TRIM25 Suppresses Rabies Virus Fixed HEP-Flury Strain Production by Activating RIG-1-Mediated Type I Interferons
Abstract
:1. Introduction
2. Results
2.1. The Infection with HEP-Flury Leads to Increased Expression of TRIM25 in N2a Cells
2.2. Trim25 Negatively Regulates HEP-Flury Replication
2.3. TRIM25 Suppresses HEP-Flury Reproduction by Promoting Type I Interferon Expression
2.4. TRIM25 Regulates the Expression of IFN through RIG-I after HEP-Flury Infection
2.5. HEP-Flury Does Not Directly Interact with TRIM25
3. Discussion
4. Materials and Methods
4.1. Viruses and Cells
4.2. Antibodies, Plasmidsand siRNAs
4.3. HEP-Flury Titration
4.4. Immunofluorescence Staining
4.5. siRNA and Plasmid DNA Transfection
4.6. Co-Immunoprecipitation
4.7. Western Blotting
4.8. Quantitative Real-Time PCR Analysis
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hampson, K.; Coudeville, L.; Lembo, T.; Sambo, M.; Kieffer, A.; Attlan, M.; Barrat, J.; Blanton, J.D.; Briggs, D.J.; Cleaveland, S.; et al. Estimating the global burden of endemic canine rabies. PLoS Negl. Trop. Dis. 2015, 9, e3709. [Google Scholar] [CrossRef] [Green Version]
- Finke, S.; Conzelmann, K.K. Replication strategies of rabies virus. Virus Res. 2005, 111, 120–131. [Google Scholar] [CrossRef] [PubMed]
- Leroy, M.; Pire, G.; Baise, E.; Desmecht, D. Expression of the interferon-alpha/beta-inducible bovine Mx1 dynamin interferes with replication of rabies virus. Neurobiol. Dis. 2006, 21, 515–521. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Wan, M.; Cai, L.; Hou, A.; Sun, B.; Zhou, Y.; Gao, F.; Su, W.; Jiang, C. Interferon Inhibition Enhances the Pilot-Scale Production of Rabies Virus in Human Diploid MRC-5 Cells. Viruses 2021, 14, 49. [Google Scholar] [CrossRef]
- Mendonca, R.Z.; Pereira, C.A. Relationship of interferon synthesis and the resistance of mice infected with street rabies virus. Braz. J. Med. Biol. Res. 1994, 27, 691–695. [Google Scholar]
- Chopy, D.; Detje, C.N.; Lafage, M.; Kalinke, U.; Lafon, M. The type I interferon response bridles rabies virus infection and reduces pathogenicity. J. Neurovirol. 2011, 17, 353–367. [Google Scholar] [CrossRef]
- Wang, Z.W.; Sarmento, L.; Wang, Y.; Li, X.Q.; Dhingra, V.; Tseggai, T.; Jiang, B.; Fu, Z.F. Attenuated rabies virus activates, while pathogenic rabies virus evades, the host innate immune responses in the central nervous system. J. Virol. 2005, 79, 12554–12565. [Google Scholar] [CrossRef] [Green Version]
- Brzozka, K.; Finke, S.; Conzelmann, K.K. Identification of the rabies virus alpha/beta interferon antagonist: Phosphoprotein P interferes with phosphorylation of interferon regulatory factor 3. J. Virol. 2005, 79, 7673–7681. [Google Scholar] [CrossRef] [Green Version]
