Next Article in Journal
Genome-Wide Association Mapping for Yield and Yield-Related Traits in Rice (Oryza Sativa L.) Using SNPs Markers
Previous Article in Journal
Combined MITOchondrial-NUCLEAR (MITO-NUCLEAR) Analysis for Mitochondrial Diseases Diagnosis: Validation and Implementation of a One-Step NGS Method
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 14
Issue 5
10.3390/genes14051088
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Complete Mitochondrial Genome and Phylogenetic Analyses of To Chicken in Vietnam

by
Lan Doan Pham
1,*,
Thi Thanh Nhan Giang
1,
Van Ba Nguyen
1,
Thi Phuong Mai Pham
1,
Thi Thu Thuy Tran
1,
Thi Quynh Chau Nguyen
1,
Khanh Van Nguyen
1 and
Duy Ngoc Do
2,3,*
1
Key Laboratory of Animal Cell Technology, National Institute of Animal Sciences, Thuyphuong, Bac Tuliem, Hanoi 100000, Vietnam
2
Faculty of Veterinary Medicine, Viet Nam National University of Agriculture, Hanoi 100000, Vietnam
3
Department of Animal Science and Aquaculture, Dalhousie University, Truro, NS B2N 5E3, Canada
*
Authors to whom correspondence should be addressed.
Genes 2023, 14(5), 1088; https://doi.org/10.3390/genes14051088
Submission received: 24 March 2023 / Revised: 3 May 2023 / Accepted: 8 May 2023 / Published: 15 May 2023
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:
Indigenous chicken breeds have both cultural significance and economic value since they possess unique genetic characteristics that enable them to adapt to the local environment and contribute to biodiversity, food security, and sustainable agriculture in Vietnam. To (Tò in Vietnamese) chicken, a Vietnamese indigenous chicken breed, is popularly raised in Thai Binh province; however, little known is about the genetic diversity of this breed. In this study, we sequenced the complete mitochondrial genome of To chicken for a better understanding of the diversity and origin of the breed. The results of sequencing showed that the mitochondrial genome of To chicken spans a total length of 16,784 base pairs and comprises one non-coding control region (known as the displacement-loop (D-loop) region), two ribosomal RNA genes, 13 protein-coding genes, and 22 transfer RNA genes. The phylogenetic tree analyses and estimated genetic distances based on 31 complete mitochondrial genome sequences indicated that To chicken has a close genetic distance with the Laotian native chicken breed, Lv’erwu breed in China, and Nicobari black and Kadaknath breeds in India. The result of the current study might be important for conservation, breeding, and further genetic studies of To chicken.

