Thyroid Transcriptomic Profiling Reveals the Follicular Phase Differential Regulation of lncRNA and mRNA Related to Prolificacy in Small Tail Han Sheep with Two FecB Genotypes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Tissue Collection
2.2. Total RNA Extraction and Library Construction
2.3. Processing of Sequencing Data
2.4. Identification of Candidate lncRNAs
2.5. Analysis of Differentially Expressed Genes
2.6. Bioinformatics Analysis
2.7. Construction of a Network for the Analysis of lncRNAs-mRNAs Interactions
2.8. Reverse Transcription and qPCR Validation
3. Results
3.1. Summary of Raw Sequence Reads
3.2. Differential Expression Analysis of lncRNAs and mRNAs
3.3. GO Analysis of the Biological Function of DELs and DEGs
3.4. KEGG Pathway Analysis
3.5. Interaction Analysis of lncRNAs-mRNAs and Function Prediction
3.6. Data Validation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- He, X.; Li, B.; Fu, S.; Wang, B.; Qi, Y.; Da, L.; Te, R.; Sun, S.; Liu, Y.; Zhang, W. Identification of piRNAs in the testes of Sunite and Small-tailed Han sheep. Anim. Biotechnol. 2019, 32, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Bi, Y.; Feng, W.; Kang, Y.; Wang, K.; Yang, Y.; Qu, L.; Chen, H.; Lan, X.; Pan, C. Detection of mRNA Expression and Copy Number Variations within the Goat FecB Gene Associated with Litter Size. Front. Vet. Sci. 2021, 8, 758705. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Guo, X.; He, X.; Di, R.; Zhang, X.; Zhang, J.; Wang, X.; Chu, M. Transcriptome Analysis Reveals Differentially Expressed Genes and Long Non-coding RNAs Associated with Fecundity in Sheep Hypothalamus with Different FecB Genotypes. Front. Cell Dev. Biol. 2021, 9, 633747. [Google Scholar] [CrossRef] [PubMed]
- Otsuka, F. Multiple Endocrine Regulation by Bone Morphogenetic Protein System. Endocr. J. 2010, 57, 3–14. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Guo, X.; He, X.; Liu, Q.; Di, R.; Hu, W.; Cao, X.; Zhang, X.; Zhang, J.; Chu, M. Effects of FecB Mutation on Estrus, Ovulation, and Endocrine Characteristics in Small Tail Han Sheep. Front. Vet. Sci. 2021, 8, 709737. [Google Scholar] [CrossRef]
- Jia, J.; Jin, J.; Chen, Q.; Yuan, Z.; Li, H.; Bian, J.; Gui, L. Eukaryotic expression, Co-IP and MS identify BMPR-1B protein-protein interaction network. Biol. Res. 2020, 53, 24. [Google Scholar] [CrossRef]
- Xia, Q.; Li, Q.; Gan, S.; Guo, X.; Zhang, X.; Zhang, J.; Chu, M. Exploring the roles of fecundity-related long non-coding RNAs and mRNAs in the adrenal glands of small-tailed Han Sheep. BMC Genet. 2020, 21, 39. [Google Scholar] [CrossRef]
- Han, Q.; He, X.; Di, R.; Chu, M. Comparison of expression patterns of six canonical clock genes of follicular phase and luteal phase in Small-tailed Han sheep. Arch. Anim. Breed. 2021, 64, 457–466. [Google Scholar] [CrossRef]
- Li, C.; He, X.; Zhang, Z.; Ren, C.; Chu, M. Pineal gland transcriptomic profiling reveals the differential regulation of lncRNA and mRNA related to prolificacy in STH sheep with two FecB genotypes. BMC Genom. Data 2021, 22, 9. [Google Scholar] [CrossRef]
- Okada, H.; Hayashizaki, Y. The world of functional RNA. Rinsho Shinkeigaku 2013, 53, 957–961. [Google Scholar] [CrossRef] [Green Version]
- Li, M.; Liu, Y.; Xie, S.; Ma, L.; Zhao, Z.; Gong, H.; Sun, Y.; Huang, T. Transcriptome analysis reveals that long noncoding RNAs contribute to developmental differences between medium-sized ovarian follicles of Meishan and Duroc sows. Sci. Rep. 2021, 11, 22510. [Google Scholar] [CrossRef] [PubMed]
