Molecular Cloning of Toll-like Receptor 2 and 4 (SpTLR2, 4) and Expression of TLR-Related Genes from Schizothorax prenanti after Poly (I:C) Stimulation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Treatments
2.2. RNA Extraction and cDNA Synthesis
2.3. CDS Cloning of SpTLR2 and SpTLR4
2.4. Sequence Analysis
2.5. Tissue Distribution of SpTLR2 and SpTLR4 mRNA
2.6. Statistical Analysis
3. Results
3.1. Identification and Structural and Phylogenetic Analysis of SpTLR2 and SpTLR4
3.2. Tissue Distribution of SpTLR2 and SpTLR4 Expression
3.3. Expression of TLR-Related Genes Following Poly (I:C) Challenge
3.3.1. Expression of SpTLR2
3.3.2. Expression of SpTLR3
3.3.3. Expression of SpTLR4
3.3.4. Expression of SpTLR22s
3.3.5. Expression of SpTLR18
3.3.6. Expression of SpMyD88
3.3.7. Expression of SpIRF3
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Alcorn, S.W.; Murra, A.L.; Pascho, R.J. Effects of rearing temperature on immune functions in sockeye salmon (Oncorhynchus nerka). Fish Shellfish Immunol. 2002, 12, 303–334. [Google Scholar] [CrossRef]
- Takeuchi, O.; Akira, S. Pattern recognition receptors and inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ishii, K.J.; Koyama, S.; Nakagawa, A.; Coban, C.; Akira, S. Host innate immune receptors and beyond: Making sense of microbial infections. Cell Host Microbe 2008, 3, 352–363. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen recognition and innate immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef] [Green Version]
- Anderson, K.V.; Jürgens, G.; Nüsslein-Volhard, C. Establishment of dorsal-ventral polarity in the Drosophila embryo: Genetic studies on the role of the Toll gene product. Cell 1985, 42, 779–789. [Google Scholar] [CrossRef]
- Rebl, A.; Goldammer, T.; Seyfert, H.M. Toll-like receptor signaling in bony fish. Vet. Immunol. Immunopathol. 2010, 134, 139–150. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Kong, X.; Zhou, C.; Li, L.; Nie, G.; Li, X. Toll-like receptor recognition of bacteria in fish: Ligand specificity and signal pathways. Fish Shellfish Immunol. 2014, 41, 380–388. [Google Scholar] [CrossRef]
- Aoki, T.; Hikima, J.; Hwang, S.D.; Jung, T.S. Innate immunity of finfish: Primordial conservation and function of viral RNA sensors in teleosts. Fish Shellfish Immunol. 2013, 35, 1689–1702. [Google Scholar] [CrossRef] [PubMed]
- Hansen, J.D.; Vojtech, L.N.; Laing, K.J. Sensing disease and danger: A survey of vertebrate PRRs and their origins. Dev. Comp. Immunol. 2011, 35, 886–897. [Google Scholar] [CrossRef]
- Takano, T.; Hwang, S.D.; Kondo, H.; Hirono, I.; Aoki, T.; Sano, M. Evidence of molecular toll-like receptor mechanisms in teleosts. Fish Pathol. 2010, 45, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Li, J.; Han, J.; Shu, C.; Xu, T. Identification and characteristic analysis of TLR28: A novel member of the TLR1 family in teleost. Dev. Comp. Immunol. 2016, 62, 102–107. [Google Scholar] [CrossRef]
