Effects of L-arginine on Nitric Oxide Synthesis and Larval Metamorphosis of Mytilus coruscus
Abstract
1. Introduction
2. Materials and Methods
2.1. Larval Culture and Spawning
2.2. Metamorphosis Assays of Pharmacological Treatments
2.3. Determination of NO Levels in the Larvae
2.4. McNOS RNAi
2.5. Total RNA Extraction and Quantitative Real-Time PCR
2.6. Metamorphosis Assays and Survival Rate of Pediveliger Larvae after McNOS RNAi
2.7. Statistical Analysis
3. Results
3.1. NO Content in the Larvae on Exposure to L-arginine and AGH
3.2. Effects of L-arginine on NOS Expression
3.3. Behavior of the Larvae on the Exposure to L-arginine and AGH
3.4. Metamorphosis of Pediveliger Larvae on Exposure to L-arginine and AGH
3.5. NOS siRNA and Survival Rate of the Larvae
3.6. NO Content in the Larvae after McNOS siRNA and L-arginine Treatment
3.7. The Larval Metamorphosis Rate after McNOS siRNA and L-arginine Treatment
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Strathmann, R.R. Hypotheses on the origins of marine larvae. Annu. Rev. Ecol. Syst. 1993, 24, 89–117. [Google Scholar] [CrossRef]
- Hadfield, M.G.; Paul, V.J. Natural chemical cues for settlement and metamorphosis of marine invertebrate larvae. In Marine Chemical Ecology, 1st ed.; McClintock, J.B., Baker, B.J., Eds.; CRC Press: Boca Raton, FL, USA, 2001; Volume 13, pp. 432–433. [Google Scholar]
- Hadfield, M.G.; Carpizo-Ituarte, E.J.; del Carmen, K.; Nedved, B.T. Metamorphic competence, a major adaptive convergence in marine invertebrate larvae. Am. Zool. 2001, 41, 1123–1131. [Google Scholar] [CrossRef]
- Harder, T.; Qian, P.Y. Induction of larval attachment and metamorphosis in the serpulid polychaete Hydroides elegans by dissolved free amino acids: Isolation and identification. Mar. Ecol. Prog. Ser. 1999, 179, 259–271. [Google Scholar] [CrossRef]
- Hadfield, M.G. Biofilms and marine invertebrate larvae: What bacteria produce that larvae use to choose settlement sites. Annu. Rev. Mar. Sci. 2011, 3, 453–470. [Google Scholar] [CrossRef]
- Bryan, P.J.; Qian, P.Y.; Kreider, J.L.; Chia, F.S. Induction of larval settlement and metamorphosis by pharmacological and conspecific associated compounds in the serpulid polychaete Hydroides elegans. Mar. Ecol. Prog. Ser. 1997, 146, 81–90. [Google Scholar] [CrossRef]
- Yang, J.L.; Shen, P.J.; Liang, X.; Li, Y.F.; Bao, W.Y.; Li, J.L. Larval settlement and metamorphosis of the mussel Mytilus coruscus in response to monospecific bacterial biofilms. Biofouling 2013, 29, 247–259. [Google Scholar] [CrossRef] [PubMed]
- Joyce, A.; Vogeler, S. Molluscan bivalve settlement and metamorphosis: Neuroendocrine inducers and morphogenetic responses. Aquaculture 2018, 487, 64–82. [Google Scholar] [CrossRef]
- Rivero, A. Nitric oxide: An antiparasitic molecule of invertebrates. Trends Parasitol. 2006, 22, 219–225. [Google Scholar] [CrossRef]
- Bruckdorfer, R. The basics about nitric oxide. Mol. Asp. Med. 2005, 26, 3–31. [Google Scholar] [CrossRef]
- Müller, U. The nitric oxide system in insects. Prog. Neurobiol. 1997, 51, 363–381. [Google Scholar] [CrossRef]
- Nappi, A.J.; Vass, E.; Frey, F.; Carton, Y. Nitric oxide involvement in Drosophila immunity. Nitric Oxide 2000, 4, 423–430. [Google Scholar] [CrossRef] [PubMed]
- Imamura, M.; Yang, J.; Yamakawa, M. cDNA cloning, characterization and gene expression of nitric oxide synthase from the silkworm, Bombyx mori. Insect Mol. Biol. 2002, 11, 257–265. [Google Scholar] [CrossRef] [PubMed]
