Genotyping by Sequencing (GBS)-Based QTL Mapping for Bacterial Fruit Blotch (BFB) in Watermelon
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Pathogen Culture and Inoculation
2.3. Phenotyping
2.4. Extraction of Genomic DNA
2.5. Genotyping by Sequencing and QTL Mapping
2.6. High-Resolution Melting Analysis
2.7. Statistical Data Analysis
3. Results
3.1. Inheritance of Resistance to BFB in Watermelon
3.2. QTLs for Resistance to BFB
3.3. SNP Genotyping Using High-Resolution Melting (HRM) Assays
3.4. Candidate Genes Identification
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Webb, R.; Goth, R. A seedborne bacterium isolated from watermelon. Plant Dis. Report. 1965, 49, 818–821. [Google Scholar]
- Schaad, N.W.; Postnikova, E.; Sechler, A.; Claflin, L.E.; Vidaver, A.K.; Jones, J.B.; Agarkova, I.; Ignatov, A.; Dickstein, E.; Ramundo, B.A. Reclassification of subspecies of Acidovorax avenae as A. Avenae (Manns 1905) emend., A. cattleyae (Pavarino, 1911) comb. nov., A. citrulli Schaad et al., 1978) comb. nov., and proposal of A. oryzae sp. nov. Syst. Appl. Microbiol. 2008, 31, 434–446. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bahar, O.; Burdman, S. Bacterial fruit blotch: A threat to the cucurbit industry. Isr. J. Plant Sci. 2010, 58, 19–31. [Google Scholar] [CrossRef]
- Burdman, S.; Walcott, R. Acidovorax citrulli: Generating basic and applied knowledge to tackle a global threat to the cucurbit industry. Mol. Plant Pathol. 2012, 13, 805–815. [Google Scholar] [CrossRef]
- Silva, G.M.; Souza, R.M.; Yan, L.; Júnior, R.S.; Medeiros, F.H.; Walcott, R.R. Strains of the group I lineage of Acidovorax citrulli, the causal agent of bacterial fruit blotch of cucurbitaceous crops, are predominant in Brazil. Phytopathology 2016, 106, 1486–1494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Crall, J.; Schenck, N. Bacterial fruit rot of watermelon in Florida. Plant Dis. Rep. 1969, 53, 74–75. [Google Scholar]
- Noh, J.; Kim, J.-H.; Lim, J.H.; Kim, T.B.; Seong, M.H.; Jung, G.T.; Kim, J.M.; Cheong, S.-S.; Oh, N.K.; Lee, W.-H. Occurrence of diseases and case of clinical diagnosis on watermelon in South Korea, 2008–2012. Res. Plant Dis. 2014, 20, 8–14. [Google Scholar] [CrossRef] [Green Version]
- Carvalho, F.C.; Santos, L.A.; Dias, R.; Mariano, R.L.; Souza, E.B. Selection of watermelon genotypes for resistance to bacterial fruit blotch. Euphytica 2013, 190, 169–180. [Google Scholar] [CrossRef] [Green Version]
- Block, C.C.; Shepherd, L. Long-term survival and seed transmission of Acidovorax avenae subsp. citrulli in melon and watermelon seed. Plant Health Prog. 2008, 9, 36. [Google Scholar] [CrossRef] [Green Version]
- Burdman, S.; Kots, N.; Kritzman, G.; Kopelowitz, J. Molecular, physiological, and host-range characterization of Acidovorax avenae subsp. citrulli isolates from watermelon and melon in Israel. Plant Dis. 2005, 89, 1339–1347. [Google Scholar]
- Mundt, C.C. Durable resistance: A key to sustainable management of pathogens and pests. Infect. Genet. Evol. 2014, 27, 446–455. [Google Scholar] [CrossRef] [PubMed]
- Wechter, W.P.; Levi, A.; Ling, K.-S.; Kousik, C.; Block, C.C. Identification of resistance to Acidovorax avenae subsp. citrulli among melon (Cucumis spp.) plant introductions. HortScience 2011, 46, 207–212. [Google Scholar]