- Bhoj, V.G.; Chen, Z.J. Ubiquitylation in innate and adaptive immunity. Nature 2009, 458, 430–437. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.C.; Lo, Y.C.; Wu, H. Helical assembly in the MyD88-IRAK4-IRAK2 complex in TLR/IL-1R signalling. Nature 2010, 465, 885–890. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, C.; Deng, L.; Hong, M.; Akkaraju, G.R.; Inoue, J.; Chen, Z.J. TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 2001, 412, 346–351. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Akira, S. The role of pattern-recognition receptors in innate immunity: Update on toll-like receptors. Nat. Immunol. 2010, 11, 373–384. [Google Scholar] [CrossRef]
- Stein, C.; Caccamo, M.; Laird, G.; Leptin, M. Conservation and divergence of gene families encoding components of innate immune response systems in zebrafish. Genome Biol. 2007, 8, R251. [Google Scholar] [CrossRef] [Green Version]
- Jiang, X.; Chen, Z.J. The role of ubiquitylation in immune defence and pathogen evasion. Nat. Rev. Immunol. 2011, 12, 35–48. [Google Scholar] [CrossRef] [Green Version]
- Du, X.; Li, D.; Li, Y.; Wu, J.; Huang, A.; Bu, G.; Meng, F.; Kong, F.; Cao, X.; Han, X.; et al. Clone, identification and functional character of two toll-like receptor 5 molecules in Schizothorax prenanti. Fish Shellfish Immunol. 2019, 95, 81–92. [Google Scholar] [CrossRef]
- Rock, F.L.; Hardiman, G.; Timans, J.C.; Kastelein, R.A.; Bazan, J.F. A family of human receptors structurally related to Drosophila Toll. Proc. Natl. Acad. Sci. USA 1998, 95, 588–593. [Google Scholar] [CrossRef]
- Sullivan, C.; Charette, J.; Catchen, J.; Lage, C.R.; Giasson, G.; Postlethwait, J.H.; Millard, P.J.; Kim, C.H. The gene history of zebrafish tlr4a and tlr4b is predictive of their divergent functions. J. Immunol. 2009, 183, 5896–5908. [Google Scholar] [CrossRef] [Green Version]
- Samanta, M.; Basu, M.; Swain, B.; Paichha, M.; Lenka, S.S.; Das, S.; Jayasankar, P.; Maiti, N.K. Molecular cloning and characterization of LrTLR4, analysis of its inductive expression and associated down-stream signaling molecules following lipopolysaccharide stimulation and Gram-negative bacterial infection. Fish Shellfish Immunol. 2017, 60, 164–176. [Google Scholar] [CrossRef] [PubMed]
- Su, J.; Yang, C.; Xiong, F.; Wang, Y.; Zhu, Z. Toll-like receptor 4 signaling pathway can be triggered by grass carp reovirus and Aeromonas hydrophila infection in rare minnow Gobiocypris rarus. Fish Shellfish Immunol. 2009, 27, 33–39. [Google Scholar] [CrossRef] [PubMed]
- Kongchum, P.; Palti, Y.; Hallerman, E.M.; Hulata, G.; David, L. SNP discovery and development of genetic markers for mapping innate immune response genes in common carp (Cyprinus carpio). Fish Shellfish Immunol. 2010, 29, 356–361. [Google Scholar] [CrossRef] [PubMed]
- Huang, R.; Dong, F.; Jang, S.; Liao, L.; Zhu, Z.; Wang, Y. Isolation and analysis of a novel grass carp toll-like receptor 4 (tlr4) gene cluster involved in the response to grass carp reovirus. Dev. Comp. Immunol. 2012, 38, 383–388. [Google Scholar] [CrossRef] [PubMed]
- Tong, C.; Lin, Y.; Zhang, C.; Shi, J.; Qi, H.; Zhao, K. Transcriptome-wide identification, molecular evolution and expression analysis of toll-like receptor family in a Tibet fish, Gymnocypris przewalskii. Fish Shellfish Immunol. 2015, 46, 334–345. [Google Scholar] [CrossRef]