- Foley, E.; O’Farrell, P.H. Nitric oxide contributes to induction of innate immune responses to gram-negative bacteria in Drosophila. Genes Dev. 2003, 17, 115–125. [Google Scholar] [CrossRef]
- Yang, X.X.; Wong, Y.H.; Zhang, Y.; Zhang, G.; Qian, P.Y. Exploring the regulatory role of nitric oxide (NO) and the NO-p38MAPK/cGMP pathway in larval settlement of the bryozoan Bugula neritina. Biofouling 2018, 34, 545–556. [Google Scholar] [CrossRef] [PubMed]
- Froggett, S.J.; Leise, E.M. Metamorphosis in the marine snail Ilyanassa obsoleta, yes or NO? Biol. Bull. 1999, 196, 57–62. [Google Scholar] [CrossRef] [PubMed]
- Pechenik, J.A.; Cochrane, D.E.; Li, W.; West, E.T.; Pires, A.; Leppo, M. Nitric oxide inhibits metamorphosis in larvae of Crepidula fornicata, the slippershell snail. Biol. Bull. 2007, 213, 160–171. [Google Scholar] [CrossRef]
- Bishop, C.D.; Pires, A.; Norby, S.W.; Boudko, D.; Moroz, L.L.; Hadfield, M.G. Analysis of nitric oxide-cyclic guanosine monophosphate signaling during metamorphosis of the nudibranch Phestilla sibogae Bergh (Gastropoda: Opisthobranchia). Evol. Dev. 2008, 10, 288–299. [Google Scholar] [CrossRef]
- Biggers, W.J.; Pires, A.; Pechenik, J.A.; Johns, E.; Patel, P.; Polson, T.; Polson, J. Inhibitors of nitric oxide synthase induce larval settlement and metamorphosis of the polychaete annelid Capitella teleta. Invertebr. Reprod. Dev. 2012, 56, 1–13. [Google Scholar] [CrossRef]
- Zhang, Y.; He, L.S.; Zhang, G.; Xu, Y.; Lee, O.O.; Matsumura, K.; Qian, P.Y. The regulatory role of the NO/cGMP signal transduction cascade during larval attachment and metamorphosis of the barnacle Balanus (=Amphibalanus) amphitrite. J. Exp. Biol. 2012, 215, 3813–3822. [Google Scholar]
- Zhang, G.; Wong, Y.H.; Zhang, Y.; He, L.S.; Xu, Y.; Qian, P.Y. Nitric oxide inhibits larval settlement in Amphibalanus amphitrite cyprids by repressing muscle locomotion and molting. Proteomics 2015, 15, 3854–3864. [Google Scholar] [CrossRef]
- Bishop, C.D.; Brandhorst, B.P. NO/cGMP signaling and HSP90 activity represses metamorphosis in the sea urchin Lytechinus pictus. Biol. Bull. 2001, 201, 394–404. [Google Scholar] [CrossRef]
- Comes, S.; Locascio, A.; Silvestre, F.; d’Ischia, M.; Russo, G.L.; Tosti, E.; Branno, M.; Palumbo, A. Regulatory roles of nitric oxide during larval development and metamorphosis in Ciona intestinalis. Dev. Biol. 2007, 306, 772–784. [Google Scholar] [CrossRef] [PubMed]
- Ueda, N.; Degnan, S.M. Nitric oxide acts as a positive regulator to induce metamorphosis of the ascidian Herdmania momus. PLoS ONE 2013, 8, e72797. [Google Scholar] [CrossRef] [PubMed]
- Ueda, N.; Degnan, S.M. Nitric oxide is not a negative regulator of metamorphic induction in the abalone Haliotis asinina. Front. Mar. Sci. 2014, 1, 21. [Google Scholar] [CrossRef]
- Song, H.; Hewitt, O.H.; Degnan, S.M. Arginine biosynthesis by a bacterial symbiont enables nitric oxide production and facilitates larval settlement in the marine-sponge host. Curr. Biol. 2021, 31, 433–437.e3. [Google Scholar] [CrossRef]
- Ercolesi, E.; Tedeschi, G.; Fiore, G.; Negri, A.; Maffioli, E.; d’Ischia, M.; Palumbo, A. Protein nitration as footprint of oxidative stress-related nitric oxide signaling pathways in developing Ciona intestinalis. Nitric Oxide 2012, 27, 18–24. [Google Scholar] [CrossRef]
- Castellano, I.; Ercolesi, E.; Palumbo, A. Nitric oxide affects ERK signaling through down-regulation of MAP kinase phosphatase levels during larval development of the ascidian Ciona intestinalis. PLoS ONE 2014, 9, e102907. [Google Scholar] [CrossRef]