- He, X.; Tao, L.; Zhong, Y.; Di, R.; Xia, Q.; Wang, X.; Guo, X.; Gan, S.; Zhang, X.; Zhang, J.; et al. Photoperiod induced the pituitary differential regulation of lncRNAs and mRNAs related to reproduction in sheep. PeerJ 2021, 9, e10953. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Li, M.; Bo, X.; Li, T.; Ma, L.; Zhai, T.; Huang, T. Systematic Analysis of Long Non-Coding RNAs and mRNAs in the Ovaries of Duroc Pigs During Different Follicular Stages Using RNA Sequencing. Int. J. Mol. Sci. 2018, 19, 1722. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, D.; Wang, Y.; Zheng, Y.; Dai, F.; Liu, S.; Yuan, M.; Deng, Z.; Bao, A.; Cheng, Y. Silencing of lncRNA UCA1 inhibited the pathological progression in PCOS mice through the regulation of PI3K/AKT signaling pathway. J. Ovarian Res. 2021, 14, 48. [Google Scholar] [CrossRef] [PubMed]
- Dong, Y.; Lyu, L.; Zhang, D.; Li, J.; Wen, H.; Shi, B. Integrated lncRNA and mRNA Transcriptome Analyses in the Ovary of Cynoglossus semilaevis Reveal Genes and Pathways Potentially Involved in Reproduction. Front. Genet. 2021, 12, 671729. [Google Scholar] [CrossRef] [PubMed]
- Steinhauser, C.; Askelson, K.; Hobbs, K.; Bazer, F.; Satterfield, M. Maternal nutrient restriction alters thyroid hormone dynamics in placentae of sheep having small for gestational age fetuses. Domest. Anim. Endocrinol. 2021, 77, 106632. [Google Scholar] [CrossRef]
- Feng, K.; Zhu, K.; Wu, Z.; Su, S.; Yao, W. Identification and expression analysis of thyroid-stimulating hormone β subunit, and effects of T3 on gonadal differentiation-related gene expression in rice field eel, Monopterus albus. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2021, 258, 110681. [Google Scholar] [CrossRef]
- Costa, N.; Cordeiro, M.; Silva, T.; Sastre, D.; Santana, P.; Sá, A.; Sampaio, R.; Santos, S.; Adona, P.; Miranda, M.D.S.; et al. Effect of triiodothyronine on developmental competence of bovine oocytes. Theriogenology 2013, 80, 295–301. [Google Scholar] [CrossRef]
- Song, D.; Wu, G.; Wei, Q.; Shi, F. Bisphenol A attenuates thyroxine-induced apoptosis in ovarian granulosa cells of pigs. Reprod. Domest. Anim. 2019, 54, 864–872. [Google Scholar] [CrossRef]
- Zhang, Z.; Tang, J.; Di, R.; Liu, Q.; Wang, X.; Gan, S.; Zhang, X.; Zhang, J.; Chu, M.; Hu, W. Integrated Hypothalamic Transcriptome Profiling Reveals the Reproductive Roles of mRNAs and miRNAs in Sheep. Front. Genet. 2020, 10, 1296. [Google Scholar] [CrossRef] [Green Version]
- Pertea, M.; Kim, D.; Pertea, G.M.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protos. 2016, 11, 1650–1667. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Luo, H.; Bu, D.; Zhao, G.; Yu, K.; Zhang, C.; Liu, Y.; Chen, R.; Zhao, Y. Utilizing sequence intrinsic composition to classify protein-coding and long non-coding transcripts. Nucleic Acids Res. 2013, 41, e166. [Google Scholar] [CrossRef] [PubMed]