- Sonthonnax, F.; Besson, B.; Bonnaud, E.; Jouvion, G.; Merino, D.; Larrous, F.; Bourhy, H. Lyssavirus matrix protein cooperates with phosphoprotein to modulate the Jak-Stat pathway. Sci. Rep. 2019, 9, 12171. [Google Scholar] [CrossRef] [Green Version]
- Masatani, T.; Ito, N.; Shimizu, K.; Ito, Y.; Nakagawa, K.; Sawaki, Y.; Koyama, H.; Sugiyama, M. Rabies virus nucleoprotein functions to evade activation of the RIG-I-mediated antiviral response. J. Virol. 2010, 84, 4002–4012. [Google Scholar] [CrossRef] [Green Version]
- Luo, J.; Zhang, B.; Wu, Y.; Guo, X. Amino Acid Mutation in Position 349 of Glycoprotein affect the Pathogenicity of Rabies Virus. Front. Microbiol. 2020, 11, 481. [Google Scholar] [CrossRef]
- Tian, D.; Luo, Z.; Zhou, M.; Li, M.; Yu, L.; Wang, C.; Yuan, J.; Li, F.; Tian, B.; Sui, B.; et al. Critical Role of K1685 and K1829 in the Large Protein of Rabies Virus in Viral Pathogenicity and Immune Evasion. J. Virol. 2016, 90, 232–244. [Google Scholar] [CrossRef] [Green Version]
- Mifune, K.; Mannen, K.; Cho, S.; Narahara, H. Enhanced antibody responses in mice by combined administration of interferon with rabies vaccine. Arch. Virol. 1987, 94, 287–295. [Google Scholar] [CrossRef] [PubMed]
- Faul, E.J.; Wanjalla, C.N.; McGettigan, J.P.; Schnell, M.J. Interferon-beta expressed by a rabies virus-based HIV-1 vaccine vector serves as a molecular adjuvant and decreases pathogenicity. Virology 2008, 382, 226–238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Tian, Q.; Xu, X.; Yang, X.; Luo, J.; Mo, W.; Peng, J.; Niu, X.; Luo, Y.; Guo, X. Recombinant rabies virus expressing IFNalpha1 enhanced immune responses resulting in its attenuation and stronger immunogenicity. Virology 2014, 468–470, 621–630. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tian, B.; Zhou, M.; Yang, Y.; Yu, L.; Luo, Z.; Tian, D.; Wang, K.; Cui, M.; Chen, H.; Fu, Z.F.; et al. Lab-Attenuated Rabies Virus Causes Abortive Infection and Induces Cytokine Expression in Astrocytes by Activating Mitochondrial Antiviral-Signaling Protein Signaling Pathway. Front. Immunol. 2017, 8, 2011. [Google Scholar] [CrossRef]
- Luo, Z.; Li, Y.; Zhou, M.; Lv, L.; Wu, Q.; Chen, C.; Zhang, Y.; Sui, B.; Tu, C.; Cui, M.; et al. Toll-Like Receptor 7 Enhances Rabies Virus-Induced Humoral Immunity by Facilitating the Formation of Germinal Centers. Front. Immunol. 2019, 10, 429. [Google Scholar] [CrossRef]
- Vunjak, M.; Versteeg, G.A. TRIM proteins. Curr. Biol. 2019, 29, R42–R44. [Google Scholar] [CrossRef] [Green Version]
- Zheng, N.; Shabek, N. Ubiquitin Ligases: Structure, Function, and Regulation. Annu. Rev. Biochem. 2017, 86, 129–157. [Google Scholar] [CrossRef]
- van Tol, S.; Hage, A.; Giraldo, M.I.; Bharaj, P.; Rajsbaum, R. The TRIMendous Role of TRIMs in Virus-Host Interactions. Vaccines 2017, 5, 23. [Google Scholar] [CrossRef] [Green Version]