1. Introduction

Vietnam, located in Southeast Asia, is one of the domestication centers of wild jungle fowls from about 10,000 years ago and it is also the area of origin for several indigenous chicken breeds or ecotypes in Asia [1]. More than 30 Vietnamese native chicken breeds has been identified based on their places of origin, morphology, and conservation status [1]. Chicken is an important part of Vietnamese culture since it is commonly used in Vietnamese cuisine, and many traditional dishes feature chicken as a main ingredient. Moreover, it also plays a role in Vietnamese folklore and superstitions. For example, a rooster is considered a symbol of good luck and is believed to bring prosperity and happiness. In Vietnamese culture, it is also stated that the sound of a rooster crowing can ward off evil spirits and bring blessings to the household. Moreover, it is used as a traditional medicine to improve the health of the sick and is used for cockfighting in annual festivals. Native chickens are commonly raised in Vietnamese households for both personal consumption and for sale in local markets. For many farmers, selling chicken is an important source of income for their families. To (Tò in Vietnamese) chicken is one of the Vietnamese indigenous chicken breeds. It is originated from To village, An My commune, Quynh Phu district of Thai Binh province, belonging to Red River Dental in Northeast Vietnam. At one day old, male and female chickens have similar physical features such as milky white feathers, a golden beak, and pinkish-white legs [2]. At 19 weeks of age, the rooster has dark red feathers, a single comb, bright red wattle, yellow beak, and long yellow legs, while the hen has brown body feathers, a single comb, and a golden beak and legs [2]. To chicken has a distinct feature compared to other Vietnamese indigenous chickens as it has feathers on its legs from the feet to the junction with the thigh. In addition, To chicken leg gap has a purple-red color (Figure 1). The average age of sexual maturation is approximately 148 days, and egg yield is from 120 to 140 eggs/hen per year [3]. The body weights of roosters and hens at 19 weeks of age are about 2.2 kg and 1.8 kg, respectively [2].
To chicken has been raised for a long time and is associated with the spiritual and cultural life of the people of To village. It was used as an offer for the Kings in the past due to its high meat quality. Currently, the number of To chicken is not much and facing the risk of decreasing, so this breed has been under conservation strategies to develop valuable products such as meat and eggs, contributing to the local householder livelihoods of several communes in Thai Binh province. However, knowledge about the origin and phylogenetic relationships of To chickens with other chicken populations is still insufficient.
Recent conservation genetic studies have significant contributions to our understanding of domestication and the genetic structure of livestock through the identification of wild ancestors, answering questions relating to the extent wild ancestors contributed to the gene pool of modern livestock and how domestication events took place. Information potentially has more importance for the management and conservation of today’s animal genetic resources. Mitochondrial (mt) DNA is one of the most widely used DNA-based markers in conservation genetic studies to evaluate evolution, population genetic diversity, and the relationship of individuals. The popularity of mtDNA markers is due to several characteristics. Firstly, maternal inheritance with no recombination of mtDNA advance to trace maternal genealogies. Secondly, compared to nuclear DNA, the evolutionary rate of mtDNA is five to ten times faster, making mtDNA an ideal material for determining the difference between populations and individuals [4]. Thirdly, mitochondrial-encoded genes of mtDNA involving basic metabolic functions show that these genes are relatively conserved in adaptive processes [5]. Finally, the amplification of mtDNA is generally easier compared to nuclear DNA in PCR because of multiple copies of mtDNA per cell.
Numerous phylogenetic studies in chickens have relied on sequences of the displacement-loop (D-loop) because this region has a higher polymorphic rate than other regions of mtDNA. Phylogenetic analyses by Liu et al. [6] classified 900 D-loop sequences of wild and domestic chickens from Eurasian into nine clades named A to I. While A, B, and E clades were widely distributed in Eurasia, others were restricted to South and Southeast Asia. These results suggest that chickens in divergent clades likely originate from different areas [6]. By analysis of the mtDNA D-loop, Oka et al. [7] revealed Japanese native chickens descended from Chinese, Korean, and Southeast Asian chickens. A study by Osman et al. [8] on the complete sequence of mtDNA D-loop region revealed the dual origin of domestic chickens in Egyptian including chickens from South Asia and the Pacific. A range of phylogenetic information of indigenous chickens of Southeast Asian countries was reported regarding mtDNA D-loop sequences. The majority of Laotian native chickens are associated with chickens from Southeast Asia and China [9]. Indonesian native chickens have three maternal lineages [10]. Most of the Thai indigenous chickens are related to chickens in South and Southwest China as well as surrounding and in Southeast Asia [11], while Philippine chickens are the origin of Pacific chickens [12]. Some phylogenetic studies of Vietnamese native chickens analyzed information of a partial sequence of the mtDNA-control region and reported that Vietnamese chickens originated from multiple maternal lineages. By using 455 base pairs (bp) sequences of mtDNA D-loop region multiple maternal origins of Vietnamese native chicken breeds including H’mong, Mia, Ri, Ho, Dong Tao, Te, Choi, Ac, Tau Vang [13] as well as Lien Minh, Dong Tao, Nhan, and Chin Cua [14] were identified. Do et al. [3] also indicated the phylogenetic relationship of To, Sau Ngon, Mong, and Tien Phong chickens with 13 haplogroups of domestic chickens in Eurasian regions based on a longer mtDNA D-loop fragment (525 bp). Ha Giang chicken population has close relationships with the silky breeds of China which is a result of the long migration across southern China [15]. However, recently, evaluations based on the complete sequence of mtDNA are predicted to be more accurate. The relatively small size of the control region limits the resolution of mtDNA. Because of the higher mutation rate of mtDNA compared to nuclear DNA, leading to high levels of repeated mutations in mtDNA which can obscure the structure of the matrilineal pedigree [16]. A study of the bird family Icteridae also demonstrated that the analysis of using the whole mitochondrial genome sequence better resolved and strongly supported hypotheses about phylogenetic relationships, compared to the use of phylogenetic relationships using the Cytochrome b and ND2 genes [17]. Recently, several studies have achieved better analytical results when using the whole mitochondrial genome to reconstruct the domestication history of animals such as cattle [18,19,20], dogs [21], horses [22], pigs [23], and chickens [16].
In this study, the complete sequence and organization of the mitochondrial genome of To chicken were determined to support conservation, origin, and evolution studies. Furthermore, the molecular phylogenetic relationships between this chicken breed and some domestic chickens and wild fowls were revealed based on complete mtDNA sequences.

2. Materials and Methods

2.1. Sample Collection and DNA Extraction

All the sample collection was done according to the standard animal care in Vietnam. Since Vietnam does not have any specific regulations regarding animal welfare. As a result, we have adapted the Vietnamese Law on Animal Health (2015) and the Vietnamese Law on Animal Husbandry (2018) in the current research. Although both laws forbid the mistreatment of animals, they do not provide specific guidelines for animal research. To ensure the best possible practices during sample collection, the authors have additionally incorporated the guidelines for animal research based on the EU directive 2010/63. The chickens were collected from the Quynh Phu district of Thai Binh province, which was the area of origin and current distribution of To chicken. One milliliter (1 mL) of blood was collected from the wing vein and stored in vials containing Ethylenediaminetetraacetic acid (EDTA) 0.5 M as an anticoagulant at 4 °C until use. Genomic DNA was extracted from the whole blood by using GeneJET Genomic ADN Purification Kit (Thermo Scientific™, Thermo Fisher Scientific, Waltham, USA) following the manual instruction from the company and stored at −20 °C until use. The concentration of genomic DNA was measured by the Qubit® 3.0 Fluorometer (InvitrogenTM, Thermo Fisher Scientific, Waltham, MA, USA).

2.2. Polymerase Chain Reaction (PCR) Amplifications of the mtDNA Sequences

A set of 23 primer pairs (Table 1) designed by Bao et al. [24] was used for the PCR reactions. The PCR reaction containing 12.5 μL buffer DreamTaq PCR Master Mix 2X (Thermo Scientific™, Thermo Fisher Scientific, Waltham, MA, USA), 0.5 μL each primer (10 pM), 100 ng DNA template, and nuclease-free water in a 25 μL reaction volume. The thermal cycling began initial denaturation at 94 °C for 3 min; followed by 35 cycles of denaturation at 94 °C for 30 s, annealing temperature (Ta) °C for 30 s (Ta °C depending on each primer pair in Table 1), extension at 72 °C for 1 min; final extension at 72 °C for 7 min. The PCR products were visualized under UV light after mixing with 6X loading dye and electrophoresis on 1.5% agarose gel stained with RedSafeTM Nucleic Acid Staining Solution (iNtRON Biotechnology, Seongnam, Republic of Korea) for 35 min at 100 V.