- Kang, Y.J.; Yang, D.C.; Kong, L.; Hou, M.; Meng, Y.Q.; Wei, L.; Gao, G. CPC2: A fast and accurate coding potential calculator based on sequence intrinsic features. Nucleic Acids Res. 2017, 45, W12–W16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bateman, A.; Coin, L.; Durbin, R.; Finn, R.D.; Hollich, V.; Griffiths-Jones, S.; Khanna, A.; Marshall, M.; Moxon, S.; Sonnhammer, E.L.; et al. The Pfam protein families database. Nucleic Acids Res. 2002, 30, 276–280. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Liu, K.; Shan, B.; Wei, S.; Li, D.; Han, H.; Wei, W.; Chen, J.; Liu, H.; Zhang, L. A genome-wide landscape of mRNAs, lncRNAs, and circRNAs during subcutaneous adipogenesis in pigs. J. Anim. Sci. Biotechnol. 2018, 9, 76. [Google Scholar] [CrossRef]
- Love, M.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550–570. [Google Scholar] [CrossRef] [Green Version]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of Biomolecular Interaction Networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef]
- Gao, Y.; Yue, J.; Huang, Z. LncRNA MIAT mediates ox-LDL-induced endothelial cell injury via miR-206/RAB22A axis. J. Surg. Res. 2021, 265, 303–312. [Google Scholar] [CrossRef]
- Dubos, C.; Stracke, R.; Grotewold, E.; Weisshaar, B.; Martin, C.; Lepiniec, L. MYB transcription factors in Arabidopsis. Trends Plant Sci. 2010, 15, 573–581. [Google Scholar] [CrossRef]
- Zheng, L.P.; Wang, J.L.; Zheng, Y.H.; Wu, L.; Xiao, Q.X.; Li, F. The effects of protooncogene on oocyte maturation mediated by cytokines. Zhongguo Ying Yong Sheng Li Xue Za Zhi 2009, 25, 74–79. (In Chinese) [Google Scholar]
- Zheng, L.P.; Huang, J.; Zhang, D.L.; Xu, L.Q.; Li, F.; Wu, L.; Liu, Z.Y.; Zheng, Y.H. c-erbB2 and c-myb induce mouse oocyte maturation involving activation of maturation promoting factor. DNA Cell Biol. 2012, 31, 164–170. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Sun, H.; Wu, L.; Wu, F.; Tang, W.; Wang, X.; Lv, C. VUp-Regulation of VCAN Promotes the Proliferation, Invasion and Migration and Serves as a Biomarker in Gastric Cancer. OncoTargets Ther. 2020, 13, 8665–8675. [Google Scholar] [CrossRef] [PubMed]
- Shen, Q.; Chen, M.; Zhao, X.; Liu, Y.; Ren, X.; Zhang, L. Versican expression level in cumulus cells is associated with human oocyte developmental competence. Syst. Biol. Reprod. Med. 2020, 66, 176–184. [Google Scholar] [CrossRef] [PubMed]
- Özler, S.; Öztaş, E.; Tokmak, A.; Ergin, M.; Pekcan, M.K.; Güler, B.G.; Yakut, H.İ.; Yılmaz, N. Role of versican and ADAMTS-1 in polycystic ovary syndrome. J. Clin. Res. Pediatric Endocrinol. 2017, 9, 24–30. [Google Scholar] [CrossRef] [PubMed]
- Ellinger, I. The Calcium-Sensing Receptor and the Reproductive System. Front. Physiol. 2016, 7, 371. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.; Zhou, D.; Liu, C.; Zhuan, Q.; Luo, Y.; Mo, X.; Fu, X.; Hou, Y. The Calcium-Sensing Receptor Is Involved in Follicle-Stimulating Hormone-Induced Cumulus Expansion in in vitro Cultured Porcine Cumulus-Oocyte Complexes. Front. Cell Dev. Biol. 2021, 9, 625036. [Google Scholar] [CrossRef]
- Yang, R.; Sun, H.H.; Ji, C.L.; Zhang, J.; Yuan, H.J.; Luo, M.J.; Liu, X.Y.; Tan, J.H. Role of calcium-sensing receptor in regulating spontaneous activation of postovulatory aging rat oocytes. Biol. Reprod. 2017, 98, 218–226. [Google Scholar] [CrossRef]
- Roostalu, J.; Rickman, J.; Thomas, C.; Nédélec, F.; Surrey, T. Determinants of Polar versus Nematic Organization in Networks of Dynamic Microtubules and Mitotic Motors. Cell 2018, 175, 796–808.e14. [Google Scholar] [CrossRef] [Green Version]
- Mihalas, B.P.; Camlin, N.; Xavier, M.; Peters, A.E.; Holt, J.E.; Sutherland, J.; McLaughlin, E.; Eamens, A.; Nixon, B. The small non-coding RNA profile of mouse oocytes is modified during aging. Aging 2019, 11, 2968–2997. [Google Scholar] [CrossRef]