- Koepke, L.; Gack, M.U.; Sparrer, K.M. The antiviral activities of TRIM proteins. Curr. Opin. Microbiol. 2021, 59, 50–57. [Google Scholar] [CrossRef]
- Martin-Vicente, M.; Medrano, L.M.; Resino, S.; Garcia-Sastre, A.; Martinez, I. TRIM25 in the Regulation of the Antiviral Innate Immunity. Front. Immunol. 2017, 8, 1187. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, M.; Fu, M.; Li, M.; Hu, H.; Gong, S.; Hu, Q. Herpes Simplex Virus Type 2 Inhibits Type I IFN Signaling Mediated by the Novel E3 Ubiquitin Protein Ligase Activity of Viral Protein ICP22. J. Immunol. 2020, 205, 1281–1292. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Zheng, H.; Yu, S.; Ding, Y.; Wu, W.; Mao, X.; Liao, Y.; Meng, C.; Ur, R.Z.; Tan, L.; et al. Newcastle Disease Virus V Protein Degrades Mitochondrial Antiviral Signaling Protein To Inhibit Host Type I Interferon Production via E3 Ubiquitin Ligase RNF5. J. Virol. 2019, 93, e00322-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- van Gent, M.; Sparrer, K.; Gack, M.U. TRIM Proteins and Their Roles in Antiviral Host Defenses. Annu. Rev. Virol. 2018, 5, 385–405. [Google Scholar] [CrossRef]
- Narayan, K.; Waggoner, L.; Pham, S.T.; Hendricks, G.L.; Waggoner, S.N.; Conlon, J.; Wang, J.P.; Fitzgerald, K.A.; Kang, J. TRIM13 is a negative regulator of MDA5-mediated type I interferon production. J. Virol. 2014, 88, 10748–10757. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yan, J.; Li, Q.; Mao, A.P.; Hu, M.M.; Shu, H.B. TRIM4 modulates type I interferon induction and cellular antiviral response by targeting RIG-I for K63-linked ubiquitination. J. Mol. Cell Biol. 2014, 6, 154–163. [Google Scholar] [CrossRef] [Green Version]
- Yang, K.; Shi, H.X.; Liu, X.Y.; Shan, Y.F.; Wei, B.; Chen, S.; Wang, C. TRIM21 is essential to sustain IFN regulatory factor 3 activation during antiviral response. J. Immunol. 2009, 182, 3782–3792. [Google Scholar] [CrossRef] [Green Version]
- Higgs, R.; Ni, G.J.; Ben, L.N.; Breen, E.P.; Fitzgerald, K.A.; Jefferies, C.A. The E3 ubiquitin ligase Ro52 negatively regulates IFN-beta production post-pathogen recognition by polyubiquitin-mediated degradation of IRF3. J. Immunol. 2008, 181, 1780–1786. [Google Scholar] [CrossRef] [Green Version]
- Zhou, J.R.; Liu, J.H.; Li, H.M.; Zhao, Y.; Cheng, Z.; Hou, Y.M.; Guo, H.J. Regulatory effects of chicken TRIM25 on the replication of ALV-A and the MDA5-mediated type I interferon response. Vet. Res. 2020, 51, 145. [Google Scholar] [CrossRef]
- Jin, Y.; Jia, K.; Zhang, W.; Xiang, Y.; Jia, P.; Liu, W.; Yi, M. Zebrafish TRIM25 Promotes Innate Immune Response to RGNNV Infection by Targeting 2CARD and RD Regions of RIG-I for K63-Linked Ubiquitination. Front. Immunol. 2019, 10, 2805. [Google Scholar] [CrossRef] [Green Version]