2.3. Sequencing and Structure Analysis

The amplicons were sequenced in both directions using an ABI 3130 DNA analyzer (Applied Biosystems, MA, USA) with the same PCR primers. The DNA sequences were assembled using Unipro UGENE software version 40.1 [25] and exported to FASTA files. The complete mitochondrial sequence was annotated using MITOS [26]. The nucleotide composition and GC contents of To’s mitochondrial genome were calculated using DAMBE software version 7.3.5 [27]. The mitochondrial genome map of To chicken was produced by GenomeVx 2.0 [28]

2.4. Phylogenetic Analysis

The complete mtDNA sequence of To chicken was aligned with mitochondrial genome sequences of other chicken breeds retrieved from The National Center for Biotechnology Information (NCBI) database following accession numbers as listed in Table 2 by using the MUSCLE algorithm of MEGA software version X [29]. A maximum likelihood (ML) tree was constructed by MEGA software version X [29] using 1000 bootstrap replicates.

3. Results

3.1. Structure of Mitochondrial Genome of To Chicken

The complete mitochondrial genome sequence of To chicken was determined and deposited in GeneBank with accession No. OL959342. The total length of To chicken mitochondrial genome was 16,784 bp. The nucleotide composition was 30.26% for A, 23.72% for T, 32.51% for C, and 13.51% for G. The A + T content (53.98%) is greater than G + C content (46.02%). In the genome, the GC contents have a significant impact on gene expression in chickens since the GC content in genes is responsible for approximately 10% of the variation in gene expression [30]. The structure of To mitochondrial genome was shown in Table 3. The results of annotating the structure and arrangement of the components of the mitochondrial genome of To chicken were highly similar to the typical mitochondrial genome of White Leghorn chickens identified by Desjardins and Morais [31]. The mitochondrial gene arrangements of To chicken was shown in Figure 2. Like the mitochondrial genome of other vertebrates, the mitochondrial genome of the studied chicken breed included a non-coding region (D-loop) and 37 genes, including 2 genes encoding ribosomal RNA (rRNA), 13 protein-coding genes, 22 genes encoding transfer RNA (tRNA), distributed on both H (Heavy) and L (Light) strands of mitochondria. The D-loop region and coding genes were located mainly on the H-strand except for the nicotinamide adenine dinucleotide dehydrogenase (ND) 6 gene and eight tRNA genes on the L-strand. The start codons of the 12 protein-coding genes were mainly ATG, while that of the cytochrome c oxidase subunits (CO) I gene is GTG. The COIII and ND4 genes ended with an incomplete stop codon (T--), under the assumption that a stop codon TAA will form after undergoing polyadenylation during post-transcription [32]; the ND2 gene ends with a codon TAG; the COI gene ended with the codon AGG; and other protein-coding genes all had stop codon TAA. In the mitochondrial genome, 17 non-coding spaces were found between genes; the spaces in the length range from 1 to9 bp. While the sequences of some genes were contiguous, such as tRNA-Ile and ND1; tRNA-Met and ND2, sequences of several other genes overlapped. For example, COI and tRNA-Ser2, ATP 8 and ATP 6, ND4L, and ND4 (Table 3). There were 7 overlaps in size 1 to 10 bp. The length of the D loop region was 1231 bp. The length of 12SrRNA and 16S rRNA were 975 bp and 1622 respectively. The overall lengths of 13 protein-coding genes were 11,394 bp and 22 tRNA genes, ranging from 65 to 76 bp in length.

3.2. Phylogenetic Analysis

A matrilineal phylogenetic tree was constructed based on the complete mitochondrial genome sequence of To chicken breed, 11 sequences of jungle fowls including 8 red jungle fowls sequences, 1 green jungle fowl, 1 grey jungle fowl, and 1 Ceylon jungle fowl, and 19 sequences of domestic chicken that were distributed in different areas of Asia (China, India, Laos, Philippine, Indonesia and New Guinea) and Europe taken from GenBank NCBI, which are listed in Table 2. From the results of the multi-sequence alignment, the best nucleotide substitution model was identified as HKY + G + I. The phylogenetic tree is shown in Figure 3.
The phylogenetic tree results showed seven large clades based on the complete mtDNA sequence (Figure 3). While Green Jungle Fowl (Gallus varius) and Ceylon Jungle Fowl (Gallus lafayetii) were grouped in separate clades (VI and VII respectively) and were independent with domestic chickens, and Grey Jungle Fowl (Gallus sonneratii) and four subspecies of Red Jungle Fowl (Gallus gallus): G. g. bankiva, G. g. gallus, G. g. spadiceus and G. g. murghi were grouped with domestic chickens. In the phylogenetic tree, To chicken was far from chicken groups in the island of Southeast Asia (Philippines, Indonesia, and Long Island New Guinea). To chicken was alone in a subclade and was distributed in clade I, the largest clade including most of the Indian native chicken breeds, Laotian native chickens, three Chinese native chickens, two commercial chicken breeds (White Leghorn and White Plymouth Rock), wild chicken species Grey Jungle Fowl (Gallus sonneratii), and Indian Red Jungle Fowl. Genetic distances analysis in this study determined To chicken had the shortest genetic distances from Grey Jungle Fowl (Gallus sonneratii) (0.0002386), Lv’erwu chicken (in Yunnan, China) (0.0002983), Laos native chicken (0.0004176), Nicobari black (0.0006565), and Kadaknath (0.0007162).

