Effects of Chinese yam Polysaccharides on the Muscle Tissues Development-Related Genes Expression in Breast and Thigh Muscle of Broilers
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Design, Diets and Broilers
2.2. Slaughter and Samples Collection
2.3. Messenger RNA Expression Analysis
2.4. Primer Design
2.5. Statistical Analysis
3. Results
3.1. BMP and TMP
3.2. Muscle Development-Related Genes Expression
3.3. Correlations between Genes Expression and BMP or TMP
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Misaki, R.; Fujiyama, K.; Kajiura, H. Structure and biological functions of plant glycans and polysaccharides. Ref. Module. Chem. Mol. Sci. Chem. Eng. 2021, 5, 93–109. [Google Scholar]
- Zhang, J.; Cai, K.; Mishra, R.; Jha, R. In ovo supplementation of chitooligosaccharide and chlorella polysaccharide affects cecal microbial community, metabolic pathways, and fermentation metabolites in broiler chickens. Poult. Sci. 2020, 99, 4776–4785. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Zhao, Z.; Pan, Z.; An, L.; Balasubramanian, B.; Liu, W. New insights into the role of dietary marine-derived polysaccharides on productive performance, egg quality, antioxidant capacity, and jejunal morphology in late-phase laying hens. Poult. Sci. 2020, 99, 2100–2107. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Qu, H.; Jia, J.; Kuang, C.; Wen, Y.; Yan, H.; Gui, Z. Characterization, antioxidant and antitumor activities of polysaccharides from purple sweet potato. Carbohydr. Polym. 2015, 132, 31–40. [Google Scholar] [CrossRef]
- Chen, H.; Li, D.; Chang, B.; Gong, L.; Dai, J.; Yi, G. Effects of Chinese herbal polysaccharides on the immunity and growth performance of young broilers. Poult. Sci. 2003, 82, 364. [Google Scholar] [CrossRef]
- Li, Z.; Xiao, W.; Xie, J.; Chen, Y.; Yu, Q.; Zhang, W.; Shen, M. Isolation, Characterization and Antioxidant Activity of Yam Polysaccharides. Foods 2022, 11, 800. [Google Scholar] [CrossRef]
- Cheng, Z.; Hu, M.; Tao, J.; Yang, H.; Yan, P.; An, G.; Wang, H. The protective effects of Chinese yam polysaccharide against obesity-induced insulin resistance. J. Funct. Foods 2019, 55, 238–247. [Google Scholar] [CrossRef]
- Liu, Y.; Li, H.; Fan, Y.; Man, S.; Liu, Z.; Gao, W.; Wang, T. Antioxidant and Antitumor Activities of the Extracts from Chinese Yam (Dioscorea opposite Thunb.) Flesh and Peel and the Effective Compounds. J. Food Sci. 2016, 81, H1553–H1564. [Google Scholar] [CrossRef]
- Judith, B.; Denise, L.; Stephan, H.; Zakaria, F.; Felix, E.; Petit, B. Isolation, Physicochemical Characterization and Application of Yam (Dioscorea spp.) Starch as Thickening and Gelling Agent. Starch-Stärke 2005, 57, 107–117. [Google Scholar]
- Huang, R.; Xie, J.; Yu, Y.; Shen, M. Recent progress in the research of yam mucilage polysaccharides: Isolation, structure and bioactivities. Int. J. Biol. Macromol. 2020, 155, 1262–1269. [Google Scholar] [CrossRef]
- Yang, W.; Ying, W.; Li, X.; Ping, Y. Purification and structural characterization of Chinese yam polysaccharide and its activities. Carbohydr. Polym. 2014, 117, 1021–1027. [Google Scholar] [CrossRef] [PubMed]