- Wang, S.; Yu, M.; Liu, A.; Bao, Y.; Qi, X.; Gao, L.; Chen, Y.; Liu, P.; Wang, Y.; Xing, L.; et al. TRIM25 inhibits infectious bursal disease virus replication by targeting VP3 for ubiquitination and degradation. PLoS Pathog. 2021, 17, e1009900. [Google Scholar] [CrossRef]
- Giraldo, M.I.; Hage, A.; van Tol, S.; Rajsbaum, R. TRIM Proteins in Host Defense and Viral Pathogenesis. Curr. Clin. Microbiol. Rep. 2020, 7, 101–114. [Google Scholar] [CrossRef] [PubMed]
- Meyerson, N.R.; Zhou, L.; Guo, Y.R.; Zhao, C.; Tao, Y.J.; Krug, R.M.; Sawyer, S.L. Nuclear TRIM25 Specifically Targets Influenza Virus Ribonucleoproteins to Block the Onset of RNA Chain Elongation. Cell Host Microbe 2017, 22, 627–638. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sanchez, J.G.; Sparrer, K.; Chiang, C.; Reis, R.A.; Chiang, J.J.; Zurenski, M.A.; Wan, Y.; Gack, M.U.; Pornillos, O. TRIM25 Binds RNA to Modulate Cellular Anti-viral Defense. J. Mol. Biol. 2018, 430, 5280–5293. [Google Scholar] [CrossRef] [PubMed]
- Li, M.M.; Lau, Z.; Cheung, P.; Aguilar, E.G.; Schneider, W.M.; Bozzacco, L.; Molina, H.; Buehler, E.; Takaoka, A.; Rice, C.M.; et al. TRIM25 Enhances the Antiviral Action of Zinc-Finger Antiviral Protein (ZAP). PLoS Pathog. 2017, 13, e1006145. [Google Scholar] [CrossRef]
- Woo, H.M.; Lee, J.M.; Kim, C.J.; Lee, J.S.; Jeong, Y.J. Recovery of TRIM25-Mediated RIG-I Ubiquitination through Suppression of NS1 by RNA Aptamers. Mol. Cells 2019, 42, 721–728. [Google Scholar] [CrossRef] [PubMed]
- Gack, M.U.; Shin, Y.C.; Joo, C.H.; Urano, T.; Liang, C.; Sun, L.; Takeuchi, O.; Akira, S.; Chen, Z.; Inoue, S.; et al. TRIM25 RING-finger E3 ubiquitin ligase is essential for RIG-I-mediated antiviral activity. Nature 2007, 446, 916–920. [Google Scholar] [CrossRef]
- Oshiumi, H.; Matsumoto, M.; Hatakeyama, S.; Seya, T. Riplet/RNF135, a RING finger protein, ubiquitinates RIG-I to promote interferon-beta induction during the early phase of viral infection. J. Biol. Chem. 2009, 284, 807–817. [Google Scholar] [CrossRef] [Green Version]
- Hu, Y.; Li, W.; Gao, T.; Cui, Y.; Jin, Y.; Li, P.; Ma, Q.; Liu, X.; Cao, C. The Severe Acute Respiratory Syndrome Coronavirus Nucleocapsid Inhibits Type I Interferon Production by Interfering with TRIM25-Mediated RIG-I Ubiquitination. J. Virol. 2017, 91, e02143-16. [Google Scholar] [CrossRef] [Green Version]
- Ban, J.; Lee, N.R.; Lee, N.J.; Lee, J.K.; Quan, F.S.; Inn, K.S. Human Respiratory Syncytial Virus NS 1 Targets TRIM25 to Suppress RIG-I Ubiquitination and Subsequent RIG-I-Mediated Antiviral Signaling. Viruses 2018, 10, 716. [Google Scholar] [CrossRef] [Green Version]