4. Discussion

Vietnam is known for being one of the domesticated chicken centers in Southeast Asia. However, the origin and history of the domestication of Vietnamese native chickens are still uncertain. The complete mitochondrial genome sequence supplied important genetic information for accurately measuring phylogenetic relationships. In this study, the mitochondrial genome sequences and structures were determined for To chicken. The complete mtDNA genome of To chicken was 16,874 bp in size and included 13 protein-coding genes, 22 tRNA genes, two rRNA genes, and one non-coding region (D-loop region) similar to the mitochondrial genome of other vertebrates. The overall A + T contents of To chicken mtDNA genomes was 53.98% with the percentage of each nucleotide composition being 32.51% for C, 30.26% for A, 23.72% for T, and 13.51% for G which were similar to those of some Chinese native breeds such as Wuhua three-yellow chickens, Longsheng Feng chickens, Luhua chickens, Piao chickens, Taoyan chickens, and Huangshan Black chickens [33,34,35,36,37,38]. Moreover, the overall composition of Indian local chickens is in the order G > A > T > C [39].
The results of genetic distance analyses showed a close genetic relationship of To chicken with the native chicken breeds in Laos (Laos native chicken breed), China (Lv’erwu chicken), and India (Nicobari black and Kadaknath breeds) (Figure 3). These results were supported by the hypothesis that Vietnamese chickens have multiple maternal lineages. Previously, Vietnamese domestic chicken breeds are suggested being originated from regions with diverse maternal lineages, including Yunnan and surrounding areas in South and Southwest China, as well as neighboring countries like Burma, Thailand, and India [3,13,15]. Moreover, the phylogeny tree also demonstrated the close relationship of To chicken with the Grey Jungle Fowl (Gallus sonneratii), which inhabits India, north to southern Rajasthan, Gujarat, Madhya Pradesh, and Andhra Pradesh to Polavaram [40]. Meanwhile, Vietnam is a place where the domestication of Red Jungle Fowl occurred and where two subspecies G.g.gallus and G.g.jabouillei were reported inhabitants [41]. This close relationship indicated a possible contribution to the genetics of Grey Jungle Fowl into the gene pool of To chickens. Nishibori et al. [40] found molecular evidence of the inter-species hybridization between Grey Jungle Fowl and Red Jungle Fowl by phylogenetic analysis using mtDNA sequences. Meanwhile, another study also proposed evidence for the hybrid origin of domestic chickens when detected the yellow skin allele originates from Grey Jungle Fowl [42]. The Bekisar chicken, an Indonesian native chicken breed, has a hybrid origin between the Green Jungle Fowl rooster and the domesticated chicken hen [10]. This suggests the necessity to conduct further studies to test the hybrid origin of domestic chickens.
While mtDNA serves as a useful resource to study genetic diversity and evolutionary relationships, it is essential to acknowledge its limitations in research, including incomplete lineage sorting (maternal inheritance), absence of recombination, mutational saturation, or introgression (transfer of mtDNA between species) [43,44]. Therefore, alternative genomic tools, such as whole genome sequencing, genotyping by sequencing, or utilizing different SNP panels, must be employed to analyze the genetic diversity and population structure of To chicken. Meanwhile, it is necessary to develop an efficient breeding program such as a community-based breeding program [45] for this breed to avoid the loss of its genetic diversity or enhance productivity.

5. Conclusions

The complete mitochondrial genome DNA sequence of To chicken breed was determined to be 16,784 bp in length. The phylogenetic analysis suggested that To chicken has multiple maternal lineages and a close relationship with Laos native chicken breed, Lv’erwu chicken breed from China, and Nicobari black and Kadaknath chicken from India. These results will be valuable for further studies on the evolution, phylogeny, and conservation of To chicken.

Author Contributions

Conceptualization: L.D.P. and D.N.D.; Methodology: L.D.P., T.T.N.G., V.B.N., T.P.M.P., T.T.T.T., T.Q.C.N., K.V.N. and D.N.D.; Formal Analysis: L.D.P., T.T.N.G., V.B.N., T.P.M.P., T.T.T.T., T.Q.C.N. and K.V.N.; Writing: T.T.N.G., V.B.N., L.D.P. and D.N.D.; Review and Editing: L.D.P., T.T.N.G., V.B.N., T.P.M.P., T.T.T.T., T.Q.C.N., K.V.N. and D.N.D.; Project Administration: L.D.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Since Vietnam does not have any specific regulations regarding animal welfare, we have adapted the Vietnamese Law on Animal Health (2015) and the Vietnamese Law on Animal Husbandry (2018) in the current research. Although both laws forbid the mistreatment of animals, they do not provide specific guidelines for animal research. To ensure the best possible practices during sample collection, the authors have additionally incorporated the guidelines for animal research based on the EU directive 2010/63.

Data Availability Statement

The complete mitochondrial genome sequence of To chicken was determined and deposited in GeneBank with accession No. OL959342.