- Chambon, J.P.; Soule, J.; Pomies, P.; Fort, P.; Sahuquet, A.; Alexandre, D.; Mangeat, P.H.; Baghdiguian, S. Tail regression in Ciona intestinalis (Prochordate) involves a Caspase-dependent apoptosis event associated with ERK activation. Development 2002, 129, 3105–3114. [Google Scholar] [CrossRef]
- Chambon, J.P.; Nakayama, A.; Takamura, K.; McDougall, A.; Satoh, N. ERK- and JNK-signalling regulate gene networks that stimulate metamorphosis and apoptosis in tail tissues of ascidian tadpoles. Development 2007, 134, 1203–1219. [Google Scholar] [CrossRef]
- Stuehr, D.J. Enzymes of the L-arginine to nitric oxide pathway. J. Nutr. 2004, 134, 2748S–2767S. [Google Scholar] [CrossRef]
- Vogeler, S.; Carboni, S.; Li, X.; Nevejan, N.; Monaghan, S.J.; Ireland, J.H.; Joyce, A. Bivalves are NO different: Nitric oxide as negative regulator of metamorphosis in the Pacific oyster, Crassostrea gigas. BMC Dev. Biol. 2020, 20, 23. [Google Scholar] [CrossRef]
- Griffith, O.W.; Stuehr, D.J. Nitric oxide synthases: Properties and catalytic mechanism. Annu. Rev. Physiol. 1995, 57, 707–736. [Google Scholar] [CrossRef]
- Alderton, W.K.; Cooper, C.E.; Knowles, R.G. Nitric oxide synthases: Structure, function and inhibition. Biochem. J. 2001, 357, 593–615. [Google Scholar] [CrossRef] [PubMed]
- Michel, T.; Feron, O. Nitric oxide synthases: Which, where, how, and why? J. Clin. Investig. 1997, 100, 2146–2152. [Google Scholar] [CrossRef] [PubMed]
- Bryan, N.S.; Bian, K.; Murad, F. Discovery of the nitric oxide signaling pathway and targets for drug development. Front. Biosci. (Landmark Ed.) 2009, 14, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Regulski, M.; Tully, T. Molecular and biochemical characterization of dNOS: A Drosophila Ca2+/calmodulin-dependent nitric oxide synthase. Proc. Natl. Acad. Sci. USA 1995, 92, 9072–9076. [Google Scholar] [CrossRef]
- Yuda, M.; Hirai, M.; Miura, K.; Matsumura, H.; Ando, K.; Chinzei, Y. cDNA cloning, expression and characterization of nitric-oxide synthase from the salivary glands of the blood-sucking insect Rhodnius prolixus. Eur. J. Biochem. 1996, 242, 807–812. [Google Scholar] [CrossRef]
- Nighorn, A.; Gibson, N.J.; Rivers, D.M.; Hildebrand, J.G.; Morton, D.B. The nitric oxide-cGMP pathway may mediate communication between sensory afferents and projection neurons in the antennal lobe of Manduca sexta. J. Neurosci. 1998, 18, 7244–7255. [Google Scholar] [CrossRef]
- Luckhart, S.; Rosenberg, R. Gene structure and polymorphism of an invertebrate nitric oxide synthase gene. Gene 1999, 232, 25–34. [Google Scholar] [CrossRef]
- Davies, S. Nitric oxide signalling in insects. Insect Biochem. Mol. Biol. 2000, 30, 1123–1138. [Google Scholar] [CrossRef]
- Scheinker, V.; Fiore, G.; Di Cristo, C.; Di Cosmo, A.; d’Ischia, M.; Enikolopov, G.; Palumbo, A. Nitric oxide synthase in the nervous system and ink gland of the cuttlefish Sepia officinalis: Molecular cloning and expression. Biochem. Biophys. Res. Commun. 2005, 338, 1204–1215. [Google Scholar] [CrossRef]
- Godoy, L.; Gonzàlez-Duarte, R.; Albalat, R. S-Nitrosogluthathione reductase activity of amphioxus ADH3: Insights into the nitric oxide metabolism. Int. J. Biol. Sci. 2006, 2, 117–124. [Google Scholar] [CrossRef] [PubMed]
- Matsuo, R.; Misawa, K.; Ito, E. Genomic structure of nitric oxide synthase in the terrestrial slug is highly conserved. Gene 2008, 415, 74–81. [Google Scholar] [CrossRef]
- Korneev, S.A.; Straub, V.; Kemenes, I.; Korneeva, E.I.; Ott, S.R.; Benjamin, P.R.; O’Shea, M. Timed and targeted differential regulation of nitric oxide synthase (NOS) and anti-NOS genes by reward conditioning leading to long-term memory formation. J. Neurosci. 2005, 25, 1188–1192. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Q.F.; Zhou, Z.; Wang, L.L.; Wang, L.L.; Yue, F.; Wang, J.J.; Song, L.S. A scallop nitric oxide synthase (NOS) with structure similar to neuronal NOS and its involvement in the immune defense. PLoS ONE 2013, 8, e69158. [Google Scholar] [CrossRef]
- Wang, C.; Bao, W.Y.; Gu, Z.Q.; Li, Y.F.; Liang, X.; Ling, Y.; Cai, S.L.; Shen, H.D.; Yang, J.L. Larval settlement and metamorphosis of the mussel Mytilus coruscus in response to natural biofilms. Biofouling 2012, 28, 249–256. [Google Scholar] [CrossRef]
- Zhu, Y.T.; Zhang, Y.; Liu, Y.Z.; Li, Y.F.; Yoshida, A.; Osatomi, K.; Yang, J.L.; Liang, X. Nitric oxide negatively regulates larval metamorphosis in hard-shelled mussel (Mytilus coruscus). Front. Mar. Sci. 2020, 7, 356. [Google Scholar] [CrossRef]
- Yang, J.L.; Satuito, C.G.; Bao, W.Y.; Kitamura, H. Induction of metamorphosis of pediveliger larvae of the mussel Mytilus galloprovincialis Lamarck, 1819 using neuroactive compounds, KCl, NH4Cl and organic solvents. Biofouling 2008, 24, 461–470. [Google Scholar] [CrossRef]
- Liang, X.; Chen, K.; Li, Y.F.; Bao, W.Y.; Yoshida, A.; Osatomi, K.; Yang, J.L. An α2-adrenergic receptor is involved in larval metamorphosis in the mussel, Mytilus coruscus. Biofouling 2019, 35, 986–996. [Google Scholar] [CrossRef]
- Yang, J.L.; Li, W.S.; Liang, X.; Li, Y.F.; Chen, Y.R.; Bao, W.Y.; Li, J.L. Effects of adrenoceptor compounds on larval metamorphosis of the mussel Mytilus coruscus. Aquaculture 2014, 426, 282–287. [Google Scholar] [CrossRef]
- Laudet, V. The origins and evolution of vertebrate metamorphosis. Curr. Biol. 2011, 21, R726–R737. [Google Scholar] [CrossRef]
- Holstein, T.W.; Laudet, V. Life-history evolution: At the origins of metamorphosis. Curr. Biol. 2014, 24, R159–R161. [Google Scholar] [CrossRef] [PubMed]
- Morris, S.M. Enzymes of arginine metabolism. J. Nutr. 2004, 134, 2743S–2747S. [Google Scholar] [CrossRef] [PubMed]
- Morris, S.M. Regulation of enzymes of the urea cycle and arginine metabolism. Annu. Rev. Nutr. 2002, 22, 87–105. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Morris, S.M. Arginine metabolism: Nitric oxide and beyond. Biochem. J. 1998, 336, 1–17. [Google Scholar] [CrossRef]
- Payne, S.H.; Loomis, W.F. Retention and loss of amino acid biosynthetic pathways based on analysis of whole-genome sequences. Eukaryot. Cell 2006, 5, 272–276. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.D.; Yang, Z.; Li, W. Transcriptome analysis of the ArgR regulon in Pseudomonas aeruginosa. J. Bacteriol. 2004, 186, 3855–3861. [Google Scholar] [CrossRef]
- Rinaldo, S.; Giardina, G.; Mantoni, F.; Paone, A.; Cutruzzolà, F. Beyond nitrogen metabolism: Nitric oxide, cyclic-di-GMP and bacterial biofilms. FEMS Microbiol. Lett. 2018, 365, fny029. [Google Scholar] [CrossRef] [PubMed]
- Romero, M.R.; Phuong, M.A.; Bishop, C.; Krug, P.J. Nitric oxide signaling differentially affects habitat choice by two larval morphs of the sea slug Alderia willowi: Mechanistic insight into evolutionary transitions in dispersal strategies. J. Exp. Biol. 2013, 216, 1114–1125. [Google Scholar]
- Okamoto, K.; Watanabe, A.; Watanabe, N.; Sakata, K. Induction of larval metamorphosis in serpulid polychaetes by L-DOPA and catecholamines. Fish. Sci. 1995, 61, 69–74. [Google Scholar] [CrossRef]
- Coon, S.L.; Bonar, D.B.; Weiner, R.M. Induction of settlement and metamorphosis of the pacific oyster, crassostrea gigas (Thunberg), by L-DOPA and catecholamines. J. Exp. Mar. Biol. Ecol. 1985, 94, 211–221. [Google Scholar] [CrossRef]
- Bao, W.Y.; Yang, J.L.; Satuito, C.G.; Kitamura, H. Larval metamorphosis of the mussel Mytilus galloprovincialis in response to Alteromonas sp. 1: Evidence for two chemical cues? Mar. Biol. 2007, 152, 657–666. [Google Scholar] [CrossRef]
- Andreakis, N.; D’Aniello, S.; Albalat, R.; Patti, F.P.; Garcia-Fernandez, J.; Procaccini, G.; Sordino, P.; Palumbo, A. Evolution of the nitric oxide synthase family in metazoans. Mol. Biol. Evol. 2011, 28, 163–179. [Google Scholar] [CrossRef] [PubMed]
- Korneev, S.A.; Piper, M.R.; Picot, J.; Phillips, R.; Korneeva, E.I.; O’Shea, M. Molecular characterization of NOS in a mollusc: Expression in a giant modulatory neuron. J. Neurobiol. 1998, 35, 65–76. [Google Scholar] [CrossRef]
- Cioni, C.; Di Patti, M.C.; Venturini, G.; Modica, M.V.; Scarpa, F.; Oliverio, M.; Toni, M. Cellular, biochemical, and molecular characterization of nitric oxide synthase expressed in the nervous system of the prosobranch Stramonita haemastoma (Gastropoda, Neogastropoda). J. Comp. Neurol. 2012, 520, 364–383. [Google Scholar] [CrossRef]
- Shao, Y.N.; Li, C.H.; Zhang, W.W.; Wang, Z.H.; Lv, Z.M. The first description of complete invertebrate arginine metabolism pathways implies dose-dependent pathogen regulation in Apostichopus japonicus. Sci. Rep. 2016, 6, 23783. [Google Scholar]
- Liang, X.; Chen, Y.; Gao, W.; Guo, X.; Ding, D.; Yoshida, A.; Osatomi, K.; Yang, J.L. Effects on larval metamorphosis in the mussel Mytilus coruscus of compounds that act on downstream effectors of G-protein-coupled receptors. J. Mar. Biol. Assoc. UK 2018, 98, 333–339. [Google Scholar] [CrossRef]
- Zaccolo, M.; Movsesian, M.A. cAMP and cGMP signaling cross-talk: Role of phosphodiesterases and implications for cardiac pathophysiology. Circ. Res. 2007, 100, 1569–1578. [Google Scholar] [CrossRef]
Primer | Sequence (5′–3′) | Usage |
---|---|---|
NOS siRNA | CGGCCGUUGACUAUAUAUATT | RNAi |
NC siRNA | UUCUCCGAACGUGUCACGUTT | RNAi |
McNOS-RT-F | GAAGTTCAAATAAAGCATCCAAAAT | qRT-PCR |
McNOS-RT-R | GTGGTGGTCCATTATTGTAGCTCCT | qRT-PCR |
EF-1α-RT-F | CACCACGAGTCTCTCCCTGA | qRT-PCR |
EF-1α-RT-R | GCTGTCACCACAGACCATTCC | qRT-PCR |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, Y.-T.; Liang, L.-L.; Liu, T.-T.; Liang, X.; Yang, J.-L. Effects of L-arginine on Nitric Oxide Synthesis and Larval Metamorphosis of Mytilus coruscus. Genes 2023, 14, 450. https://doi.org/10.3390/genes14020450
Zhu Y-T, Liang L-L, Liu T-T, Liang X, Yang J-L. Effects of L-arginine on Nitric Oxide Synthesis and Larval Metamorphosis of Mytilus coruscus. Genes. 2023; 14(2):450. https://doi.org/10.3390/genes14020450
Chicago/Turabian StyleZhu, You-Ting, Lin-Li Liang, Tian-Tian Liu, Xiao Liang, and Jin-Long Yang. 2023. "Effects of L-arginine on Nitric Oxide Synthesis and Larval Metamorphosis of Mytilus coruscus" Genes 14, no. 2: 450. https://doi.org/10.3390/genes14020450
APA StyleZhu, Y.-T., Liang, L.-L., Liu, T.-T., Liang, X., & Yang, J.-L. (2023). Effects of L-arginine on Nitric Oxide Synthesis and Larval Metamorphosis of Mytilus coruscus. Genes, 14(2), 450. https://doi.org/10.3390/genes14020450