- Koliopoulos, M.G.; Lethier, M.; van der Veen, A.G.; Haubrich, K.; Hennig, J.; Kowalinski, E.; Stevens, R.V.; Martin, S.R.; Reis, E.S.C.; Cusack, S.; et al. Molecular mechanism of influenza A NS1-mediated TRIM25 recognition and inhibition. Nat. Commun. 2018, 9, 1820. [Google Scholar] [CrossRef] [Green Version]
- Zhao, K.; Li, L.W.; Jiang, Y.F.; Gao, F.; Zhang, Y.J.; Zhao, W.Y.; Li, G.X.; Yu, L.X.; Zhou, Y.J.; Tong, G.Z. Nucleocapsid protein of porcine reproductive and respiratory syndrome virus antagonizes the antiviral activity of TRIM25 by interfering with TRIM25-mediated RIG-I ubiquitination. Vet. Microbiol. 2019, 233, 140–146. [Google Scholar] [CrossRef] [PubMed]
- Wei, Y.; Zeng, S.; Zou, C.; Zhang, H.; Peng, O.; Xue, C.; Cao, Y. Porcine TRIM21 RING-finger E3 ubiquitin ligase is essential for anti-PRRSV activity. Vet. Microbiol. 2021, 256, 109043. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.; Zhao, X.; Sun, D.; Yang, L.; Chong, C.; Pan, Y.; Chi, X.; Gao, Y.; Wang, M.; Shi, X.; et al. Interferon alpha (IFNalpha)-induced TRIM22 interrupts HCV replication by ubiquitinating NS5A. Cell. Mol. Immunol. 2016, 13, 94–102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Di Pietro, A.; Kajaste-Rudnitski, A.; Oteiza, A.; Nicora, L.; Towers, G.J.; Mechti, N.; Vicenzi, E. TRIM22 inhibits influenza A virus infection by targeting the viral nucleoprotein for degradation. J. Virol. 2013, 87, 4523–4533. [Google Scholar] [CrossRef] [Green Version]
- Peng, C.; Zhao, C.; Wang, P.F.; Yan, L.L.; Fan, S.G.; Qiu, L.H. Identification of a TRIM32 from Penaeus monodon is involved in autophagy and innate immunity during white spot syndrome virus infection. Dev. Comp. Immunol. 2021, 123, 104169. [Google Scholar] [CrossRef]
- Li, L.; Feng, W.; Cheng, Z.; Yang, J.; Bi, J.; Wang, X.; Wang, G. TRIM62-mediated restriction of avian leukosis virus subgroup J replication is dependent on the SPRY domain. Poult. Sci. 2019, 98, 6019–6025. [Google Scholar] [CrossRef]
- Michael, J.L.; Michael, B.Y. Protein Regulation in Signal Transduction. Cold Spring Harb. Perspect. Biol. 2016, 8, a005918. [Google Scholar] [CrossRef] [Green Version]
- Lee, N.R.; Kim, H.I.; Choi, M.S.; Yi, C.M.; Inn, K.S. Regulation of MDA5-MAVS Antiviral Signaling Axis by TRIM25 through TRAF6-Mediated NF-kappaB Activation. Mol. Cells 2015, 38, 759–764. [Google Scholar] [CrossRef] [Green Version]
- Yuan, T.; Yao, W.; Tokunaga, K.; Yang, R.; Sun, B. An HIV-1 capsid binding protein TRIM11 accelerates viral uncoating. Retrovirology 2016, 13, 72. [Google Scholar] [CrossRef] [Green Version]
- Mu, T.; Zhao, X.; Zhu, Y.; Fan, H.; Tang, H. The E3 Ubiquitin Ligase TRIM21 Promotes HBV DNA Polymerase Degradation. Viruses 2020, 12, 346. [Google Scholar] [CrossRef] [Green Version]