Acknowledgments

The authors would like to thank local farmers for their help during the sampling process. The authors would like to thank the Vietnamese Ministry of Science and Technology for supporting the project.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Phuong, T.L.; Xuan, K.D.; Szalay, I. Traditions and local use of native Vietnamese chicken breeds in sustainable rural farming. World’s Poult. Sci. J. 2015, 71, 385–396. [Google Scholar] [CrossRef]
  2. Pham, T.C.; Nguyen, T.Q.; Pham, N.H.; Ho, T.X.; Tran, P.V.; Tran, H.T.; Nguyen, H.T.T.; Ma, D.T.; Pham, B.H.; Le, B.T. Selection of nuclear herd of to chickens. J. Anim. Sci. Technol. 2018, 85, 46–54. [Google Scholar]
  3. Do, S.Q.; Nguyen, L.T.P.; Nguyen, T.H.; Nguyen, T.Q. Genomic characterization of three Vietnamese indigenous chicken varieties using mitochondrial D-loop sequences. Can. J. Anim. Sci. 2019, 99, 833–839. [Google Scholar] [CrossRef]
  4. Arif, I.A.; Khan, H.A.; Bahkali, A.H.; Al Homaidan, A.A.; Al Farhan, A.H.; Al Sadoon, M.; Shobrak, M. DNA marker technology for wildlife conservation. Saudi J. Biol. Sci. 2011, 18, 219–225. [Google Scholar] [CrossRef] [PubMed]
  5. Galtier, N.; Nabholz, B.; Glémin, S.; Hurst, G.D.D. Mitochondrial DNA as a marker of molecular diversity: A reappraisal. Mol. Ecol. 2009, 18, 4541–4550. [Google Scholar] [CrossRef]
  6. Liu, Y.P.; Wu, G.S.; Yao, Y.G.; Miao, Y.W.; Luikart, G.; Baig, M.; Beja-Pereira, A.; Ding, Z.L.; Palanichamy, M.G.; Zhang, Y.P. Multiple maternal origins of chickens: Out of the Asian jungles. Mol. Phylogenetics Evol. 2006, 38, 12–19. [Google Scholar] [CrossRef]
  7. Oka, T.; Ino, Y.; Nomura, K.; Kawashima, S.; Kuwayama, T.; Hanada, H.; Amano, T.; Takada, M.; Takahata, N.; Hayashi, Y.; et al. Analysis of mtDNA sequences shows Japanese native chickens have multiple origins. Anim. Genet. 2007, 38, 287–293. [Google Scholar] [CrossRef]
  8. Osman, S.A.M.; Yonezawa, T.; Nishibori, M. Origin and genetic diversity of Egyptian native chickens based on complete sequence of mitochondrial DNA D-loop region. Poult. Sci. 2016, 95, 1248–1256. [Google Scholar] [CrossRef]
  9. Kawabe, K.; Worawut, R.; Taura, S.; Shimogiri, T.; Nishida, T.; Okamoto, S. Genetic diversity of mtDNA D-loop polymor-phisms in Laotian native fowl populations. Asian-Australas. J. Anim. Sci. 2014, 27, 19. [Google Scholar] [CrossRef]
  10. Ulfah, M.; Perwitasari, D.; Jakaria, J.; Muladno, M.; Farajallah, A. Multiple maternal origins of Indonesian crowing chickens revealed by mitochondrial DNA analysis. Mitochondrial DNA Part A 2017, 28, 254–262. [Google Scholar] [CrossRef]
  11. Teinlek, P.; Siripattarapravat, K.; Tirawattanawanich, C. Genetic diversity analysis of Thai indigenous chickens based on complete sequences of mitochondrial DNA D-loop region. Asian-Australas. J. Anim. Sci. 2018, 31, 804. [Google Scholar] [CrossRef]
  12. Godinez, C.J.P.; Dadios, P.J.D.; Espina, D.M.; Matsunaga, M.; Nishibori, M. Population Genetic Structure and Contribution of Philippine Chickens to the Pacific Chicken Diversity Inferred From Mitochondrial DNA. Front. Genet. 2021, 12, 698401. [Google Scholar] [CrossRef]
  13. Cuc, N.T.K.; Simianer, H.; Groeneveld, L.F.; Weigend, S. Multiple maternal lineages of Vietnamese local chickens inferred by mitochondrial DNA D-loop sequences. Asian-Australas. J. Anim. Sci. 2011, 24, 155–161. [Google Scholar] [CrossRef]
  14. Nguyen, T.; Duc, N.; Khoa, D.; Tuong, N.; Reyer, H.; Wimmers, K.; Thuy, D.; Thuy, N. Genetic diversity of Vietnamese native chicken breeds based on mitochondrial DNA D-loop sequence. J. Anim. Plant Sci. 2022, 32, 653–662. [Google Scholar]
  15. Berthouly-Salazar, C.; Rognon, X.; Nhu Van, T.; Gély, M.; Vu Chi, C.; Tixier-Boichard, M.; Bed’Hom, B.; Bruneau, N.; Verrier, E.; Maillard, J.C. Vietnamese chickens: A gate towards Asian genetic diversity. BMC Genet. 2010, 11, 53. [Google Scholar] [CrossRef]
  16. Miao, Y.W.; Peng, M.S.; Wu, G.S.; Ouyang, Y.N.; Yang, Z.Y.; Yu, N.; Liang, J.P.; Pianchou, G.; Beja-Pereira, A.; Mitra, B.; et al. Chicken domestication: An updated perspective based on mitochondrial genomes. Heredity 2013, 110, 277–282. [Google Scholar] [CrossRef]