- Quiniou, S.M.A.; Boudinot, P.; Bengtén, E. Comprehensive survey and genomic characterization of toll-like receptors (TLRs) in channel catfish, Ictalurus punctatus: Identification of novel fish TLRs. Immunogenetics 2013, 65, 511–530. [Google Scholar] [CrossRef]
- Lai, R.; Liu, H.; Jakovlić, I.; Zhan, F.; Wei, J.; Yang, P.; Wang, W. Molecular cloning and expression of toll-like receptor 4 (tlr4) in the blunt snout bream (Megalobrama amblycephala). Dev. Comp. Immunol. 2016, 59, 63–76. [Google Scholar] [CrossRef]
- Palti, Y. Toll-like receptors in bony fish: From genomics to function. Dev. Comp. Immunol. 2011, 35, 1263–1272. [Google Scholar] [CrossRef]
- Sepulcre, M.P.; Alcaraz-Pérez, F.; López-Muñoz, A.; Roca, F.J.; Meseguer, J.; Cayuela, M.L.; Mulero, V. Evolution of lipopolysaccharide (LPS) recognition and signaling: Fish TLR4 does not recognize LPS and negatively regulates NF-kappaB activation. J. Immunol. 2009, 182, 1836–1845. [Google Scholar] [CrossRef] [Green Version]
- Oshiumi, H.; Tsujita, T.; Shida, K.; Matsumoto, M.; Ikeo, K.; Seya, T. Prediction of the prototype of the human toll-like receptor gene family from the pufferfish, Fugu rubripes, genome. Immunogenetics 2003, 54, 791–800. [Google Scholar] [CrossRef]
- Zhang, J.; Huang, J.; Fang, C.; Li, W.; Zhao, H.; Kong, F.; Zhang, H.; Zhang, H.; Wang, Q. Molecular cloning of heat shock protein 60 (SpHSP60) from Schizothorax prenanti and the gene expressions of four SpHSPs during lipopolysaccharide (LPS) infection. Fishes 2022, 7, 139. [Google Scholar] [CrossRef]
- Pu, Y.; Zhu, J.; Wang, H.; Zhang, X.; Hao, J.; Wu, Y.; Geng, Y.; Wang, K.; Li, Z.; Zhou, J.; et al. Molecular characterization and expression analysis of Hsp90 in Schizothorax prenanti. Cell Stress Chaperones 2016, 21, 983–991. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ye, H.; Xiao, S.; Wang, X.; Wang, Z.; Zhang, Z.; Zhu, C.; Hu, B.; Lv, C.; Zheng, S.; Luo, H. Characterization of spleen transcriptome of Schizothorax prenanti during Aeromonas hydrophila infection. Mar. Biotechnol. 2018, 20, 246–256. [Google Scholar] [CrossRef] [PubMed]
- Geng, Y.; Wang, K.Y.; Huang, X.L.; Chen, D.F.; Li, C.W.; Ren, S.Y.; Liao, Y.T.; Zhou, Z.Y.; Liu, Q.F.; Du, Z.J.; et al. Streptococcus agalactiae, an emerging pathogen for cultured ya-fish, Schizothorax prenanti, in China. Transbound. Emerg. Dis. 2012, 59, 369–375. [Google Scholar] [CrossRef]
- Palacios, G.; Lovoll, M.; Tengs, T.; Hornig, M.; Hutchison, S.; Hui, J.; Kongtorp, R.T.; Savji, N.; Bussetti, A.V.; Solovyov, A.; et al. Heart and skeletal muscle inflammation of farmed salmon is associated with infection with a novel reovirus. PLoS ONE 2010, 5, e11487. [Google Scholar] [CrossRef]
- Avunje, S.; Jung, S.J. Poly (I:C) and imiquimod induced immune responses and their effects on the survival of olive flounder (Paralichthys olivaceus) from viral haemorrhagic septicaemia. Fish Shellfish Immunol. 2017, 71, 338–345. [Google Scholar] [CrossRef]
- Schaefer, T.M.; Fahey, J.V.; Wright, J.A.; Wira, C.R. Innate immunity in the human female reproductive tract: Antiviral response of uterine epithelial cells to the TLR3 agonist poly(I:C). J. Immunol. 2005, 174, 992–1002. [Google Scholar] [CrossRef] [Green Version]