- Kong, X.; Zhang, Y.; Yin, Y.; Wu, G.; Zhou, H.; Tan, Z.; Yang, F.; Bo, M.; Huang, R.; Li, T.; et al. Chinese Yam polysaccharide enhances growth performance and cellular immune response in weanling rats. J. Sci. Food Agric. 2009, 89, 2039–2044. [Google Scholar] [CrossRef]
- Ju, Y.; Xue, Y.; Huang, J.; Zhai, Q.; Wang, X. Antioxidant Chinese yam polysaccharides and its pro-proliferative effect on endometrial epithelial cells. Int. J. Biol. Macromol. 2014, 66, 81–85. [Google Scholar] [CrossRef] [PubMed]
- Deng, J.; Zhang, J.; Chang, Y.; Wang, S.; Shi, M.; Miao, G. Effects of Chinese yam polysaccharides on the immune function and serum biochemical indexes of broilers. Front. Vet. Sci. 2022, 9, 1013888. [Google Scholar] [CrossRef] [PubMed]
- Zhu, C.; Xu, W.; Hu, Y.; Zhu, W.; Song, C.; Chen, W.; Li, H. Early Development and Developmental Expression of Insulin-like Growth Factor 1 Receptor (IGF-IR) mRNA in Gaoyou Duck and Jinding Duck (Anas platyrhynchos domestica) Skeletal Muscle. J. Agric. Biotechnol. 2013, 21, 192–198. [Google Scholar]
- Wang, Q.; Mcpherron, A. Myostatin inhibition induces muscle fibre hypertrophy prior to satellite cells activation. J. Physiol. 2012, 590, 2151–2165. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Yao, H.; Zhang, Z.; Zhang, B.; Meng, F.; Xu, S.; Wang, X. Possible Correlation between Selenoprotein W and Myogenic Regulatory Factors in Chicken Embryonic Myoblasts. Biol. Trace. Elem. Res. 2012, 150, 166–172. [Google Scholar] [CrossRef] [PubMed]
- Rudnicki, M.; Jaenisch, R. The MYOD family of transcription factors and skeletal Myogenesis. Bioessays 1995, 17, 203–209. [Google Scholar] [CrossRef]
- Maves, L.; Waskiewicz, A.; Paul, B.; Cao, Y.; Tyler, A.; Cecilia, B.; Stephen, S. Pbx homeodomain proteins direct Myod activity to promote fast-muscle differentiation. Development 2007, 134, 3371–3382. [Google Scholar] [CrossRef] [Green Version]
- Du, C.; Jin, Y.; Qi, J.; Ji, Z.; Li, S.; An, G.; Jia, H.; Ni, J. Effects of myogenin on expression of late muscle genes through MyoD-dependent chromatin remodeling ability of myogenin. Mol. Cells 2012, 34, 133–142. [Google Scholar] [CrossRef] [Green Version]
- Jawasreh, K.; Athamneh, S.; Al-Zghoul, M.; Amareen, A.; Alsukhni, I.; Aad, P. Evaluation of growth performance and muscle marker genes expression in four different broiler strains in Jordan. Ital. J. Anim. Sci. 2019, 18, 766–776. [Google Scholar] [CrossRef] [Green Version]
- Carnac, G.; Vernus, B.; Bonnieu, A. Myostatin in the pathophysiology of skeletal muscle. Curr. Genom. 2007, 8, 415–422. [Google Scholar]
- Li, F.; Shan, A.; Hu, J.; Zheng, Y.; Xu, L.; Chen, Z. Changes to daily feed intake during the laying period alters embryonic MSTN and MYOG gene expression in genetically fat and lean lines of chickens. Br. Poult. Sci. 2013, 54, 728–737. [Google Scholar] [CrossRef] [PubMed]
- Lalitha, S. Primer Premier 5. Biotech Softw. Internet Rep. Comput. Softw. J. Sci. 2000, 1, 270–272. [Google Scholar] [CrossRef]
- Musa, H.; Chen, G.; Cheng, J.; Li, B.; Mekki, D. Study on carcass characteristics of chicken breeds raised under the intensive condition. Int. J. Poult. Sci. 2006, 5, 530–533. [Google Scholar]
