleopolyploidy events in plants reconstructed by deciphering the evolutionary history of VOZ transcription factors. BMC Plant Biol. 2018, 18, 256. [Google Scholar] [CrossRef]
- Jacobsen, S.-E. The Worldwide Potential for Quinoa (Chenopodium quinoa Willd.). Food Rev. Int. 2003, 19, 167–177. [Google Scholar] [CrossRef]
- Jancurová, M.; Minarovicova, L.; Dandár, A. Quinoa—A review. J. Food Sci. 2009, 27, 71–79. [Google Scholar]
- Yasui, Y.; Hirakawa, H.; Oikawa, T.; Toyoshima, M.; Matsuzaki, C.; Ueno, M.; Mizuno, N.; Nagatoshi, Y.; Imamura, T.; Miyago, M.; et al. Draft genome sequence of an inbred line of Chenopodium quinoa, an allotetraploid crop with great environmental adaptability and outstanding nutritional properties. DNA Res. 2016, 23, 535–546. [Google Scholar] [CrossRef]
- Vega-Gálvez, A.; Miranda, M.; Vergara, J.; Uribe, E.; Puente, L.; Martínez, E.A. Nutrition facts and functional potential of quinoa (Chenopodium quinoa willd.), an ancient Andean grain: A review. J. Sci. Food Agric. 2010, 90, 2541–2547. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.; Han, P.; Li, Y.; Wang, W.; Lai, D.; Zhou, L. Quinoa Secondary Metabolites and Their Biological Activities or Functions. Molecules 2019, 24, 2512. [Google Scholar] [CrossRef]
- Pereira, E.; Encina-Zelada, C.; Barros, L.; Gonzales-Barron, U.; Cadavez, V.; Ferreira, I.C. Chemical and nutritional characterization of Chenopodium quinoa Willd (quinoa) grains: A good alternative to nutritious food. Food Chem. 2018, 280, 110–114. [Google Scholar] [CrossRef] [PubMed]
- Jacobsen, S.-E.; Monteros, C.; Corcuera, L.; Bravo, L.; Christiansen, J.; Mujica, A. Frost resistance mechanisms in quinoa (Chenopodium quinoa Willd.). Eur. J. Agron. 2007, 26, 471–475. [Google Scholar] [CrossRef]
- Shi, P.; Gu, M. Transcriptome analysis and differential gene expression profiling of two contrasting quinoa genotypes in response to salt stress. BMC Plant Biol. 2020, 20, 568. [Google Scholar] [CrossRef] [PubMed]
- Lin, P.H.; Chao, Y.Y. Different drought-tolerant mechanisms in quinoa (Chenopodium quinoa Willd.) and djulis (Chenopodium formosanum Koidz.) based on physiological analysis. Plants 2021, 10, 2279. [Google Scholar] [CrossRef]
- Xie, H.; Wang, Q.; Zhang, P.; Zhang, X.; Huang, T.; Guo, Y.; Liu, J.; Li, L.; Li, H.; Qin, P. Transcriptomic and Metabolomic Analysis of the Response of Quinoa Seedlings to Low Temperatures. Biomolecules 2022, 12, 977. [Google Scholar] [CrossRef]
- Maleki, P.; Bahrami, H.A.; Saadat, S.; Sharifi, F.; Dehghany, F.; Salehi, M. Salinity threshold value of quinoa (Chenopodium quinoa Willd.) at various growth stages and the appropriate irrigation method by saline water. Comm. Soil Sci. Plant Anal. 2018, 49, 1815–1825. [Google Scholar] [CrossRef]
- Bazile, D.; Jacobsen, S.-E.; Verniau, A. The Global Expansion of Quinoa: Trends and Limits. Front. Plant Sci. 2016, 7, 622. [Google Scholar] [CrossRef]
- Jarvis, D.E.; Ho, Y.S.; Lightfoot, D.J.; Schmöckel, S.M.; Li, B.; Borm, T.J.A.; Ohyanagi, H.; Mineta, K.; Michell, C.T.; Saber, N.; et al. The genome of Chenopodium quinoa. Nature 2017, 542, 307–312. [Google Scholar] [CrossRef] [PubMed]
- Voorrips, R.E. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef] [Green Version]
- Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Deng, W.; Wang, Y.; Liu, Z.; Cheng, H.; Xue, Y. HemI: A Toolkit for Illustrating Heatmaps. PLoS ONE 2014, 9, e111988. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Mao, L.; Wang, H.; Brocker, C.; Yin, X.; Vasiliou, V.; Fei, Z.; Wang, X. Genome-Wide Identification and Analysis of Grape Aldehyde Dehydrogenase (ALDH) Gene Superfamily. PLoS ONE 2012, 7, e32153. [Google Scholar] [CrossRef]
- Schmöckel, S.M.; Lightfoot, D.J.; Razali, R.; Tester, M.; Jarvis, D.E. Identification of Putative Transmembrane Proteins Involved in Salinity Tolerance in Chenopodium quinoa by Integrating Physiological Data, RNAseq, and SNP Analyses. Front. Plant Sci. 2017, 8, 1023. [Google Scholar] [CrossRef]
- Tian, F.; Yang, D.-C.; Meng, Y.-Q.; Jin, J.; Gao, G. PlantRegMap: Charting functional regulatory maps in plants. Nucleic Acids Res. 2019, 48, D1104–D1113. [Google Scholar] [CrossRef] [PubMed]
- Yue, H.; Shu, D.; Wang, M.; Xing, G.; Zhan, H.; Du, X.; Song, W.; Nie, X. Genome-Wide Identification and Expression Analysis of the HD-Zip Gene Family in Wheat (Triticum aestivum L.). Genes 2018, 9, 70. [Google Scholar] [CrossRef] [PubMed]
- Shen, X.-X.; Salichos, L.; Rokas, A. A Genome-Scale Investigation of How Sequence, Function, and Tree-Based Gene Properties Influence Phylogenetic Inference. Genome Biol. Evol. 2016, 8, 2565–2580. [Google Scholar] [CrossRef]
- Kellogg, E.A. Evolutionary History of the Grasses. Plant Physiol. 2001, 125, 1198–1205. [Google Scholar] [CrossRef] [PubMed]
- Long, M.; Rosenberg, C.; Gilbert, W. Intron phase correlations and the evolution of the intron/exon structure of genes. Proc. Natl. Acad. Sci. USA 1995, 92, 12495–12499. [Google Scholar] [CrossRef] [Green Version]
- Xu, G.; Guo, C.; Shan, H.; Kong, H. Divergence of duplicate genes in exon–intron structure. Proc. Natl. Acad. Sci. USA 2012, 109, 1187–1192. [Google Scholar] [CrossRef]
- Wu, G.Q.; Wang, J.L.; Li, S.J. Genome-wide identification of Na+/H+ antiporter (NHX) genes in sugar beet (B vulgaris L.) and their regulated expression under salt stress. Genes 2019, 10, 401. [Google Scholar] [CrossRef] [PubMed]
- Jin, Z.; Chandrasekaran, U.; Liu, A. Genome-wide analysis of the Dof transcription factors in castor bean (Ricinus communis L.). Genes Genom. 2014, 36, 527–537. [Google Scholar] [CrossRef]
- Liu, X.; Chu, Z. Genome-wide evolutionary characterization and analysis of bZIP transcription factors and their expression profiles in response to multiple abiotic stresses in Brachypodium distachyon. BMC Genom. 2015, 16, 227. [Google Scholar] [CrossRef] [Green Version]
Gene Name | Forward Primer Sequence (5’–3’) | Reverse Primer Sequence (5’–3’) |
---|---|---|
CqEF1α | GTACGCATGGGTGCTTGACAAACTC | ATCAGCCTGGGAGGTACCAGTAAT |
CqVOZ1 | GCTGTAACTTCAGATATTTGAAG | GTGCTGGGACATTGTGCACAT |
CqVOZ2 | CTCCTCCAATCTAGGGCATCT | CTCGGAATTAGAGACAGAATCG |
CqVOZ3 | CTCTCTATCGTTGTCATCATCT | GTTGATAAGATCTTTGTTATAA |
CqVOZ4 | GTCGACCGAGTAGGAGAAGA | CCTCGTACTAAGTCACCACATTAC |
Gene Name | Gene ID | Chr | Genomic Location | ORF | Exon | AA | MW (kDa) | pI | Subcellular Localization |
---|---|---|---|---|---|---|---|---|---|
CqVOZ1 | AUR62014889 | 1 | 32490238..32496540 | 1455 | 4 | 484 | 54.31 | 5.70 | Nucleus |
CqVOZ2 | AUR62024758 | 1 | 46806664..46811534 | 1569 | 4 | 522 | 58.08 | 5.48 | Nucleus |
CqVOZ3 | AUR62031095 | 2 | 5865078..5869942 | 1230 | 3 | 409 | 45.93 | 7.56 | Nucleus |
CqVOZ4 | AUR62037692 | 4 | 51222056..51226916 | 1566 | 4 | 521 | 57.93 | 5.49 | Nucleus |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, P.; Jiang, R.; Li, B.; Wang, D.; Fang, D.; Yin, M.; Yin, M.; Gu, M. Genome-Wide Analysis and Expression Profiles of the VOZ Gene Family in Quinoa (Chenopodium quinoa). Genes 2022, 13, 1695. https://doi.org/10.3390/genes13101695
Shi P, Jiang R, Li B, Wang D, Fang D, Yin M, Yin M, Gu M. Genome-Wide Analysis and Expression Profiles of the VOZ Gene Family in Quinoa (Chenopodium quinoa). Genes. 2022; 13(10):1695. https://doi.org/10.3390/genes13101695
Chicago/Turabian StyleShi, Pibiao, Runzhi Jiang, Bin Li, Deling Wang, Di Fang, Min Yin, Mingming Yin, and Minfeng Gu. 2022. "Genome-Wide Analysis and Expression Profiles of the VOZ Gene Family in Quinoa (Chenopodium quinoa)" Genes 13, no. 10: 1695. https://doi.org/10.3390/genes13101695