- Thomas, M.; Wang, Z.; Sreenivasan, C.C.; Hause, B.M.; Renukaradhya, G.J.; Li, F.; Francis, D.H.; Kaushik, R.S.; Khatri, M. Poly I:C adjuvanted inactivated swine influenza vaccine induces heterologous protective immunity in pigs. Vaccine 2015, 33, 542–548. [Google Scholar] [CrossRef]
- Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef] [Green Version]
- Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 2007, 24, 1596–1599. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Alvarez-Pellitero, P. Fish immunity and parasite infections: From innate immunity to immunoprophylactic prospects. Vet. Immunol. Immunopathol. 2008, 126, 171–198. [Google Scholar] [CrossRef]
- Hwang, S.D.; Asahi, T.; Kondo, H.; Hirono, I.; Aoki, T. Molecular cloning and expression study on toll-like receptor 5 paralogs in Japanese flounder, Paralichthys olivaceus. Fish Shellfish Immunol. 2010, 29, 630–638. [Google Scholar] [CrossRef]
- Wang, P.; Zhao, C.; Wang, C.; Fan, S.; Yan, L.; Qiu, L. TLR3 gene in Japanese sea perch (Lateolabrax japonicus): Molecular cloning, characterization and expression analysis after bacterial infection. Fish Shellfish Immunol. 2018, 76, 347–354. [Google Scholar] [CrossRef] [PubMed]
- Du, X.; Wu, J.; Li, Y.; Xia, P.; Li, D.; Yang, X.; Yu, G.; Bu, G.; Huang, A.; Meng, F.; et al. Multiple subtypes of TLR22 molecule from Schizothorax prenanti present the functional diversity in ligand recognition and signal activation. Fish Shellfish Immunol. 2019, 93, 986–996. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Zhang, J.; Zhang, K.; Fang, C.; Li, W.; Wang, Q. Cloning of toll-like receptor 3 gene from Schizothorax prenanti (SpTLR3), and expressions of seven SpTLRs and SpMyD88 after lipopolysaccharide induction. Genes 2022, 13, 1862. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wu, J.; Li, D.; Huang, A.; Bu, G.; Meng, F.; Kong, F.; Cao, X.; Han, X.; Pan, X.; et al. Teleost-specific TLR25 identified from Schizothorax prenanti may recognize bacterial/viral components and activate NF-κB and type I IFNs signaling pathways. Fish Shellfish Immunol. 2018, 82, 361–370. [Google Scholar] [CrossRef] [PubMed]
- Harada, H.; Fujita, T.; Miyamoto, M.; Kimura, Y.; Maruyama, M.; Furia, A.; Miyata, T.; Taniguchi, T. Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell 1989, 58, 729–739. [Google Scholar] [CrossRef]
- Taniguchi, T.; Ogasawara, K.; Takaoka, A.; Tanaka, N. IRF family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 2001, 19, 623–655. [Google Scholar] [CrossRef]
- Honda, K.; Yanai, H.; Negishi, H.; Asagiri, M.; Sato, M.; Mizutani, T.; Shimada, N.; Ohba, Y.; Takaoka, A.; Yoshida, N.; et al. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 2005, 434, 772–777. [Google Scholar] [CrossRef]
- Ivashkiv, L.B.; Donlin, L.T. Regulation of type I interferon responses. Nat. Rev. Immunol. 2014, 14, 36–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holland, J.W.; Bird, S.; Williamson, B.; Woudstra, C.; Mustafa, A.; Wang, T.; Zou, J.; Blaney, S.C.; Collet, B.; Secombes, C.J. Molecular characterization of IRF3 and IRF7 in rainbow trout, Oncorhynchus mykiss: Functional analysis and transcriptional modulation. Mol. Immunol. 2008, 46, 269–285. [Google Scholar] [CrossRef]
- Iliev, D.B.; Sobhkhez, M.; Fremmerlid, K.; Jørgensen, J.B. MyD88 interacts with interferon regulatory factor (IRF) 3 and IRF7 in Atlantic salmon (Salmo salar): Transgenic SsMyD88 modulates the IRF-induced type I interferon response and accumulates in aggresomes. J. Biol. Chem. 2011, 286, 42715–42724. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ohtani, M.; Hikima, J.; Hwang, S.D.; Morita, T.; Suzuki, Y.; Kato, G.; Kondo, H.; Hirono, I.; Jung, T.S.; Aoki, T. Transcriptional regulation of type I interferon gene expression by interferon regulatory factor-3 in Japanese flounder, Paralichthys olivaceus. Dev. Comp. Immunol. 2012, 36, 697–706. [Google Scholar] [CrossRef] [PubMed]
- Lin, F.; Zhou, C.; Chen, H.; Wu, H.; Xin, Z.; Liu, J.; Gao, Y.; Yuan, D.; Wang, T.; Wei, R.; et al. Molecular characterization, tissue distribution and feeding related changes of NUCB2A/nesfatin-1 in Ya-fish (Schizothorax prenanti). Gene 2014, 536, 238–246. [Google Scholar] [CrossRef]
- Takano, T.; Kondo, H.; Hirono, I.; Saito-Taki, T.; Endo, M.; Aoki, T. Identification and characterization of a myeloid differentiation factor 88 (MyD88) cDNA and gene in Japanese flounder, Paralichthys olivaceus. Dev. Comp. Immunol. 2006, 30, 807–816. [Google Scholar] [CrossRef]
- Zhang, S.; Li, C.Z.; Yan, H.; Qiu, W.; Chen, Y.G.; Wang, P.H.; Weng, S.P.; He, J.G. Identification and function of myeloid differentiation factor 88 (MyD88) in Litopenaeus vannamei. PLoS ONE 2012, 7, e47038. [Google Scholar] [CrossRef]
- Skjaeveland, I.; Iliev, D.B.; Strandskog, G.; Jørgensen, J.B. Identification and characterization of TLR8 and MyD88 homologs in Atlantic salmon (Salmo salar). Dev. Comp. Immunol. 2009, 33, 1011–1017. [Google Scholar] [CrossRef]
- Takeda, K.; Akira, S. Toll-like receptors in innate immunity. Int. Immunol. 2005, 17, 135–145. [Google Scholar] [CrossRef] [Green Version]
- Wei, Y.C.; Pan, T.S.; Chang, M.X.; Huang, B.; Xu, Z.; Luo, T.R.; Nie, P. Cloning and expression of toll-like receptors 1 and 2 from a teleost fish, the orange-spotted grouper Epinephelus coioides. Vet. Immunol. Immunopathol. 2011, 141, 173–182. [Google Scholar] [CrossRef]
- Novoa, B.; Romero, A.; Mulero, V.; Rodríguez, I.; Fernández, I.; Figueras, A. Zebrafish (Danio rerio) as a model for the study of vaccination against viral haemorrhagic septicemia virus (VHSV). Vaccine 2006, 24, 5806–5816. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, M.F.; Wiens, G.D.; Purcell, M.K.; Palti, Y. Characterization of toll-like receptor 3 gene in rainbow trout (Oncorhynchus mykiss). Immunogenetics 2005, 57, 510–519. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.N.; Wang, Z.Y.; Yao, C.L. Characterization of toll-like receptor 3 gene in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol. 2011, 31, 98–106. [Google Scholar] [CrossRef]
- Su, J.; Zhu, Z.; Wang, Y.; Zou, J.; Hu, W. Toll-like receptor 3 regulates Mx expression in rare minnow Gobiocypris rarus after viral infection. Immunogenetics 2008, 60, 195–205. [Google Scholar] [CrossRef] [PubMed]
- Stafford, J.L.; Ellestad, K.K.; Magor, K.E.; Belosevic, M.; Magor, B.G. A toll-like receptor (TLR) gene is up-regulated in activated goldfish macrophages. Dev. Comp. Immunol. 2003, 27, 685–698. [Google Scholar] [CrossRef]
- Hirono, I.; Takami, M.; Miyata, M.; Miyazaki, T.; Han, H.J.; Takano, T.; Endo, M.; Aoki, T. Characterization of gene structure and expression of two toll-like receptors from Japanese flounder, Paralichthys olivaceus. Immunogenetics 2004, 56, 38–46. [Google Scholar] [CrossRef] [PubMed]
- Salazar, C.; Haussmann, D.; Kausel, G.; Figueroa, J. Molecular cloning of Salmo salar toll-like receptors (TLR1, TLR22, TLR5M and TLR5S) and expression analysis in SHK-1 cells during Piscirickettsia salmonis infection. J. Fish. Dis. 2016, 39, 239–248. [Google Scholar] [CrossRef]
- Matsuo, A.; Oshiumi, H.; Tsujita, T.; Mitani, H.; Kasai, H.; Yoshimizu, M.; Matsumoto, M.; Seya, T. Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from birnaviruses. J. Immunol. 2008, 181, 3474–3485. [Google Scholar] [CrossRef] [Green Version]
- Xiao, X.; Qin, Q.; Chen, X. Molecular characterization of a Toll-like receptor 22 homologue in large yellow croaker (Pseudosciaena crocea) and promoter activity analysis of its 5′-flanking sequence. Fish Shellfish Immunol. 2011, 30, 224–233. [Google Scholar] [CrossRef]
- Lv, J.; Huang, R.; Li, H.; Luo, D.; Liao, L.; Zhu, Z.; Wang, Y. Cloning and characterization of the grass carp (Ctenopharyngodon idella) Toll-like receptor 22 gene, a fish-specific gene. Fish Shellfish Immunol. 2012, 32, 1022–1031. [Google Scholar] [CrossRef]
- Ding, X.; Lu, D.Q.; Hou, Q.H.; Li, S.S.; Liu, X.C.; Zhang, Y.; Lin, H.R. Orange-spotted grouper (Epinephelus coioides) toll-like receptor 22: Molecular characterization, expression pattern and pertinent signaling pathways. Fish Shellfish Immunol. 2012, 33, 494–503. [Google Scholar] [CrossRef] [PubMed]
- Sundaram, A.Y.M.; Kiron, V.; Dopazo, J.; Fernandes, J.M.O. Diversification of the expanded teleost-specific toll-like receptor family in Atlantic cod, Gadus morhua. BMC Evol. Biol. 2012, 12, 256. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Samanta, M.; Swain, B.; Basu, M.; Mahapatra, G.; Sahoo, B.R.; Paichha, M.; Lenka, S.S.; Jayasankar, P. Toll-like receptor 22 in Labeo rohita: Molecular cloning, characterization, 3D modeling, and expression analysis following ligands stimulation and bacterial infection. Appl. Biochem. Biotechnol. 2014, 174, 309–327. [Google Scholar] [CrossRef] [PubMed]
- Panda, R.P.; Chakrapani, V.; Patra, S.K.; Saha, J.N.; Jayasankar, P.; Kar, B.; Sahoo, P.K.; Barman, H.K. First evidence of comparative responses of Toll-like receptor 22 (TLR22) to relatively resistant and susceptible Indian farmed carps to Argulus siamensis infection. Dev. Comp. Immunol. 2014, 47, 25–35. [Google Scholar] [CrossRef]
- Muñoz, I.; Sepulcre, M.P.; Meseguer, J.; Mulero, V. Toll-like receptor 22 of gilthead seabream, Sparus aurata: Molecular cloning, expression profiles and post-transcriptional regulation. Dev. Comp. Immunol. 2014, 44, 173–179. [Google Scholar] [CrossRef]
- Hu, G.B.; Zhang, S.F.; Yang, X.; Liu, D.H.; Liu, Q.M.; Zhang, S.C. Cloning and expression analysis of a Toll-like receptor 22 (tlr22) gene from turbot, Scophthalmus maximus. Fish Shellfish Immunol. 2015, 44, 399–409. [Google Scholar] [CrossRef]
- Reyes-Becerril, M.; Ascencio-Valle, F.; Alamillo, E.; Hirono, I.; Kondo, H.; Jirapongpairoj, W.; Angulo, C. Molecular cloning and comparative responses of Toll-like receptor 22 following ligands stimulation and parasitic infection in yellowtail (Seriola lalandi). Fish Shellfish Immunol. 2015, 46, 323–333. [Google Scholar] [CrossRef]
- Li, H.; Yang, G.; Ma, F.; Li, T.; Yang, H.; Rombout, J.H.; An, L. Molecular characterization of a fish-specific Toll-like receptor 22 (TLR22) gene from common carp (Cyprinus carpio L.): Evolutionary relationship and induced expression upon immune stimulants. Fish Shellfish Immunol. 2017, 63, 74–86. [Google Scholar] [CrossRef]
- Ding, X.; Liang, Y.; Peng, W.; Li, R.; Lin, H.; Zhang, Y.; Lu, D. Intracellular TLR22 acts as an inflammation equalizer via suppression of NF-κB and selective activation of MAPK pathway in fish. Fish Shellfish Immunol. 2018, 72, 646–657. [Google Scholar] [CrossRef]
- Meijer, A.H.; Gabby Krens, S.F.; Medina Rodriguez, I.A.; He, S.; Bitter, W.; Ewa Snaar-Jagalska, B.; Spaink, H.P. Expression analysis of the toll-like receptor and TIR domain adaptor families of zebrafish. Mol. Immunol. 2004, 40, 773–783. [Google Scholar] [CrossRef]
Primers | Sequences (5′–3′) | Annealing Temperature (°C) | Size (bp) |
---|---|---|---|
Primers for CDS cloning | |||
TLR2-F | TTAATGGCAGTCAGGATGAG | 50 | 2447 |
TLR2-R | ACATTGCGTTTAGGTACTTGG | ||
TLR2 walking 1 | CCATGCGATCGAACAGGTCT | For sequencing | |
TLR2 walking 2 | AATTGGTGCGCGCCTATTTC | ||
TLR4-F TLR4-R | ATGACCTCAAACAAGGCTGGC | 50 | 2634 |
AATGTAAAACCATACTGCCAT | |||
TLR4 walking | GATGCTGACGATGTTCCGGA | For sequencing | |
Primers for qRT-PCR | |||
TLR2-F | GATCAACGGCACAGTGTTTG | 62 | 170 |
TLR2-R | CAGGTCTGAAAGGAGGTTCTG | ||
TLR3-F | GCTGAAAGGAGATGAGTTAGAG | 62 | 110 |
TLR3-R | ACGTAGGGACATGGATGAA | ||
TLR4-F | CTTGGTGTCGCTTTGAGTTTG | 62 | 107 |
TLR4-R | GTCTCTGCTCCACTTTAGGTATG | ||
TLR18-F | ACAGACTAAATGGCCAGGGAAG | 62 | 118 |
TLR18-R | AACCACAAGCAAGGGCAAAG | ||
TLR22-1-F | CCTCTTCTTAGCCTTCCTTTAC | 62 | 94 |
TLR22-1-R | CTCGTCTTTGGTGTTGTAGG | ||
TLR22-2-F | TTCCAGGGACTGTGGTATTTG | 62 | 98 |
TLR22-2-R | GCCCACAGATAAGGAGTGTAAG | ||
TLR22-3-F | CCATCGGCATTCTTTGGTTT | 62 | 169 |
TLR22-3-R | CTGTGTTCAGGAATGCCTTG | ||
IRF3-F | CCAAACCACACCATCCAATCT | 62 | 109 |
IRF3-R | ACTACCTGTTCCTGACGGTATC | ||
MyD88-F | GAGTTTCCCACTCCGTTAAGA | 62 | 92 |
MyD88-R | CGCCGAGATGATGGACTTTA | ||
β-actin-F | GACCACCTTCAACTCCATCAT | 62 | 126 |
β-actin -R | GTGATCTCCTTCTGCATCCTATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, J.; Huang, J.; Zhao, H. Molecular Cloning of Toll-like Receptor 2 and 4 (SpTLR2, 4) and Expression of TLR-Related Genes from Schizothorax prenanti after Poly (I:C) Stimulation. Genes 2023, 14, 1388. https://doi.org/10.3390/genes14071388
Zhang J, Huang J, Zhao H. Molecular Cloning of Toll-like Receptor 2 and 4 (SpTLR2, 4) and Expression of TLR-Related Genes from Schizothorax prenanti after Poly (I:C) Stimulation. Genes. 2023; 14(7):1388. https://doi.org/10.3390/genes14071388
Chicago/Turabian StyleZhang, Jianlu, Jiqin Huang, and Haitao Zhao. 2023. "Molecular Cloning of Toll-like Receptor 2 and 4 (SpTLR2, 4) and Expression of TLR-Related Genes from Schizothorax prenanti after Poly (I:C) Stimulation" Genes 14, no. 7: 1388. https://doi.org/10.3390/genes14071388