- Jin, S.; Yang, L.; Zang, H.; Xu, Y.; Chen, X.; Chen, X.; Liu, P.; Geng, Z. Influence of free-range days on growth performance, carcass traits, meat quality, lymphoid organ indices, and blood biochemistry of Wannan Yellow chickens. Poult. Sci. 2019, 98, 6602–6610. [Google Scholar] [CrossRef] [PubMed]
- Sun, B.; Xiao, H.; Zhou, M.; Lou, Y.; He, Z.; Pan, G.; Zhang, Q.; Li, W.; Hui, X. Effect of Astragalus Polysaccharide in Diets on Slaughter Performance and Meat Quality of Broilers. Acta. Ecologiae. Anim. Domastici. 2015, 36, 26–29. [Google Scholar]
- Zhang, J.; Shen, H.; Zhang, X.; Dai, L.; Zhang, Q.; Wang, J. Fly maggot powder combined with astragalus polysaccharide on the growth performance of yellow feather broilers, Effects of slaughter performance and immune organ index. Feed. Res. 2020, 43, 31–35. [Google Scholar]
- Sun, T.; Gao, Y.; Zhou, H.; Sun, Z.; Lou, Y. Effects of Lycium barbarum polysaccharide on performance and muscle amino acid composition of 21-day-old broilers. Heilongjiang Anim. Sci. Vet. Med. 2019, 20, 118–122. [Google Scholar]
- Beilharz, M.; Lareu, R.; Garrett, K.; Grounds, M.; Fletcher, S. Quantitation of muscle precursor cell activity in skeletal muscle by Northern analysis of MyoD and myogenin expression: Application to dystrophic (mdx) mouse muscle. Mol. Cell Neurosci. 1992, 3, 326–331. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Li, M.; Xu, S.; Sun, J.; Liu, G. Expression of Myostatin (Mstn) and Myogenin (Myog) Genes in Zi And Rhine Goose and Their Correlation with Carcass Traits. Braz. J. Poult. Sci. 2019, 21, 1–6. [Google Scholar] [CrossRef]
- Ríos, R.; Carneiro, I.; Arce, V.; Devesa, J. Myostatin is an inhibitor of myogenic differentiation. Am. J. Physiol. Cell. Physiol. 2002, 282, C993–C999. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Castelhano-Barbosa, E.; Gabriel, J.; Alvares, L.; Monteiro-Vitorello, C.; Coutinho, L. Temporal and spatial expression of the myostatin gene during chicken embryo development. Growth Dev. Aging 2005, 69, 3–12. [Google Scholar] [PubMed]
- Gizak, A.; Wrobel, E.; Moraczewski, J.; Dzugaj, A. Changes in subcellular localization of fructose 1,6-bisphosphatase during differentiation of isolated muscle satellite cells. FEBS Lett. 2006, 580, 4042–4046. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sabourin, L.; Rudnicki, M. The molecular regulation of myogenesis. Clin. Genet. 2000, 57, 16. [Google Scholar] [CrossRef] [PubMed]
- Manceau, M.; Gros, J.; Savage, K.; Thomé, V.; McPherron, A.; Paterson, B.; Marcelle, C. Myostatin promotes the terminal differentiation of embryonic muscle progenitors. Genes Dev. 2008, 22, 668–681. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.H.; Mao, H.G.; Dong, X.Y.; Cao, H.Y.; Yin, Z.Z. Expression of MSTN gene and its correlation with pectoralis muscle fiber traits in the domestic pigeons (Columba livia)-ScienceDirect. Poult. Sci. 2019, 98, 5265–5271. [Google Scholar] [CrossRef] [PubMed]
Items | Composition/% | |
---|---|---|
Initial Stages (1–28 days) | End Stages (29–48 days) | |