- Wu, S.; Wang, X.; Reddy, U.; Sun, H.; Bao, K.; Gao, L.; Mao, L.; Patel, T.; Ortiz, C.; Abburi, V.L. Genome of ‘Charleston Gray’, the principal American watermelon cultivar, and genetic characterization of 1365 accessions in the US National Plant Germplasm System watermelon collection. Plant Biotechnol. J. 2019, 17, 2246–2258. [Google Scholar] [CrossRef] [Green Version]
- Hopkins, D.L.; Thompson, C.M.; Hilgren, J.; Lovic, B. Wet seed treatment with peroxyacetic acid for the control of bacterial fruit blotch and other seedborne diseases of watermelon. Plant Dis. 2003, 87, 1495–1499. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.; Wehner, T.C. Flowering stage resistance to bacterial fruit blotch in the watermelon germplasm collection. Crop Sci. 2015, 55, 727–736. [Google Scholar] [CrossRef]
- Daley, J.; Wehner, T.C. Screening for bacterial fruit blotch resistance in watermelon fruit. Crop Sci. 2021, 61, 1228–1240. [Google Scholar] [CrossRef]
- Hopkins, D.; Levi, A.; Pitrat, M. Progress in the development of Crimson Sweet-type watermelon breeding lines with resistance to Acidovorax avenae subsp. citrulli. In Proceedings of the IXth EUCARPIA Meeting on Genetics and Breeding of Cucurbitaceae, Avignon, France, 21–24 May 2008. [Google Scholar]
- Islam, M.; Hossain, M.R.; Jesse, D.M.I.; Jung, H.-J.; Kim, H.-T.; Park, J.-I.; Nou, I.-S. Development of molecular marker linked with bacterial fruit blotch resistance in melon (Cucumis melo L.). Genes 2020, 11, 220. [Google Scholar] [CrossRef] [Green Version]
- Branham, S.E.; Levi, A.; Katawczik, M.L.; Wechter, W.P. QTL mapping of resistance to bacterial fruit blotch in Citrullus amarus. Theor. Appl. Genet. 2019, 132, 1463–1471. [Google Scholar] [CrossRef]
- Jang, Y.J.; Seo, M.; Hersh, C.P.; Rhee, S.-J.; Kim, Y.; Lee, G.P. An evolutionarily conserved non-synonymous SNP in a leucine-rich repeat domain determines anthracnose resistance in watermelon. Theor. Appl. Genet. 2019, 132, 473–488. [Google Scholar] [CrossRef]
- Fall, L.A.; Clevenger, J.; McGregor, C. Assay development and marker validation for marker assisted selection of Fusarium oxysporum f. sp. niveum race 1 in watermelon. Mol. Breed. 2018, 38, 130. [Google Scholar] [CrossRef]
- Branham, S.E.; Patrick Wechter, W.; Lambel, S.; Massey, L.; Ma, M.; Fauve, J.; Farnham, M.W.; Levi, A. QTL-seq and marker development for resistance to Fusarium oxysporum f. sp. niveum race 1 in cultivated watermelon. Mol. Breed. 2018, 38, 139. [Google Scholar] [CrossRef]
- Branham, S.E.; Patrick Wechter, W.; Ling, K.-S.; Chanda, B.; Massey, L.; Zhao, G.; Guner, N.; Bello, M.; Kabelka, E.; Fei, Z.; et al. QTL mapping of resistance to Fusarium oxysporum f. sp. niveum race 2 and Papaya ringspot virus in Citrullus amarus. Theor. Appl. Genet. 2020, 133, 677–687. [Google Scholar] [CrossRef] [PubMed]
- Gimode, W.; Bao, K.; Fei, Z.; McGregor, C. QTL associated with gummy stem blight resistance in watermelon. Theor. Appl. Genet. 2021, 134, 573–584. [Google Scholar] [CrossRef]
- Lee, E.S.; Kim, D.-S.; Kim, S.G.; Huh, Y.-C.; Back, C.-G.; Lee, Y.-R.; Siddique, M.I.; Han, K.; Lee, H.-E.; Lee, J. QTL Mapping for Gummy Stem Blight Resistance in Watermelon (Citrullus spp.). Plants 2021, 10, 500. [Google Scholar] [CrossRef] [PubMed]
- Hong, J.-E.; Hossain, M.R.; Jung, H.-J.; Nou, I.-S. QTL associated with Gummy Stem Blight (GSB) resistance in watermelon. BMC Genom. 2022, 23, 632. [Google Scholar] [CrossRef] [PubMed]