  17. Powell, A.F.L.A.; Barker, K.F.; Lanyon, S.M. Empirical evaluation of partitioning schemes for phylogenetic analyses of mitogenomic data: An avian case study. Mol. Phylogenetics Evol. 2013, 66, 69–79. [Google Scholar] [CrossRef]
  18. Achilli, A.; Bonfiglio, S.; Olivieri, A.; Malusa, A.; Pala, M.; Kashani, B.H.; Perego, U.A.; Ajmone-Marsan, P.; Liotta, L.; Semino, O. The multifaceted origin of taurine cattle reflected by the mitochondrial genome. PLoS ONE 2009, 4, e5753. [Google Scholar] [CrossRef]
  19. Achilli, A.; Olivieri, A.; Pellecchia, M.; Uboldi, C.; Colli, L.; Al-Zahery, N.; Accetturo, M.; Pala, M.; Kashani, B.H.; Perego, U.A.; et al. Mitochondrial genomes of extinct aurochs survive in domestic cattle. Curr. Biol. 2008, 18, R157–R158. [Google Scholar] [CrossRef]
  20. Bonfiglio, S.; Achilli, A.; Olivieri, A.; Negrini, R.; Colli, L.; Liotta, L.; Ajmone-Marsan, P.; Torroni, A.; Ferretti, L. The enigmatic origin of bovine mtDNA haplogroup R: Sporadic interbreeding or an independent event of Bos primigenius domestication in Italy? PLoS ONE 2010, 5, e15760. [Google Scholar] [CrossRef]
  21. Pang, J.F.; Kluetsch, C.; Zou, X.J.; Zhang, A.B.; Luo, L.Y.; Angleby, H.; Ardalan, A.; Ekström, C.; Sköllermo, A.; Lundeberg, J.; et al. mtDNA data indicate a single origin for dogs south of Yangtze River, less than 16,300 years ago, from numerous wolves. Mol. Biol. Evol. 2009, 26, 2849–2864. [Google Scholar] [CrossRef] [PubMed]
  22. Achilli, A.; Olivieri, A.; Soares, P.; Lancioni, H.; Kashani, B.H.; Perego, U.A.; Nergadze, S.G.; Carossa, V.; Santagostino, M.; Capomaccio, S.; et al. Mitochondrial genomes from modern horses reveal the major haplogroups that underwent domestication. Proc. Natl. Acad. Sci. USA 2012, 109, 2449–2454. [Google Scholar] [CrossRef] [PubMed]
  23. Wu, G.S.; Yao, Y.G.; Qu, K.X.; Ding, Z.L.; Li, H.; Palanichamy, M.G.; Duan, Z.Y.; Li, N.; Chen, Y.S.; Zhang, Y.P. Population phylogenomic analysis of mitochondrial DNA in wild boars and domestic pigs revealed multiple domestication events in East Asia. Genome Biol. 2007, 8, R245. [Google Scholar] [CrossRef] [PubMed]
  24. Bao, H.G.; Zhao, C.J.; Li, J.Y.; Wu, C.X. Sequencing and alignment of mitochondrial genomes of Tibetan chicken and two lowland chicken breeds. Sci. China Ser. C Life Sci. 2008, 51, 47–51. [Google Scholar] [CrossRef] [PubMed]
  25. Okonechnikov, K.; Golosova, O.; Fursov, M. Unipro UGENE: A unified bioinformatics toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef] [PubMed]
  26. Bernt, M.; Donath, A.; Jühling, F.; Externbrink, F.; Florentz, C.; Fritzsch, G.; Pütz, J.; Middendorf, M.; Stadler, P.F. MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol. Phylogenetics Evol. 2013, 69, 313–319. [Google Scholar] [CrossRef]
  27. Xia, X. DAMBE6: New tools for microbial genomics, phylogenetics, and molecular evolution. J. Hered. 2017, 108, 431–437. [Google Scholar] [CrossRef]
  28. Conant, G.C.; Wolfe, K.H. GenomeVx: Simple web-based creation of editable circular chromosome maps. Bioinformatics 2008, 24, 861–862. [Google Scholar] [CrossRef]
  29. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547. [Google Scholar] [CrossRef]
  30. Rao, Y.S.; Chai, X.W.; Wang, Z.F.; Nie, Q.H.; Zhang, X.Q. Impact of GC content on gene expression pattern in chicken. Genet. Sel. Evol. 2013, 45, 9. [Google Scholar] [CrossRef]
  31. Desjardins, P.; Morais, R. Sequence and gene organization of the chicken mitochondrial genome: A novel gene order in higher vertebrates. J. Mol. Biol. 1990, 212, 599–634. [Google Scholar] [CrossRef]
  32. Clayton, D.A. Replication and transcription of vertebrate mitochondrial DNA. Annu. Rev. Cell Biol. 1991, 7, 453–478. [Google Scholar] [CrossRef]
  33. Huang, X.H.; Zhong, F.S.; Li, W.N.; Chen, J.B.; Zhang, A.X.; Yao, Q.F. Complete mitochondrial genome of the Wuhua three-yellow chicken (Gallus gallus domesticus). Mitochondrial DNA Part A 2016, 27, 1311–1312. [Google Scholar] [CrossRef]
  34. Gu, J.; Li, S. Complete mitochondrial genome of the Longsheng Feng chicken (Gallus gallus). Mitochondrial DNA Part B 2020, 5, 2911–2912. [Google Scholar] [CrossRef]