Ingredients, % | - | - |
Corn | 60.00 | 63.50 |
Soybean meal | 32.00 | 29.00 |
Wheat bran | 1.00 | - |
Soybean oil | 1.00 | 2.00 |
Fish meal | 2.00 | 1.60 |
CaHPO4 | 1.30 | 1.30 |
Limestone | 1.40 | 1.30 |
NaCl | 0.30 | 0.30 |
Premix a | 1.00 | 1.00 |
Total | 100.00 | 100.00 |
Nutrient levels, % | - | - |
Metabolic energy, (MJ/kg) b | 12.13 | 12.55 |
Crude protein | 21.00 | 20.00 |
Calcium | 1.00 | 0.90 |
Total p | 0.65 | 0.60 |
Available p | 0.45 | 0.35 |
Lysine | 0.50 | 0.38 |
Methionine | 1.10 | 1.00 |
Gene 1 | Primer Sequences (5′ → 3′) | Product Size (bp) | GenBank |
---|---|---|---|
β-actin | Forward: CATTGAACACGGTATTGTCACCAACTG | 270 | L08165.1 |
Reverse: GTAACACCATCACCAGAGTCCATCAC | |||
MYOD1 | Forward: ACACGTCGGACATGCACTTCTTC | 213 | NM_204214 |
Reverse: CAGCGTTGGTGGTCTTCCTCTTG | |||
MYOG | Forward: GCGGAGGCTGAAGAAGGTGAAC | 347 | NM_204184 |
Reverse: CGATGGAGGAGAGCGAGTGGAG | |||
MSTN | Forward: TGGCTCTGGATGGCAGTAGTCAG | 290 | AF019621 |
Reverse: CGTCTCGGTTGTGGCATGATAGTC |
Item | Control | CYP250 | CYP500 | CYP1000 |
---|---|---|---|---|
MYOD1 | ||||
BMP | 0.492 (p = 0.582) | 0.287 (p = 0.582) | 0.629 (p = 0.181) | −0.250 (p = 0.633) |
TMP | −0.624 (p = 0.186) | −0.326 (p = 0.528) | −0.625 (p = 0.184) | −0.412 (p = 0.417) |
MYOG | ||||
BMP | 0.209 (p = 0.692) | −0.059 (p = 0.912) | −0.298 (p = 0.566) | 0.421 (p = 0.406) |
TMP | 0.577 (p = 0.231) | 0.240 (p = 0.648) | −0.557 (p = 0.251) | 0.448 (p = 0.373) |
MSTN | ||||
BMP | 0.660 (p = 0.154) | 0.149 (p = 0.779) | −0.461 (p = 0.357) | −0.283 (p = 0.587) |
TMP | −0.348 (p = 0.499) | 0.128 (p = 0.809) | −0.645 (p = 0.166) | −0.669 (p = 0.147) |
Item | Control | CYP250 | CYP500 | CYP1000 |
---|---|---|---|---|
MYOD1 | ||||
BMP | 0.157 (p = 0.767) | 0.546 (p = 0.263) | −0.228 (p = 0.664) | −0.222 (p = 0.672) |
TMP | 0.532 (p = 0.277) | 0.159 (p = 0.764) | 0.819 * (p = 0.046) | −0.805 (p = 0.053) |
MYOG | ||||
BMP | −0110 (p = 0.835) | 0.042 (p = 0.938) | 0.013 (p = 0.980) | −0.264 (p = 0.614) |
TMP | 0.585 (p = 0.223) | 0.291 (p = 0.576) | 0.912 * (p = 0.011) | −0.973 ** (p = 0.001) |
MSTN | ||||
BMP | 0.006 (p = 0.991) | 0.742 (p = 0.091) | 0.121 (p = 0.819) | 0.549 (p = 0.260) |
TMP | 0.584 (p = 0.223) | 0.306 (p = 0.556) | 0.851 * (p = 0.032) | −0.632 (p = 0.178) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Deng, J.; Zhang, J.; Jin, Y.; Chang, Y.; Shi, M.; Miao, Z. Effects of Chinese yam Polysaccharides on the Muscle Tissues Development-Related Genes Expression in Breast and Thigh Muscle of Broilers. Genes 2023, 14, 6. https://doi.org/10.3390/genes14010006
Deng J, Zhang J, Jin Y, Chang Y, Shi M, Miao Z. Effects of Chinese yam Polysaccharides on the Muscle Tissues Development-Related Genes Expression in Breast and Thigh Muscle of Broilers. Genes. 2023; 14(1):6. https://doi.org/10.3390/genes14010006
Chicago/Turabian StyleDeng, Jiahua, Jinzhou Zhang, Yan Jin, Yadi Chang, Mingyan Shi, and Zhiguo Miao. 2023. "Effects of Chinese yam Polysaccharides on the Muscle Tissues Development-Related Genes Expression in Breast and Thigh Muscle of Broilers" Genes 14, no. 1: 6. https://doi.org/10.3390/genes14010006