- Bennabi, I.; Quéguiner, I.; Kolano, A.; Boudier, T.; Mailly, P.; Verlhac, M.; Terret, M. Shifting meiotic to mitotic spindle assembly in oocytes disrupts chromosome alignment. EMBO Rep. 2018, 19, 368–381. [Google Scholar] [CrossRef]
- Smith, K.R.; Hanson, H.; Hollingshaus, M.S. BRCA1 and BRCA2 mutations and female fertility. Curr. Opin. Obstet. Gynecol. 2013, 25, 207–213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miao, Y.; Wang, P.; Xie, B.; Yang, M.; Li, S.; Cui, Z.; Fan, Y.; Li, M.; Xiong, B. BRCA2 deficiency is a potential driver for human primary ovarian insufficiency. Cell Death Dis. 2019, 10, 474. [Google Scholar] [CrossRef] [PubMed]
- Gad, A.; Nemcova, L.; Murin, M.; Kinterova, V.; Kanka, J.; Laurincik, J.; Benc, M.; Pendovski, L.; Prochazka, R. Global transcriptome analysis of porcine oocytes in correlation with follicle size. Mol. Reprod. Dev. 2019, 87, 102–114. [Google Scholar] [CrossRef] [PubMed]
Sample Name | Raw Reads | Clean Reads | Clean Bases | Mapped Reads | Mapping Rate (%) | Q30 (%) |
---|---|---|---|---|---|---|
MM_F_T_1 | 97711458 | 94718122 | 14.21G | 86628641 | 91.46 | 95.12 |
MM_F_T_2 | 96088926 | 93452790 | 14.02G | 85202534 | 91.17 | 93.78 |
MM_F_T_3 | 92644672 | 90743952 | 13.61G | 83435512 | 91.95 | 94.41 |
ww_F_T_1 | 90959354 | 88524974 | 13.28G | 81088654 | 91.6 | 94.29 |
ww_F_T_2 | 103513712 | 99977788 | 15G | 90093436 | 90.11 | 92.7 |
ww_F_T_3 | 84148306 | 80737376 | 12.11G | 72225658 | 89.46 | 92.46 |
Gene Name | Classification | Sequence (5′-3′) |
---|---|---|
CASR | F | TGAGCTTTGACGAGCCTCAG |
R | TGGTCAGGGCGTCATTGTTT | |
BRCA2 | F | CTCGACCTGCTTGCTGGTATGC |
R | CGCTGAAGAGTGATGACAAGGGAAG | |
ICA | F | CCGAAGTGTGGATGGCAAGGAAG |
R | ACCCAATGGCGGCATCTGTAAATAG | |
LNC_002767 | F | CTGACAGTAGCCTGGTTGGG |
R | ATGACAGGATGTGGGCAGTG | |
XR_001435524.1 | F | TAGCTAGGTGGTTCGCTGAC |
R | GAGAGGACGTCTGCAAGGTT | |
LNC_010851 | F | GCACTCAGCACACAGGTACT |
R | CCAGAGGAAGACCAACGAGC | |
RPL-19 | F | ATCGCCAATGCCAACTC |
R | CCTTTCGCTTACCTATACC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chang, C.; He, X.; Di, R.; Wang, X.; Han, M.; Liang, C.; Chu, M. Thyroid Transcriptomic Profiling Reveals the Follicular Phase Differential Regulation of lncRNA and mRNA Related to Prolificacy in Small Tail Han Sheep with Two FecB Genotypes. Genes 2022, 13, 849. https://doi.org/10.3390/genes13050849
Chang C, He X, Di R, Wang X, Han M, Liang C, Chu M. Thyroid Transcriptomic Profiling Reveals the Follicular Phase Differential Regulation of lncRNA and mRNA Related to Prolificacy in Small Tail Han Sheep with Two FecB Genotypes. Genes. 2022; 13(5):849. https://doi.org/10.3390/genes13050849
Chicago/Turabian StyleChang, Cheng, Xiaoyun He, Ran Di, Xiangyu Wang, Miaoceng Han, Chen Liang, and Mingxing Chu. 2022. "Thyroid Transcriptomic Profiling Reveals the Follicular Phase Differential Regulation of lncRNA and mRNA Related to Prolificacy in Small Tail Han Sheep with Two FecB Genotypes" Genes 13, no. 5: 849. https://doi.org/10.3390/genes13050849
APA StyleChang, C., He, X., Di, R., Wang, X., Han, M., Liang, C., & Chu, M. (2022). Thyroid Transcriptomic Profiling Reveals the Follicular Phase Differential Regulation of lncRNA and mRNA Related to Prolificacy in Small Tail Han Sheep with Two FecB Genotypes. Genes, 13(5), 849. https://doi.org/10.3390/genes13050849