- Bhatia, D.; Wing, R.A.; Yu, Y.; Chougule, K.; Kudrna, D.; Lee, S.; Rang, A.; Singh, K. Genotyping by sequencing of rice interspecific backcross inbred lines identifies QTLs for grain weight and grain length. Euphytica 2018, 214, 41. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The sequence alignment/map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [Green Version]
- Guo, S.; Zhao, S.; Sun, H.; Wang, X.; Wu, S.; Lin, T.; Ren, Y.; Gao, L.; Deng, Y.; Zhang, J.; et al. Resequencing of 414 cultivated and wild watermelon accessions identifies selection for fruit quality traits. Nat. Genet. 2019, 51, 1616–1623. [Google Scholar] [CrossRef] [Green Version]
- McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.; Cibulskis, K.; Kernytsky, A.; Garimella, K.; Altshuler, D.; Gabriel, S.; Daly, M.; et al. The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010, 20, 1297–1303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Levi, A.; Thomas, C.E.; Wehner, T.C.; Zhang, X. Low genetic diversity indicates the need to broaden the genetic base of cultivated watermelon. HortScience 2001, 36, 1096–1101. [Google Scholar] [CrossRef] [Green Version]
- Levi, A.; Thies, J.A.; Wechter, W.P.; Harrison, H.F.; Simmons, A.M.; Reddy, U.K.; Nimmakayala, P.; Fei, Z. High frequency oligonucleotides: Targeting active gene (HFO-TAG) markers revealed wide genetic diversity among Citrullus spp. accessions useful for enhancing disease or pest resistance in watermelon cultivars. Genet. Resour. Crop Evol. 2013, 60, 427–440. [Google Scholar] [CrossRef]
- Hopkins, D.; Thompson, C. Seed transmission of Acidovorax avenae subsp. citrulli in cucurbits. HortScience 2002, 37, 924–926. [Google Scholar] [CrossRef] [Green Version]
- Zheng, Y.; Wu, S.; Bai, Y.; Sun, H.; Jiao, C.; Guo, S.; Zhao, K.; Blanca, J.; Zhang, Z.; Huang, S.; et al. Cucurbit Genomics Database (CuGenDB): A central portal for comparative and functional genomics of cucurbit crops. Nucleic Acids Res. 2019, 47, D1128–D1136. [Google Scholar] [CrossRef] [Green Version]
- Guo, S.; Zhang, J.; Sun, H.; Salse, J.; Lucas, W.J.; Zhang, H.; Zheng, Y.; Mao, L.; Ren, Y.; Wang, Z.; et al. The draft genome of watermelon (Citrullus lanatus) and resequencing of 20 diverse accessions. Nat. Genet. 2013, 45, 51–58. [Google Scholar] [CrossRef] [PubMed]
- Romeis, T.; Ludwig, A.A.; Martin, R.; Jones, J.D. Calcium-dependent protein kinases play an essential role in a plant defence response. EMBO J. 2001, 20, 5556–5567. [Google Scholar] [CrossRef] [Green Version]
- Xu, W.; Huang, W. Calcium-dependent protein kinases in phytohormone signaling pathways. Int. J. Mol. Sci. 2017, 18, 2436. [Google Scholar] [CrossRef] [Green Version]
- Kawamoto, N.; Sasabe, M.; Endo, M.; Machida, Y.; Araki, T. Calcium-dependent protein kinases responsible for the phosphorylation of a bZIP transcription factor FD crucial for the florigen complex formation. Sci. Rep. 2015, 5, 8341. [Google Scholar] [CrossRef] [Green Version]
- Bardak, A.; Çelik, S.; Erdoğan, O.; Ekinci, R.; Dumlupinar, Z. Association mapping of Verticillium wilt disease in a worldwide collection of cotton (Gossypium hirsutum L.). Plants 2021, 10, 306. [Google Scholar] [CrossRef]
- Jiang, J.; Wang, B.; Shen, Y.; Wang, H.; Feng, Q.; Shi, H. The Arabidopsis RNA binding protein with K homology motifs, SHINY1, interacts with the C-terminal domain phosphatase-like 1 (CPL1) to repress stress-inducible gene expression. PLoS Genet. 2013, 9, e1003625. [Google Scholar] [CrossRef] [Green Version]