  35. Gu, J.; Li, S. The complete mitochondrial genome of the Luhua chicken (Gallus gallus). Mitochondrial DNA Part B 2020, 5, 2832–2834. [Google Scholar] [CrossRef]
  36. Gu, J.; Li, S. Next-generation sequencing of the complete mitochondrial genome of the Piao chicken (Gallus gallus). Mitochondrial DNA Part B 2020, 5, 2870–2871. [Google Scholar] [CrossRef]
  37. Liu, L.L.; Xie, H.B.; Yu, Q.F.; He, S.P.; He, J.H. Determination and analysis of the complete mitochondrial genome sequence of Taoyuan chicken. Mitochondrial DNA Part A 2016, 27, 371–372. [Google Scholar] [CrossRef]
  38. Jin, S.; Zang, H.; He, P.; Jiang, T.; Pan, S.; Geng, Z. Complete mitochondrial genome and phylogenetic analysis of Huangshan Black chicken (Gallus gallus). Mitochondrial DNA Part B 2021, 6, 243–244. [Google Scholar] [CrossRef]
  39. Kanakachari, M.; Chatterjee, R.; Rajkumar, U.; Haunshi, S.; Reddy, M.; Bhattacharya, T. Indian Red Jungle fowl depicts close genetic relationship with Indian native chicken breeds as evidenced through whole mitochondrial genome intersection. bioRxiv 2020. [Google Scholar] [CrossRef]
  40. Nishibori, M.; Shimogiri, T.; Hayashi, T.; Yasue, H. Molecular evidence for hybridization of species in the genus Gallus except for Gallus varius. Anim. Genet. 2005, 36, 367–375. [Google Scholar] [CrossRef]
  41. Lawal, R.A.; Hanotte, O. Domestic chicken diversity: Origin, distribution, and adaptation. Anim. Genet. 2021, 52, 385–394. [Google Scholar] [CrossRef] [PubMed]
  42. Eriksson, J.; Larson, G.; Gunnarsson, U.; Bed’Hom, B.; Tixier-Boichard, M.; Strömstedt, L.; Wright, D.; Jungerius, A.; Vereijken, A.; Randi, E.; et al. Identification of the yellow skin gene reveals a hybrid origin of the domestic chicken. PLoS Genet. 2008, 4, e1000010. [Google Scholar] [CrossRef] [PubMed]
  43. DeSalle, R.; Schierwater, B.; Hadrys, H. MtDNA: The small workhorse of evolutionary studies. Front. Bioscie. 2017, 22, 873–887. [Google Scholar] [CrossRef] [PubMed]
  44. Wan, Q.H.; Wu, H.; Fujihara, T.; Fang, S.G. Which genetic marker for which conservation genetics issue? Electrophoresis 2004, 25, 2165–2176. [Google Scholar] [CrossRef]
  45. Mueller, J.P.; Rischkowsky, B.; Haile, A.; Philipsson, J.; Mwai, O.; Besbes, B.; Valle Zárate, A.; Tibbo, M.; Mirkena, T.; Duguma, G. Community—Based livestock breeding programmes: Essentials and examples. J. Anim. Breed. Gen. 2015, 132, 155–168. [Google Scholar] [CrossRef]
Genes 14 01088 g001 550
Figure 1. The mature To rooster.
Figure 1. The mature To rooster.
Genes 14 01088 g001
Genes 14 01088 g002 550
Figure 2. Scale drawing of the mitochondrial genome of To chicken.
Figure 2. Scale drawing of the mitochondrial genome of To chicken.
Genes 14 01088 g002
Genes 14 01088 g003 550
Figure 3. Maximum likelihood phylogenetic tree for complete mtDNA sequence of To chicken. A total of 19 sequences of domestic chicken and 11 sequences of jungle fowls. Node labels correspond to bootstrap values evaluated with 1000 replicates. Bootstrap values under 50% are not shown. The position of To chicken in the tree is marked by a red triangle.
Figure 3. Maximum likelihood phylogenetic tree for complete mtDNA sequence of To chicken. A total of 19 sequences of domestic chicken and 11 sequences of jungle fowls. Node labels correspond to bootstrap values evaluated with 1000 replicates. Bootstrap values under 50% are not shown. The position of To chicken in the tree is marked by a red triangle.
Genes 14 01088 g003
Table
Table 1. Primers and conditions of amplification.
Table 1. Primers and conditions of amplification.
PrimerPCR Primer SequencesTa *
°C		Expected PCR Product Length (bp)
Forward (5′-3′)Reverse (5′-3′)
1CTCGCCCTACTTGCCTTCCTGCCTGATACCTGCTCCTTT60925
2CACTGAAGATGCCAAGATGGTACCTTGACCTGTCTTATTAGCGA63748
3TGCCAGCACAGCCTACATAGAGACGGGTTCGCTCAAAT58750
4TAGCAAGAACAACCAAGCAAAGTGCCATTCATACAAGTCTCAATTTACGG63781
5GCAAACCAAAGACCCGACTGGTGTTCATAGATAGAAACCGACCTG60656
6CGACAAGGAGGTTTACGACGAAGGTTTGTTAGGGTGGG62389
7TTAACAGTCCTACGTGATCTGAGTGAGTGCAATGGGAAATAATTCT591077
8TAACCACCGTCCTATTCCTGATCAGGCGTTGGTTATGCT63699
9CGAGCGATTGAAGCCACTAGCAAGTCGGAGGTAGAAGAAT59740
10GGCTTCATGCCAAAATGACTAGAATGGAGGAAACACCTGCTA55.51109