- Wu, X.; Wang, J.; Wang, S.; Wu, F.; Chen, Z.; Li, C.; Cheng, G.; Qin, F.X. Inhibition of Influenza A Virus Replication by TRIM14 via Its Multifaceted Protein-Protein Interaction with NP. Front. Microbiol. 2019, 10, 344. [Google Scholar] [CrossRef] [Green Version]
- Patil, G.; Zhao, M.; Song, K.; Hao, W.; Bouchereau, D.; Wang, L.; Li, S. TRIM41-Mediated Ubiquitination of Nucleoprotein Limits Influenza A Virus Infection. J. Virol. 2018, 92, e00905-18. [Google Scholar] [CrossRef] [Green Version]
- Yuan, Y.; Fang, A.; Wang, Z.; Tian, B.; Zhang, Y.; Sui, B.; Luo, Z.; Li, Y.; Zhou, M.; Chen, H.; et al. Trim25 restricts rabies virus replication by destabilizing phosphoprotein. Cell Insight 2022, 1, 10057. [Google Scholar] [CrossRef] [PubMed]
- Peng, J.; Zhu, S.; Hu, L.; Ye, P.; Wang, Y.; Tian, Q.; Mei, M.; Chen, H.; Guo, X. Wild-type rabies virus induces autophagy in human and mouse neuroblastoma cell lines. Autophagy 2016, 12, 1704–1720. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, J.; Wang, H.; Gu, J.; Deng, T.; Yuan, Z.; Hu, B.; Xu, Y.; Yan, Y.; Zan, J.; Liao, M.; et al. BECN1-dependent CASP2 incomplete autophagy induction by binding to rabies virus phosphoprotein. Autophagy 2017, 13, 739–753. [Google Scholar] [CrossRef]
- Gori, S.G.; Anichini, G.; Gandolfo, C.; Cusi, M.G. SARS-CoV-2 N Protein Targets TRIM25-Mediated RIG-I Activation to Suppress Innate Immunity. Viruses 2021, 13, 1439. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Yin, G.; Bian, H.; Yang, J.; Zhou, P.; Yan, K.; Liu, C.; Chen, P.; Zhu, J.; Li, Z.; et al. LncRNA XIST upregulates TRIM25 via negatively regulating miR-192 in hepatitis B virus-related hepatocellular carcinoma. Mol. Med. 2021, 27, 41. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Wu, C.; Pan, Y.; Liu, H.; Wang, X.; Yang, Y.; Gu, M.; Zhang, Y.; Wang, X. NDR2 promotes the antiviral immune response via facilitating TRIM25-mediated RIG-I activation in macrophages. Sci. Adv. 2019, 5, eaav0163. [Google Scholar] [CrossRef] [Green Version]
- Pauli, E.K.; Chan, Y.K.; Davis, M.E.; Gableske, S.; Wang, M.K.; Feister, K.F.; Gack, M.U. The ubiquitin-specific protease USP15 promotes RIG-I-mediated antiviral signaling by deubiquitylating TRIM25. Sci. Signal. 2014, 7, ra3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, J.; Zhang, Y.; Zhang, Q.; Wu, Y.; Zhang, B.; Mo, M.; Tian, Q.; Zhao, J.; Mei, M.; Guo, X. The Deoptimization of Rabies Virus Matrix Protein Impacts Viral Transcription and Replication. Viruses 2019, 12, 4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luo, J.; Zhang, Y.; Wang, Y.; Liu, Q.; Chen, L.; Zhang, B.; Luo, Y.; Huang, S.; Guo, X. Rhabdovirus Infection Is Dependent on Serine/Threonine Kinase AP2-Associated Kinase 1. Life 2020, 10, 170. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Zhang, B.; Wu, Y.; Tian, Q.; Zhao, J.; Lyu, Z.; Zhang, Q.; Mei, M.; Luo, Y.; Guo, X. Expression of interleukin-6 by a recombinant rabies virus enhances its immunogenicity as a potential vaccine. Vaccine 2017, 35, 938–944. [Google Scholar] [CrossRef]
ID | Sequence (5′-3′) |
---|---|
HEP-N-FLAG-F | TTCGAGCTCATCGATGGTACCATGGATGCCGACAAGAT |
HEP-N-FLAG-R | AATTAATTAAGATCTGCTAGCTTATGAGTCACTCGAATACG |
HEP-P-FLAG-F | TTCGAGCTCATCGATGGTACCATGAGCAAGATCTTTGTTAATCCGAGTG |
HEP-P-FLAG-R | AATTAATTAAGATCTGCTAGCTTAGCATGATGTGTAGCGATCCAAG |
HEP-M-FLAG-F | TTCGAGCTCATCGATGGTACCATGAACTTTCTATGTAAGATAGTGAA |
HEP-M-FLAG-R | AATTAATTAAGATCTGCTAGCTTATTCTAAAAGCAGAGAAGAGTC |
HEP-G1-FLAG-F | TTCGAGCTCATCGATGGTACCATGGTTCCTCAGGTTCTTTTG |
HEP-G1-FLAG-R | AATTAATTAAGATCTGCTAGCTCACTTCCCCCATTTCGG |
HEP-G2-FLAG-F | TTCGAGCTCATCGATGGTACCTATGTATTGATGATTGCAGG |
HEP-G2-FLAG-R | AATTAATTAAGATCTGCTAGCTCACAGTCTGGTCTCG |
HEP-L-FLAG-F | TTCGAGCTCATCGATGGTACCATGCTGGATCCGGGAGAG |
HEP-L-FLAG-R | AATTAATTAAGATCTGCTAGCTTACAAACAACTGTAGTCTAGTAGGGA |
siRNA | Sense (5′-3′) | Antisense (5′-3′) |
---|---|---|
TRIM25-1 | GCAAAUGUACCCAGCACAATT | UUGUGCUGGGUACAUUUGCTT |
TRIM25-2 | CCCACUUCUCACCUAACAATT | UUGUUAGGUGAGAAGUGGGTT |
TRIM25-3 | CCUCUCUAUCUGCUCCAAATT | UUUGGAGCAGAUAGAGAGGTT |
RIG-I-1 | CCAGAUGAUAGAUACUACAAUTT | AUUGUAGUAUCUAUCAUCUGGTT |
RIG-I-2 | CCUGGGUAAUGAAAGCCGAUUTT | AAUCGGCUUUCAUUACCCAGGTT |
RIG-I-3 | GCUGGCAUGUAUAUGUGCGUATT | UACGCACAUAUACAUGCCAGCTT |
IFNα-1 | GAGCCAGAUUAUCUCUUUCUATT | UAGAAAGAGAUAAUCUGGCUCTT |
IFNα-2 | CGUCAUUGAAUCACACCUGAUTT | AUCAGGUGUGAUUCAAUGACGTT |
IFNα-3 | CAGUCAUUGAAAGCCUAGAAATT | UUUCUAGGCUUUCAAUGACUGTT |
IFNβ-1 | GCAGAAGAGUUACACUGCCUUTT | AAGGCAGUGUAACUCUUCUGCTT |
IFNβ-2 | AGCCCUCUCCAUCAACUAUAATT | UUAUAGUUGAUGGAGAGGGCUTT |
IFNβ-3 | GCUCUCCACUUGAAGAGCUAUTT | AUAGCUCUUCAAGUGGAGAGCTT |
NC | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUUCGGAGAATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, B.; Cai, T.; He, H.; Huang, X.; Luo, Y.; Huang, S.; Luo, J.; Guo, X. TRIM25 Suppresses Rabies Virus Fixed HEP-Flury Strain Production by Activating RIG-1-Mediated Type I Interferons. Genes 2023, 14, 1555. https://doi.org/10.3390/genes14081555
Zhang B, Cai T, He H, Huang X, Luo Y, Huang S, Luo J, Guo X. TRIM25 Suppresses Rabies Virus Fixed HEP-Flury Strain Production by Activating RIG-1-Mediated Type I Interferons. Genes. 2023; 14(8):1555. https://doi.org/10.3390/genes14081555
Chicago/Turabian StyleZhang, Boyue, Ting Cai, Hongling He, Xuezhe Huang, Yongwen Luo, Shile Huang, Jun Luo, and Xiaofeng Guo. 2023. "TRIM25 Suppresses Rabies Virus Fixed HEP-Flury Strain Production by Activating RIG-1-Mediated Type I Interferons" Genes 14, no. 8: 1555. https://doi.org/10.3390/genes14081555