- Qi, Y.; Liu, Y.; Zhang, Z.; Gao, J.; Guan, Z.; Fang, W.; Chen, S.; Chen, F.; Jiang, J. The over-expression of a chrysanthemum gene encoding an RNA polymerase II CTD phosphatase-like 1 enzyme enhances tolerance to heat stress. Hortic. Res. 2018, 5, 37. [Google Scholar] [CrossRef]
- Cabot, C.; Martos, S.; Llugany, M.; Gallego, B.; Tolrà, R.; Poschenrieder, C. A role for zinc in plant defense against pathogens and herbivores. Front. Plant Sci. 2019, 10, 1171. [Google Scholar] [CrossRef] [PubMed]
- Tsutsui, T.; Kato, W.; Asada, Y.; Sako, K.; Sato, T.; Sonoda, Y.; Kidokoro, S.; Yamaguchi-Shinozaki, K.; Tamaoki, M.; Arakawa, K.; et al. DEAR1, a transcriptional repressor of DREB protein that mediates plant defense and freezing stress responses in Arabidopsis. J. Plant Res. 2009, 122, 633–643. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, P.K.; Gupta, K.; Lopato, S.; Agarwal, P. Dehydration responsive element binding transcription factors and their applications for the engineering of stress tolerance. J. Exp. Bot. 2017, 68, 2135–2148. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Völz, R.; Kim, S.-K.; Mi, J.; Mariappan, K.G.; Guo, X.; Bigeard, J.; Alejandro, S.; Pflieger, D.; Rayapuram, N.; Al-Babili, S.; et al. The Trihelix transcription factor GT2-like 1 (GTL1) promotes salicylic acid metabolism, and regulates bacterial-triggered immunity. PLoS Genet. 2018, 14, e1007708. [Google Scholar] [CrossRef] [PubMed]
- Cheng, X.; Xiong, R.; Yan, H.; Gao, Y.; Liu, H.; Wu, M.; Xiang, Y. The trihelix family of transcription factors: Functional and evolutionary analysis in Moso bamboo (Phyllostachys edulis). BMC Plant Biol. 2019, 19, 154. [Google Scholar] [CrossRef] [PubMed]
QTL Name | Chromosome | Peak (cM) | LOD 1 | Add 2 | Dom 3 | PVE 4 | 2–LOD Interval (cM) 5 | Left Flanking Marker | Right Flanking Marker |
---|---|---|---|---|---|---|---|---|---|
ClBFB10.1 | 10 | 13 | 4.29 | 0.0708 | −2.2148 | 18.84 | 12.5–16.5 | 6,117,466 | 6,407,497 |
ClBFB10.2 | 10 | 518 | 2.94 | 0.4174 | 1.9965 | 15.41 | 515.5–521.5 | 32,375,640 | 32,192,944 |
SNP | QTL | Marker Name | Primer Sequence (5′–3′) * |
---|---|---|---|
Chr10_6133795 | ClBFB10.1 | WmBFB10.1 | Forward: TTCAAACTGTAACAAAATAGAGTCAAA |
Reverse: AAATATTTGATTTTGAGTTCCTTCTCC | |||
Probe: TCCAGTCATCTCGTTTTACGCTTCAT | |||
Chr10_32259129 | ClBFB10.2 | WmBFB10.2 | Forward: AAGAGGTTTCGGATCAGGCCATGATT |
Reverse: GAACGCAAAATTAATTTCCAAACATATC | |||
Probe: TGATCGTTGAGAGCGAGGACGAAGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yeo, S.-M.; Hong, J.; Hossain, M.R.; Jung, H.-J.; Choe, P.; Nou, I.-S. Genotyping by Sequencing (GBS)-Based QTL Mapping for Bacterial Fruit Blotch (BFB) in Watermelon. Genes 2022, 13, 2250. https://doi.org/10.3390/genes13122250
Yeo S-M, Hong J, Hossain MR, Jung H-J, Choe P, Nou I-S. Genotyping by Sequencing (GBS)-Based QTL Mapping for Bacterial Fruit Blotch (BFB) in Watermelon. Genes. 2022; 13(12):2250. https://doi.org/10.3390/genes13122250
Chicago/Turabian StyleYeo, Sang-Min, Jeongeui Hong, Mohammad Rashed Hossain, Hee-Jeong Jung, Phillip Choe, and Ill-Sup Nou. 2022. "Genotyping by Sequencing (GBS)-Based QTL Mapping for Bacterial Fruit Blotch (BFB) in Watermelon" Genes 13, no. 12: 2250. https://doi.org/10.3390/genes13122250
APA StyleYeo, S.-M., Hong, J., Hossain, M. R., Jung, H.-J., Choe, P., & Nou, I.-S. (2022). Genotyping by Sequencing (GBS)-Based QTL Mapping for Bacterial Fruit Blotch (BFB) in Watermelon. Genes, 13(12), 2250. https://doi.org/10.3390/genes13122250