11CCTACTAGCCTCATCTACCGTAGGCGTCTGGGTAATCTGAGTATC591105
12ACAGGCTTTACCCTACACCCAGGTTAAGATGACAGTAGTGAGGATCA601172
13GCAATCCCTGGACGACTAAATCAATGGGCTTGGGTCAACTATGTG621122
14ACCAATAATACCATCAATCTCCCGCTTAGTAGAAAGGATAGTGAG591034
15TTTGCCTCCTACGACTAATCAAGCTGTATATTGTGGTGTTAGTTCATAT541008
16TCATTCGCCCTTGGACCTATTTGGGGTGGGTGAGTTTGAT58682
17CATTCGCCCTTGGACCTATCGATGGAAGAGTGCCTCGTTGG631388
18CCTAAAATCCCTCATTGCCTACTATGTTATTTGCGATGGTTAGTG601157
19GAAAGCATTGCCACCCACTGATGATTGCTGGGGTTCGTGTG601141
20CCACCTCCTGCCTAACCATTTCGTCCGATGTGAAGGAAGATA601020
21AACGTACAATACGGCTGACAGGTTTGAGTCCTCCTTTT611022
22CCCCACAATCGGAACACTAGGTCTAACCAAGCGGGAATA60735
23GATTAGACGCCACAGCTAAATTCGTGAAAAGTGAGAAAGTTC63721
*: annealing temperature.
Table
Table 2. Complete chicken mitochondrial genome deposited in the GenBank NCBI.
Table 2. Complete chicken mitochondrial genome deposited in the GenBank NCBI.
No.Breed/Common NameGenBank Accession No.Geographic Location
1Red jungle fowl (G. g. bankiva)AP003323Indonesia
2Red jungle fowl (G. g. gallus)AP003322Philippine
3Red jungle fowl (G. g. spadiceus)AP003321Laos
4Red jungle fowl (G. g. spadiceus)GU261716Myanmar
5Red jungle fowl (G. g. spadiceus)GU261702China
6Red jungle fowl (G. g. jabouillei)GU261674China
7Red jungle fowl (G. g. murghi)GU261708India
8Red jungle fowl (G. g. murghi)KP211423India
9Green jungle fowl (G. varius)AP003324Indonesia
10Grey jungle fowl (G. sonheratii)AP003320Laos
11Ceylon jungle fowl (G. lafayettei)AP003325Japan
12White LeghornAP003317Europe
13White Plymouth RockAP003318Europe
14Lao’s negative chickenAP00319Laos
15Domestic chicken KY039399Philippine
16Domestic chickenKY039425Indonesia
17Domestic chickenKY039394Long Island New Guinea
18Aseel KP211418India
19Ghagus KP211419India
20Haringhata Black KP211420India
21Nicobari Black KP211421India
22Nicobari Brown KP211422India
23Tellicherry KP211424India
24Kadaknath KP211425India
25Rugao Yellow KP742951China
26Xiaoxiang KX781319China
27Xuefeng GU261675China
28Lverwu GU261712China
29Jinhu Wufeng KR347464China
30Tibetan DQ648776China
Table
Table 3. Structural mtDNA of To chicken.
Table 3. Structural mtDNA of To chicken.
GeneStrandPositionLength
(bp)		Intergenic Nucleotide *CodonsAnti-Codon
StartEndStartStop
D-loopH1123112310
tRNA-PheH12321301700 GAA
12S rRNAH130222769750
tRNA-ValH22772349730 TAC
16S rRNAH2350397116220
tRNA-Leu2H39724045749 TAA
ND1H405550299750ATGTAA
tRNA-IleH50305101725 GAT
tRNA-GlnL5107517771−1 TTG
tRNA-MetH51775245690 CAT
ND2H524662861041−2ATGTAG
tRNA-TrpH62856360766 TCA
tRNA-AlaL63676435693 TGC
tRNA-AsnL64396511731 GTT
tRNA-CysL6513657866−1 GCA
tRNA-TyrL65786648711 GTA
COIH665082001551−9GTGAGG
tRNA-Ser2L81928266752 TGA
tRNA-AspH82698337691 GTC
COIIH833990226841ATGTAA
tRNA-LysH90249091681 TTT
ATP8H90939257165−10ATGTAA
ATP6H92489931684−1ATGTAA
COIIIH9931107147840ATGT--
tRNA-GlyH1071510783690 TCC
ND3H10784111353521ATGTAA
tRNA-ArgH1113711204680 TCG
ND4LH1120511501297−7ATGTAA
ND4H114951287213780ATGT--
tRNA-HisH1287312941691 GTG
tRNA-Ser1H1294313007651 GCT
tRNA-Leu1H1300913079710 TAG
ND5H130801489718184ATGTAA
CytbH149021604411433ATGTAA
tRNA-ThrH1604816116690 TGT
tRNA-ProL1611716186706 TGG
ND6L16193167145222ATGTAA
tRNA-GluL167171678468 TTC
*: Overlap (−).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pham, L.D.; Giang, T.T.N.; Nguyen, V.B.; Pham, T.P.M.; Tran, T.T.T.; Nguyen, T.Q.C.; Van Nguyen, K.; Do, D.N. The Complete Mitochondrial Genome and Phylogenetic Analyses of To Chicken in Vietnam. Genes 2023, 14, 1088. https://doi.org/10.3390/genes14051088

AMA Style

Pham LD, Giang TTN, Nguyen VB, Pham TPM, Tran TTT, Nguyen TQC, Van Nguyen K, Do DN. The Complete Mitochondrial Genome and Phylogenetic Analyses of To Chicken in Vietnam. Genes. 2023; 14(5):1088. https://doi.org/10.3390/genes14051088

Chicago/Turabian Style

Pham, Lan Doan, Thi Thanh Nhan Giang, Van Ba Nguyen, Thi Phuong Mai Pham, Thi Thu Thuy Tran, Thi Quynh Chau Nguyen, Khanh Van Nguyen, and Duy Ngoc Do. 2023. "The Complete Mitochondrial Genome and Phylogenetic Analyses of To Chicken in Vietnam" Genes 14, no. 5: 1088. https://doi.org/10.3390/genes14051088

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop