Mutations of BRCA1, BRCA2, and PALB2 Genes in Breast Tumor Tissue: Relationship with the Effectiveness of Neoadjuvant Chemotherapy and Disease Prognosis
by
,
Matvey M. Tsyganov
1,2,*
,
Sofia S. Sorokovikova
1,3,
Elizaveta A. Lutzkaya
1 and
Marina K. Ibragimova
1,2,3 1
Department of Experimental Oncology, Cancer Research Institute, Tomsk National Research Medical Center, Russian Academy of Sciences, 5, Kooperativny Street, 634050 Tomsk, Russia
2
Faculty of Medicine and Biology, Siberian State Medical University, 2, Moskovsky Trakt, 634050 Tomsk, Russia
3
Biological Institute, National Research Tomsk State University, 36, Lenin Avenue, 634050 Tomsk, Russia
*
Author to whom correspondence should be addressed.
Genes 2023, 14(8), 1554; https://doi.org/10.3390/genes14081554
Submission received: 19 June 2023
/
Revised: 24 July 2023
/
Accepted: 26 July 2023
/
Published: 28 July 2023
(This article belongs to the Section Molecular Genetics and Genomics)
Abstract
:It has been shown that the loss of function of the BRCA1, BRCA2, and PALB2 genes due to a number of hereditary mutations or chromosomal aberrations can affect the effectiveness of chemotherapy treatment and disease prognosis in patients with various types of cancer, and in particular in breast cancer. Thus, the aim of the work was to evaluate the predictive and prognostic potential of DNA copy number aberrations and mutations in the BRCA1, BRCA2, and PALB2 genes in breast tumors. Materials and Methods: The study included 66 patients with breast cancer. DNA copy number aberrations (CNA) were assessed by high-density CytoScanHD™ Array micro matrix analysis. Gene mutations were assessed by sequencing on the MiSeq™ Sequencing System using the Accel-Amplicon BRCA1, BRCA2, and PALB2 Panel. Results: It has been established that the presence of a normal copy number of PALB2 is associated with a lack of response to chemotherapy in Taxotere-containing treatment regimens (p = 0.05). In addition, the presence of a PALB2 deletion is associated with 100% metastatic survival rates (log-rank test p = 0.04). As a result of sequencing, 25 mutations were found in the BRCA1 gene, 42 mutations in BRCA2, and 27 mutations in the PALB2 gene. The effect of mutations on the effectiveness of treatment is controversial, but an effect on the survival of patients with breast cancer has been shown. So, in the presence of pathogenic mutations in the BRCA2 gene, 100% metastatic survival is observed (log-rank test p = 0.05), as well as in the elimination of PALB2 mutations during treatment (log-rank test p = 0.07). Conclusion: Currently, there is little data on the effect of chromosomal aberrations and mutations in the BRCA1/2 and PALB2 genes on the effectiveness of treatment and prognosis of the disease. At the same time, the study of these genes has great potential for testing focused on a personalized approach to the treatment of patients with breast cancer.
Keywords:
BRCA1; BRCA2; PALB2; CNA; DNA copy number aberrations; mutations; efficiency; neoadjuvant chemotherapy; prognosis1. Introduction
Breast cancer (BC) tumorigenesis is driven by various genes, among which are such classical tumor suppressors as BRCA1 and BRCA2 [1]. The products of these genes are phosphoproteins contributing to the process of homologous recombination repair of double DNA strand breaks, play a role in controlling the cell cycle and repression of estrogen transcriptional activity, inhibiting the proliferation of breast cells and other estrogen-dependent organs [2]. It has been noted that in the presence of heterozygous hereditary mutations in the BRCA1 genes, the likelihood of a secondary inactivating mutation, deletion, or hypermethylation of the promoter increases, and in such cells, there is a violation of DNA repair, which leads to genomic instability, various chromosomal aberrations, and, as a result, an increased risk of developing cancer [3]. Hereditary BRCA1 mutations increase the cumulative risk of developing breast cancer by the age of 70 to 60–70% [1]. One of the most well-known and widespread is the BRCA1 c.5266dupC germline mutation in exon 20, which is associated with a high risk of breast cancer and ovarian cancer [4]. In addition, its relationship with the effectiveness of chemotherapy treatment has been shown, in particular, patients with the mutation are very sensitive to platinum drugs and resistant to taxanes [5]. Further studies have shown that cells with BRCA1 and BRCA2 dysfunction are deficient in the repair of double-stranded DNA breaks (HRD—homologous recombination deficiency) by the conservative mechanism of homologous recombination [6]. Current evidence suggests that in sporadic cancers, the processes underlying HRD may be due to more than just germline mutations (e.g., c.5266dupC, c.1961del, c.3700_3704del, c.3756_3759del, c.4035del in BRCA1, and c.5946del in BRCA2, etc.) but also by numerous other mechanisms. Tumors that are phenotypically and genetically similar to familial BRCA1-associated breast cancer have similar properties to those and are defined as “BRCAness” (BRCA-like tumors) and these common properties may be important for treatment [7].
The main reasons for the loss of activity of the BRCA1 gene are aberrant expression, loss of heterozygosity of this gene, the presence of a deletion of the 17q21.31 locus in the tumor tissue, somatic mutations, promoter hypermethylation, etc. Relatively recently, a comparative study of the efficacy of carboplatin and docetaxel in patients with familial breast cancer and BRCA-like tumors was carried out. It was found that in BRCA-associated patients, the efficacy of carboplatin was statistically significantly higher compared to docetaxel (68% vs. 33%, respectively, p = 0.01). However, such an effect was not obtained in BRCAness tumors with a methylated gene promoter and underexpression [8]. Studying the predictive and prognostic values of the BRCAness tumor landscape, it was found that the status of HRD and its assessment predicted pathological complete response (PCR) in patients with triple-negative BC (p = 0.0012) [9]. In addition, the GeparSixto (GBG66) study found that the PCR rate in patients with triple-negative breast cancer in the general group (regardless of BRCA1/2 status) was higher in the carboplatin-treated group (RR 1.87; 95% CI 1.17–2.97; p = 0.009): 41.4% (60 of 145) and 56.8% (83 of 146 patients), respectively. At the same time, tumors with HRD were more likely to achieve PCR than tumors with a high level of HR (55.9% vs. 29.8%, p = 0.001). Moreover, patients with HRD tumors showed a higher PCR rate when carboplatin was added to the chemotherapy regimen (64.9% vs. 45.2%; p = 0.025) [10].
In our opinion, large chromosomal rearrangements and mutations not only in the BRCA1 gene but also in the BRCA2 and PALB2 genes are of great importance in the formation of a deficiency in homologous recombination, since these genes function in a complex.
As for the PALB2 gene, it has been found that it also plays a key role in the process of DNA repair by homologous recombination. When repairing double-strand breaks, PALB2 bridges the BRCA complex as a “bridge” [11]. It has been shown that the loss of PALB2 function due to mutations is an important cause of hereditary breast cancer [12,13], along with the carriage of mutations in the BRCA1 and BRCA2 genes [14,15]. Patients with PALB2 mutations have more aggressive clinical and pathological features of the tumor process [16]. The effect of loss of PALB2 function on the effectiveness of treatment was established. The objective response rate in pancreatic ductal adenocarcinoma in patients with mutations was 58% compared with 21% in the control group (p = 0.0022). The influence of the presence of the PALB2 mutation on the prognosis of the disease has not yet been fully established. But, in the work of Cybulski C. et al., 116 carriers of 509_510delGA or 172_175delTTGT mutations were identified in 12,529 women diagnosed with breast cancer. Ten-year survival for PALB2 mutations carriers and non-carriers was 48.0% (95% CI, 36.5–63.2%) and 74.7% (95% CI, 73.5–75.8%), respectively (OR 2.27, 95% CI 1.64–3.15; p < 0.0001) [13]. A similar result was shown for patients diagnosed with pancreatic ductal adenocarcinoma. In particular, it was found that when treated with platinum drugs, patients who carried PALB2 mutations had a 1-year overall survival (OS) of 94% compared with 60% in the control group of patients [17]. One of the latest studies [18] showed that the use of olaparib in a patient with metastatic breast cancer with a pathogenetically significant PALB2 mutation (exon 1, c.18G>T, p. (=)) is significantly more beneficial (median progression-free survival of 8 months), compared with patients who do not have mutations in the PALB2 gene [19,20]. This may indicate the clinical potential of using PARP inhibitors in the presence of PALB2 mutations.
In addition, it is interesting to study the presence of DNA copy number aberrations (CNA) of PALB2. Although CNA on chromosome 16 is common, no PALB2 loss has been shown in breast cancer patients [21]. Thus, in patients with colorectal cancer, it was found that PALB2 deletion is associated with lower relapse-free (p = 0.026) and overall survival (p = 0.028) [22]. At the same time, low expression also correlated with lower overall survival rates (at p < 0.001). Interestingly, in breast cancer, higher PALB2 expression (which may be due to amplification of the 16p12.2 locus) is associated with lower overall survival (at p < 0.01) in stage III patients [23].
However, in the current context and the highly controversial and controversial results of many studies, it is difficult to say about the clinical significance of the presence of mutations and chromosomal aberrations of the BRCA1, BRCA2, and PALB2 genes in a breast tumor and their impact on the effectiveness of chemotherapy and disease prognosis. In this regard, the work was aimed to evaluate CNA and mutations of the BRCA1, BRCA2, and PALB2 genes in the breast tumor of patients and their predictive and prognostic potential.
2. Materials and Methods
2.1. Patients and Treatment
The study involved 66 patients with operable breast cancer stage IIA–IIIB (T1–4N0–3M0) with morphologically verified diagnosis, aged 28–68, the average age being 47.43 ± 0.78 years old (Mean ± SE) (Table 1). All of them had treatment from 2006 to 2020 at the Cancer Research Institute, Tomsk National Research Medical Center of the Russian Academy of Sciences (Tomsk, Russia). Also, the inclusion criteria for patients in the study are the appointment of neoadjuvant chemotherapy and the absence of significant comorbidities. The study was conducted according to the ethical principles suggested in the Declaration of Helsinki (fixed in 2013) and approved by the Ethical Committee of the Cancer Research Institute (Protocol No. 21 of 14 October 2022). Signed informed consent was obtained from all participants.
In accordance with the “Consensus Conference on Neoadjuvant Chemotherapy (NAC) in Carcinoma of the Breast,” on 26–28 April 2003, in Philadelphia, Pennsylvania, [24] all patients received 4–8 courses of neoadjuvant chemotherapy AC (adriamycin 50 mg/m2 and cyclophosphamide 600 mg/m2 1 per 3 weeks), AT (adriamycin 50 mg/m2 and Taxotere 75 mg/m2) or ACT (adriamycin 50 mg/m2, cyclophosphamide 600 mg/m2, Taxotere 75 mg/m2), CAX (cyclophosphamide 100 mg/m2 intramuscularly, adriamycin 30 mg/m2 intravenously, and xeloda 1200 mg/m2 orally), CP (cyclophosphamide 1080 mg/m2, cisplatin 135 mg) or monotherapy Taxotere (100 mg/m2 1 h infusion per day). The effect of chemotherapy was determined according to the criteria of the World Health Organization. A complete response (CR) was defined as the complete disappearance of the primary tumor and lymph node metastasis. A partial response (PR) was defined as a tumor reduction > 50% and stabilization (ST) was defined as a tumor reduction ≤ 50% or a tumor size increase of <25%. Progression (P) was described as an increase of >25% in tumor size. Conventionally, for the convenience of calculation and description, all patients were divided into two groups: patients with complete and partial regression forming a group with an objective response to neoadjuvant chemotherapy; patients with stabilization and progression forming a group with no response to treatment. After 3–5 weeks NAC all patients had a radical or subcutaneous mastectomy, radical resection, sectoral resection with axillary lymphadenectomy or other type of organ-preserving surgery; then, the patients underwent radiation and/or hormonal or targeted therapy (Herceptin for HER2+ status) according to indications. During the entire period, the patients were dynamic and monitored. The median follow-up time was 44 months (44 ± 3.75).
We analyzed biopsy tumor samples before treatment (~10 mm3), which were obtained under the control of an ultrasound, and after (~60–70 mm3) neoadjuvant treatment (after 3–5 weeks after the last course of chemotherapy). All tumor samples were placed in RNAlater solution (Thermo Scientific, Waltham, MA, USA) and stored at –80 °C (after 24 h incubation at +4 °C) for the following DNA extraction.
2.2. DNA Extraction
DNA was isolated from 66 paired tumor samples before and after chemotherapy with QIAamp DNA mini Kit (Qiagen, Hilden, Germany). DNA quality and concentration were assessed on a fluorometer Qubit 4.0 (Thermo Scientific, Waltham, MA, USA), from 50 to 250 ng/mcl. DNA integrity was assessed by capillary electrophoresis on a TapeStation 4150 device (Agilent Technologies, Santa Clara, CA, USA); DNA fragments were over 60 kbp.
2.3. Microarrays Assay
Microarray analysis on high-density microarrays from Affymetrix (USA) CytoScanTM HD Array was used to evaluate the CNA performed, which contains 1 million 900 thousand non-polymorphic markers for the analysis of copy number aberrations. Sample preparation, hybridization, and scanning procedures were performed in accordance with the manufacturer’s protocol on the Affymetrix GeneChip® Scanner 3000 7G system (Affymetrix, Santa Clara, CA, USA). CytoScan HD Suite has greater than 99% sensitivity and can reliably detect 25–50 kb copy number changes across the genome at high specificity (amplifications (gain) and deletions (loss) sections of chromosomes). Chromosome Analysis Suite 4.1 (Affymetrix, Santa Clara, CA, USA) was used for statistics. As a result of the analysis, amplifications (that is, an increase in the number of copies of the gene) and deletions (that is, a decrease in the number of copies of the gene) of the BRCA1, BRCA2, and PALB2 genes were determined.
2.4. Next-Generation Sequencing (NGS)
BRCA1, BRCA2, and PALB2 gene mutations in tumor and patient blood were assessed by sequencing on a MiSeq™ Sequencing System (Illumina, San Diego, CA, USA) using the Accel-Amplicon BRCA1, BRCA2, and PALB2 Panel (Swift Biosciences, Ann Arbor, MI, USA). Libraries of tumor DNA and patient blood DNA (as a germline mutation control) were prepared using the Swift Normalase KIT (Swift Biosciences, Ann Arbor, MI, USA). Sample preparation was performed according to the kit manufacturer’s instructions and included DNA fragmentation, ligation of adapters (synthesized oligonucleotides with a known sequence) to the ends of the fragments, and amplification of the resulting libraries. Amplification was based on the bridging PCR method and the formation of clusters on a flow cell.
2.5. Statistics
The statistical data processing was carried out using the application package Statistica 8.0 (StatSoft Inc., Tulsa, OK, USA). Survival curves were constructed by the Kaplan–Meier method and the log-rank test for the analysis of metastatic-free survival (MFS). Frequency comparisons based on qualitative data were analyzed using Fisher’s two-sided test (http://vassarstats.net/index.html (accessed on 27 July 2023)). Data processing was performed using the GATK pipeline and genetic variants found in samples of breast tumor tissue were annotated using the ANNOVAR tool.
3. Results
At the first stage of the work, the CNA frequency of the BRCA1, BRCA2, and PALB2 genes was estimated. The highest frequency of chromosome aberrations is observed in the BRCA1 gene. The frequency of deletions and amplifications is 37.9% (25/66 patients) and 24.2% (16/66 patients), respectively. The frequency of deletions and amplifications, respectively, in the BRCA2 gene is 36.4% and 3%, and the PALB2 gene is 21.2% and 27.3%. Next, an analysis was made of the relationship between CNA of the studied genes and the main clinical and pathological characteristics of patients (age, menstrual status, histological type, tumor size, lymphogenous metastasis, histological form). It was found that none of the parameters was statistically significantly associated with the presence of chromosomal aberrations in the studied gene.
Further, it was shown that in the general group of patients with the presence of deletions (25.5%, 12/47 patients) and amplifications (31.9%, 15/47 patients) at the level of a pronounced trend (p = 0.07), an objective response is most often observed on treatment (complete and partial regression), compared with the group without response (stabilization and progression), where the frequency of deletions (10.5%, 2/19 patients) and amplifications (15.8%, 3/19 patients) is lower, more than twice (Table 2). It was also found that in the group of patients with stabilization and progression, PALB2 amplification is completely absent, whereas in 8 out of 9 patients, the normal copy number of the gene is preserved, at p = 0.05 (Table 2).
In addition, it was found that the presence of a deletion in the BRCA1 gene in 91% of cases determines the presence of an objective response to treatment, at p = 0.04.
All statistically significant associations have a borderline significance level, which can most likely be explained by a small sample for this analysis. Nevertheless, there is a tendency that, for example, the presence of a deletion (loss) of a copy of the BRCA1 gene causes a deficiency in homologous recombination, and this is manifested in the high efficiency of platinum-containing drugs.
Further, using the Kaplan–Meier method, the association of MFS with the CNA of the studied genes was evaluated. In the group of 66 examined patients, distant metastases developed in 14 (21.2%) patients within 4–122 months from the moment of diagnosis. It was found that the 5-year survival rate in the group of patients with PALB2 deletion is 100%, against 83% in the group with amplification, and 68% in the group with normal copies of this gene (log-rank test p = 0.04) (Figure 1C). No significant differences in survival rates were found for the BRCA1 and BRCA2 genes (Figure 1A,B).
It is interesting to note that if patients are divided into groups according to the presence of CNA of three genes—patients with amplifications in two or all genes, patients with deletions in two or all genes, patients with a normal copy number of genes, and a group of patients with different CNAs in three genes—then 100% survival rates are shown in the group with the presence of deletions in the studied genes compared with the norm (log-rank test p = 0.05) and with different CNAs (log-rank test p = 0.01), (Figure 1D).
But at the same time, this distribution does not correlate with the effectiveness of neoadjuvant chemotherapy, p = 0.39 (Figure 2).
At the next stage of the work, in the formed sample of patients, using the Accel-Amplicon BRCA1, BRCA2, and PALB2 panel, tumor samples were screened before and after chemotherapy for the presence of mutations in the studied genes.
As a result of the analysis of the BRCA1 gene, both before and after NAC, 25 different mutations were identified (Table 3). It should be noted that synonymous SNVs do not change the amino acid sequence of a protein and, therefore, do not have a direct functional effect on its structure or function. In general, synonymous mutations are considered “neutral” in terms of functional consequences. However, studies show that not all synonymous mutations are completely neutral. Some of these may affect the rate or accuracy of transcription, mRNA splicing, or mRNA stability, which in turn may affect protein expression [25,26].
A total of 8 synonymous substitutions were identified, with a positive clinical load, as well as 12 non-synonymous substitutions, of which three mutations, c.1067A>G (rs1799950), c.2608G>A (rs753256448), and c.2609C>G (rs1060502324), have an unidentified significance.
In addition, three pathogenetically significant mutations were found: a frameshift insertion c.2612_2613insT (rs80357948), a frameshift deletion (c.4035delA (rs80357711)), and a frameshift duplication (c.5329dupC (rs397507247, rs39750724), rs431825413; rs80357906)). Moreover, the presence of c.4035delA in two patients observed the progression of the breast tumor.
In 12 patients, BRCA1 mutations were not found both before and after NAC. For 10 patients, elimination of mutations during treatment is typical, with 80% of them having complete and partial regression of the tumor, and two progressing and stabilizing. If patients with BRCA1 mutations that have no semantic load and clinical significance are excluded from the sample of patients, then only 8 types of mutations will remain: c.1067A>G, c.2470_2471insTTCCGATCTTAGTCC, c.2608G>A, c.2609C>G, c.2612_2613insT, c.4035delA, c.4807_4821del, and c.5329dupC. Moreover, the presence of these mutations before treatment most often determined an objective response to chemotherapy (Figure 3), in particular, this is typical for c.2608G>A, c.2609C>G, c.2612_2613insT, and c.5329dupC.
When analyzing the BRCA2 gene, many more mutations were identified, namely 42 different mutations (Table 4). The presence of five pathogenetically significant mutations was shown, including one non-synonymous substitution and one frameshift insertion. There are 16 BRCA2 mutations with an undetected clinical burden.
In 19 patients, mutations were not found in the biopsy material of the tumor.
Interestingly, the presence of pathogenetic BRCA2 mutations in the tumor of breast cancer patients before treatment at the level of a pronounced trend is associated with the effectiveness of NAC (Figure 4A). In 86.4% of cases (19/22 patients), such patients have an objective response to treatment, compared with the group with stabilization and progression (63.6%, 28/44 cases), p = 0.08, and 100% metastatic-free survival versus 72.5% of 5-year-old MFS in the group without these mutations (log-rank test p = 0.05) (Figure 4B).
A total of 27 mutations were found in the PALB2 gene spanning from exons 2 to 12, mostly concentrated in exon 8. The majority (97%, 64/66 patients) of patients had 5 intron mutations—c.3114-51T>A (rs249936); c.2586+58C>T (rs249954); c.212-58A>C (rs80291632); c.2587-38C>T (rs180177119); c.3351-53delT (rs35294437)—while the latter has an unidentified clinical significance. In addition, 8 frameshift deletions and 1 non-frameshift deletion were detected; 1 frameshift insertion and 2 non-frameshift insertions; 3 missense options; 3 non-synonymous SNVs and 3 synonymous SNVs, and one stop-gain, in a total of 26 patients (Table 5).
The presence of non-intron mutations was detected in 33% of patients with breast cancer (22/66 cases). Moreover, the presence of these mutations in the tumor before treatment in 28.6% and 80% of cases (4/14 and 4/5) causes a lack of response to neoadjuvant chemotherapy (stabilization and progression of the tumor, respectively), the results are not statistically significant, but a relationship is shown at the level of a pronounced trend (Figure 5).
It is interesting to note that in all patients with the elimination of the frameshift deletion c.2552delA (p.Asn851fs) mutation during NAC, objective responses to treatment are observed, whereas with the appearance of this mutation, we observed the effect of chemotherapy stabilization in one patient. At the moment, the clinical significance of mutations remains unknown. Mutations c.1706_1707del (p.Lys569fs), c.1706delA (p.Lys569fs), and c.1288delC (p.Gln467fs) also occurred in patients with an objective response to treatment (Table S1).
In addition, non-synonymous SNV was most often found in the tumor biopsy material (15 out of 66 patients). Mutation c.1676A>G (p.Gln559Arg) occurred in 12 patients, of which 4 patients had complete and partial regression, and 8 patients had stabilization and progression. All identified missense mutations (c.2993G>A; c.2014G>C; c.1010T>C) were observed in patients with tumor progression during treatment. But, only c.1010T>C has pathogenic significance.
Further, using the Kaplan–Meier method, the association of MFS with changes in the presence of mutations in the process of NAC for the three genes under study, as well as the association with the presence/absence of mutations in the surgical material of the breast tumor was assessed (Figure 6). In particular, all patients were divided into four groups: the first group consisted of patients with complete elimination of mutations during chemotherapy; the second group was of those patients who have new mutations; in the third group of patients, chemotherapy did not affect the mutation profile; the fourth group of patients had no mutations either before or after NAC. It was found that in patients with a complete absence of mutations both before and after NAC, with elimination or the appearance of new mutations during treatment, as well as in a group of patients in whom mutations were found in tumor biopsy and surgical material, the metastatic survival rates did not differ (log-rank test p = 0.63) (Figure 6A). When comparing groups of patients with and without BRCA1 mutations after NAC, no statistically significant differences were found either (log-rank test p = 0.84) (Figure 5B). A similar result is shown for the BRCA2 gene (Figure 6C,D). But an interesting result was demonstrated for the PALB2 gene. So, if in the course of treatment there was an elimination of mutations of this gene in a breast tumor, then in such patients a 100% 5-year non-metastatic survival is observed, while in an unchanged state, survival does not exceed 50%. The differences are not statistically significant, but a strong trend is shown at p = 0.07 (Figure 6E). And consequently, the absence of mutations in the surgical material of the tumor is also at the level of a trend associated with higher rates of MFS (log-rank test p = 0.1).
4. Discussion
In our work, CNAs in the BRCA1, BRCA2, and PALB2 genes were evaluated, as well as their clinical significance when using NAC. Such an analysis is an important promising direction for expanding the range of clinical markers when prescribing personalized therapy, since the products of the BRCA1, BRCA2, and PALB2 genes, as mentioned above, are involved in many cell vital processes associated with maintaining genome stability. More specifically, they appear in the activation of the G2-M checkpoint, which prevents cell division in the presence of DNA damage [27], as well as in the repair of genetic information through homologous recombination.
It should be noted that according to our previous studies [28], the frequency of aberrations in the number of copies of the BRCA1 gene in breast tumors is 53.3% (48/90 cases), of which the frequency of deletions and amplifications is 35.6% and 17.7%, respectively. which is consistent with the results obtained. It is also important that in this study, the frequency of occurrence of mutations in genes BRCA1, BRCA2, and PALB2 is higher compared to the data in the literature since all classes of mutations were taken into account. The frequency of BRCA1 and BRCA2 deletions in breast cancer is higher than the frequency of amplifications and often represents about 10–15% of cases [29]. BRCA1/2 amplifications are 5% [30]. It is important to note that the frequency of mutations can be dynamic, changing depending on the stage of the disease and other factors. At the same time, according to some data from the literature, mutations in the BRCA1 and BRCA2 genes occur in 22–28% of cases; however, these values may vary depending on the type of cancer, ethnic group, and geographic location. For example, in triple-negative breast cancer, the frequency of mutations in the BRCA1 gene is up to 16% [31]. At the same time, the frequency of BRCA1/2 mutations may be higher in patients with familial hereditary breast cancer—about 1–2% to 40%—depending on the population and region [32]. With regard to sporadic cases of breast cancer, in which BRCA1 and BRCA2 mutations occur randomly and are not associated with family history, their frequency of occurrence may be lower and range from 5% to 10% depending on the population.
Since the BRCA1, BRCA2, and PALB2 genes are related to each other—they form physiologically significant complexes—therefore, it can be logically argued that mutations in one of the genes, leading to a change in expression, can indirectly affect the work of other proteins, and therefore, the processes in which they participate [33]. For example, there are studies where the abolition of the BRCA1-PALB2 interaction led to defects in HR-based repair [34]. In our work, we observed a positive response to treatment in the group with a high frequency of gene copy number changes. That is, referring to the above facts, it can be assumed that deletions and amplifications in tumor cells could lead to their death due to a violation of the mechanisms of damage control and repair. Therefore, the presence of deletions in BRCA1 in our study in 91% of cases was associated with a partial or complete response to the treatment with platinum-containing drugs.
In the BRCA1 gene, we detected a pathogenic frameshift deletion c.4035delA in two people with progression. This mutation is described in the literature as a founder mutation [35]. Overall, a number of meta-analyses have shown that the addition of platinum to neoadjuvant chemotherapy regimens increases PCR rates in a group with a BRCA mutation compared with wild-type patients, but this phenomenon is at the level of a trend and does not reach statistical significance. Among mutant BRCA1 patients, 58.4% (93/159 cases) were found to have achieved PCR, while only 50.7% of wild-type cases (410/808 patients) showed PCR (OR 1.459 CI 95% [0.953–2.34], p = 0.082) [36]. Another meta-analysis found that the cumulative pathological complete response rates were 43.4% (59/136) and 33.9% (77/227) for the platinum-treated and control group, respectively. The addition of platinum to the neoadjuvant regimen also did not lead to a significant improvement in the PCR rate (odds ratio [OR]: 1.340, 95% confidence interval [CI] = 0.677–2.653, p = 0.40) [37].
Interestingly, among the BRCA2 gene mutations, the c.8208_8209insAG (rs483353122) mutation was found, which was not previously described in the 1000G, ExAC, SIFT, PolyPhen2, Mutation Taster databases. In dbSNP, ENIGMA rs483353122 of the BRCA2 gene is classified as a highly pathogenic frameshift mutation. Moreover, this mutation was discovered by our colleagues [38], and the question of its clinical significance remains open. A pathogenetically significant BRCA2 mutation c.8673_8674delAA was identified only in prostate cancer patients without an aggressive course of this disease [39]. There is little information about the effect of c.9090delA mutations, it is reported that it was found in colorectal cancer [40], and it can also determine sensitivity to PARP inhibitors [41].
Currently, there is little risk of familial breast cancer development in patients with mutations in the PALB2 gene. It has been established that mutations altering the gene protein are scattered throughout the coding region [14,42]; however, four PALB2 mutations are most common: PALB2 c.509_510delGA (p.Arg170fs*14) [43], PALB2 c.2323C>T (p.Gln775*) [44], PALB2 c.1592delT (p.531 fs*30) [45], and PALB2 c.3113G>A, [46,47].
It has been shown that mutations in PALB2, which binds BRCA2, affect the double-strand break repair mechanism [48], which provides a basis for the targeted use of chemotherapeutic agents targeting this mechanism. Some authors have shown the effectiveness of mitomycin C and/or cisplatin in the presence of mutations in the gene under study [49]. It has been shown that the presence of somatic mutation T413S in small-cell lung cancer disrupts the association of the gene with chromatin and reduces resistance to camptothecin [50]. There is also evidence that high expression of PALB2 in non-small cell lung cancer is associated with overall survival (at p = 0.0266) [51]. In addition, high expression of PALB2 mRNA was a predictor of response to cisplatin/docetaxel chemotherapy. In particular, in these patients, the objective response rate was 77% compared to the low expression group, where the response rate was only 23% (p = 0.0448). Whereas in acute myeloid leukemia, high expression of PALB2, on the contrary, was associated with worse OS parameters [52].
In our study, it was found that the frequency of occurrence of mutations in the PALB2 gene is 8 frameshift deletions and 1 non-frameshift deletion; 1 frameshift insertion and 2 non-frameshift insertion; 3 missense options; 3 non-synonymous SNVs and 3 synonymous SNVs, and one stop-gain. Among the frameshift deletions, two mutations (c.1706_1707del and c.1686delG) are of pathogenic significance. Many authors suggest that these mutations may contribute to the risk of familial breast cancer [14,53]. For other mutations of this class, clinical significance remains unidentified. Interestingly, three missense variants found in our sample, c.2993G>A (p.Gly998Glu); c.2014G>C (p.Glu672Gln) and c.1010T>C (p.Leu337Ser) were described earlier [54,55]. Moreover, some authors suggest that c.1010T>C (p.Leu337Ser) and c.2993G>A (p.Gly998Gln) can affect the function of the PALB2 protein [56].
The most common variant, c.1676A>G (Gln559Arg; rs152451), which is predicted by CADD, Condel, PolyPhen2, and SIFT to be benign, was significantly more common in cases (19.9% carried at least one non-wild-type allele) than controls (16.8% non-wild-type) [57]. It was found that the c.94C>G (p.Leu32Val) mutation was observed in several patients with familial breast cancer [47,58].
As for the association of mutations with disease prognosis in patients with breast cancer, it has been shown that the presence of mutations in the gene under study is not associated with disease-free survival [59]. For pancreatic ductal adenocarcinoma, platinum-treated patients who had PALB2 mutations had a higher overall survival (mean: 20.1 months) compared to non-mutated controls (mean: 15.5 months), (p = 0.002). At the same time, in patients who did not receive platinum-containing drugs, there were no significant differences in survival between groups (at p = 0.12), [17]. In our case, the presence of mutations in the PALB2 gene in patients treated according to the cyclophosphamide/cisplatin NAC regimen did not affect the effectiveness of treatment (p = 0.49) and the prognosis of the disease (log-rank test p = 1.00) (data not shown).
In a study by K. Pylkäs on the Finnish population, it was shown that patients with breast cancer and ovarian cancer did not reveal large genomic rearrangements, in particular deletions [29], which is confirmed by another study [44]. In our work, it was found that in almost 50% of cases of patients with breast cancer, chromosomal aberrations of PALB2 are observed. Thus, even though the frequency of mutations in the PALB2 gene is rare (from 0.1% to 2.7%), the risk of developing breast cancer, at least for some PALB2 mutations, remains high.
To this day, there is little data on the impact of large chromosomal rearrangements and some previously undiscovered mutations in the BRCA1/2 and PALB2 genes on the effectiveness of treatment and prognosis of the disease. At the same time, the study of these genes has great potential for testing focused on diagnosis, prevention, and a personalized approach to the treatment of cancer patients.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes14081554/s1. Table S1: Mutations of the BRCA1, BRCA2 and PALB2 genes in breast tumors of patients before and after neoadjuvant chemotherapy.
Author Contributions
Conceptualization: M.M.T.; writing—original draft: M.M.T.; formal analysis: S.S.S. and E.A.L.; validation: M.K.I.; writing—review and editing: M.K.I. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by the Russian Science Foundation grant No. 22-15-00169.
Institutional Review Board Statement
All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki Declarationand its later amendments or comparable ethical standards. The study was approved by the Ethical Committee of the Cancer Research Institute (Protocol No. 21 of 14 October 2022).
Informed Consent Statement
Informed consent was obtained from all individual participants included in the study. The experiments comply with the current laws of the country.
Data Availability Statement
Certificate of state registration of the database No. 2022621615 dated 6 July 2022 “Database of the results of sequencing of the BRCA1 and BRCA2 genes in patients with luminal B breast cancer treated with platinum preparations” Tsyganov M.M., Ibragimova M.K., Garbukov E.Yu., Usynin E.A., Litvyakov N.V. Certificate of state registration of the database No. 2022620759 dated 6 April 2022 “Database of the genetic landscape of breast cancer patients with a triple negative phenotype” Ibragimova M.K., Tsyganov M.M., Garbukov E.Yu., Zdereva E.A., Usynin E.A., Litvyakov N.V. Certificate of state registration of the database No. 2022621573 dated 4 July 2022 “Database of the results of sequencing the PALB2 gene in patients with luminal B breast cancer” Tsyganov M.M., Ibragimova M.K., Garbukov E.Yu., Usynin E.A., Litvyakov N.V.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Imyanitov, E. Features of drug sensitivity of hereditary tumors. Vopr. Onkol. 2016, 62, 221–226. [Google Scholar]
- Markowska, J.; Bar, J.; Mądry, R.; Słomska, I.; Mardas, M.; Grabowski, J. The expression of BRCA1, P53, KAI1, and Nm23 in ovaries of BRCA1 mutation carriers after prophylactic adnexectomy. Arch. Gynecol. Obstet. 2013, 288, 839–844. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alter, B.P. Fanconi anemia and the development of leukemia. Best Pract. Res. Clin. Haematol. 2014, 27, 214–221. [Google Scholar] [CrossRef] [PubMed]
- Simard, J.; Tonin, P.; Durocher, F.; Morgan, K.; Rommens, J.; Gingras, S.; Samson, C.; Leblanc, J.-F.; Belanger, C.; Dion, F. Common origins of BRCA1 mutations in Canadian breast and ovarian cancer families. Nat. Genet. 1994, 8, 392–398. [Google Scholar] [CrossRef] [PubMed]
- Byrski, T.; Huzarski, T.; Dent, R.; Gronwald, J.; Zuziak, D.; Cybulski, C.; Kladny, J.; Gorski, B.; Lubinski, J.; Narod, S. Response to neoadjuvant therapy with cisplatin in BRCA1-positive breast cancer patients. Breast Cancer Res. Treat. 2009, 115, 359–363. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuchenbaecker, K.B.; Hopper, J.L.; Barnes, D.R.; Phillips, K.-A.; Mooij, T.M.; Roos-Blom, M.-J.; Jervis, S.; Van Leeuwen, F.E.; Milne, R.L.; Andrieu, N. Risks of breast, ovarian, and contralateral breast cancer for BRCA1 and BRCA2 mutation carriers. JAMA 2017, 317, 2402–2416. [Google Scholar] [CrossRef] [Green Version]
- Lord, C.J.; Ashworth, A. BRCAness revisited. Nat. Rev. Cancer 2016, 16, 110. [Google Scholar] [CrossRef]
- Tutt, A.; Tovey, H.; Cheang, M.C.U.; Kernaghan, S.; Kilburn, L.; Gazinska, P.; Owen, J.; Abraham, J.; Barrett, S.; Barrett-Lee, P. Carboplatin in BRCA1/2-mutated and triple-negative breast cancer BRCAness subgroups: The TNT Trial. Nat. Med. 2018, 24, 628–637. [Google Scholar] [CrossRef] [Green Version]
- Kaklamani, V.G.; Jeruss, J.S.; Hughes, E.; Siziopikou, K.; Timms, K.M.; Gutin, A.; Abkevich, V.; Sangale, Z.; Solimeno, C.; Brown, K.L. Phase II neoadjuvant clinical trial of carboplatin and eribulin in women with triple negative early-stage breast cancer (NCT01372579). Breast Cancer Res. Treat. 2015, 151, 629–638. [Google Scholar] [CrossRef]
- Von Minckwitz, G.; Timms, K.; Untch, M.; Elkin, E.P.; Fasching, P.A.; Schneeweiss, A.; Salat, C.; Rezai, M.; Blohmer, J.U.; Zahm, D.M. Prediction of pathological complete response (PCR) by Homologous Recombination Deficiency (HRD) after carboplatin-containing neoadjuvant chemotherapy in patients with TNBC: Results from GeparSixto. J. Clin. Oncol. 2015, 33, 1004. [Google Scholar] [CrossRef]
- Wu, S.; Zhou, J.; Zhang, K.; Chen, H.; Luo, M.; Lu, Y.; Sun, Y.; Chen, Y. Molecular mechanisms of PALB2 function and its role in breast cancer management. Front. Oncol. 2020, 10, 301. [Google Scholar] [CrossRef] [Green Version]
- Couch, F.J.; Shimelis, H.; Hu, C.; Hart, S.N.; Polley, E.C.; Na, J.; Hallberg, E.; Moore, R.; Thomas, A.; Lilyquist, J. Associations between cancer predisposition testing panel genes and breast cancer. JAMA Oncol. 2017, 3, 1190–1196. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cybulski, C.; Kluźniak, W.; Huzarski, T.; Wokołorczyk, D.; Kashyap, A.; Jakubowska, A.; Szwiec, M.; Byrski, T.; Dębniak, T.; Górski, B. Clinical outcomes in women with breast cancer and a PALB2 mutation: A prospective cohort analysis. Lancet Oncol. 2015, 16, 638–644. [Google Scholar] [CrossRef] [PubMed]
- Antoniou, A.C.; Casadei, S.; Heikkinen, T.; Barrowdale, D.; Pylkäs, K.; Roberts, J.; Lee, A.; Subramanian, D.; De Leeneer, K.; Fostira, F. Breast-cancer risk in families with mutations in PALB2. N. Engl. J. Med. 2014, 371, 497–506. [Google Scholar] [CrossRef] [Green Version]
- Castéra, L.; Harter, V.; Muller, E.; Krieger, S.; Goardon, N.; Ricou, A.; Rousselin, A.; Paimparay, G.; Legros, A.; Bruet, O. Landscape of pathogenic variations in a panel of 34 genes and cancer risk estimation from 5131 HBOC families. Genet. Med. 2018, 20, 1677–1686. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heikkinen, T.; Kärkkäinen, H.; Aaltonen, K.; Milne, R.L.; Heikkilä, P.; Aittomäki, K.; Blomqvist, C.; Nevanlinna, H. The breast cancer susceptibility mutation PALB2 1592delT is associated with an aggressive tumor phenotype. Clin. Cancer Res. 2009, 15, 3214–3222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reiss, K.A.; Yu, S.; Judy, R.; Symecko, H.; Nathanson, K.L.; Domchek, S.M. Retrospective survival analysis of patients with advanced pancreatic ductal adenocarcinoma and germline BRCA or PALB2 mutations. JCO Precis. Oncol. 2018, 2, 1–9. [Google Scholar] [CrossRef]
- Kuemmel, S.; Harrach, H.; Schmutzler, R.K.; Kostara, A.; Ziegler-Löhr, K.; Dyson, M.H.; Chiari, O.; Reinisch, M. Olaparib for metastatic breast cancer in a patient with a germline PALB2 variant. NPJ Breast Cancer 2020, 6, 1–4. [Google Scholar] [CrossRef]
- Robson, M.; Im, S.-A.; Senkus, E.; Xu, B.; Domchek, S.M.; Masuda, N.; Delaloge, S.; Li, W.; Tung, N.; Armstrong, A. Olaparib for metastatic breast cancer in patients with a germline BRCA mutation. N. Engl. J. Med. 2017, 377, 523–533. [Google Scholar] [CrossRef]
- Robson, M.; Tung, N.; Conte, P.; Im, S.-A.; Senkus, E.; Xu, B.; Masuda, N.; Delaloge, S.; Li, W.; Armstrong, A. OlympiAD final overall survival and tolerability results: Olaparib versus chemotherapy treatment of physician’s choice in patients with a germline BRCA mutation and HER2-negative metastatic breast cancer. Ann. Oncol. 2019, 30, 558–566. [Google Scholar] [CrossRef]
- Lacle, M.M.; Kornegoor, R.; Moelans, C.B.; Maes-Verschuur, A.H.; Van Der Pol, C.; Witkamp, A.J.; Van Der Wall, E.; Rueschoff, J.; Buerger, H.; Van Diest, P.J. Analysis of copy number changes on chromosome 16q in male breast cancer by multiplex ligation-dependent probe amplification. Mod. Pathol. 2013, 26, 1461–1467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pan, W.; Lu, K.; Wang, W.; Yao, J.; Hou, Y. PALB2 as a potential prognostic biomarker for colorectal cancer. Comput. Biol. Chem. 2020, 87, 107289. [Google Scholar] [CrossRef]
- Li, J.; Li, M.; Chen, P.; Ba, Q. High expression of PALB2 predicts poor prognosis in patients with advanced breast cancer. FEBS Open Bio 2018, 8, 56–63. [Google Scholar] [CrossRef]
- Schwartz, G.F.; Hortobagyi, G.N. Proceedings of the consensus conference on neoadjuvant chemotherapy in carcinoma of the breast, April 26–28, 2003, Philadelphia, Pennsylvania. Breast J. 2004, 10, 273–294. [Google Scholar] [CrossRef]
- Plotkin, J.B.; Kudla, G. Synonymous but not the same: The causes and consequences of codon bias. Nat. Rev. Genet. 2011, 12, 32–42. [Google Scholar] [CrossRef] [Green Version]
- Duan, J.; Wainwright, M.S.; Comeron, J.M.; Saitou, N.; Sanders, A.R.; Gelernter, J.; Gejman, P.V. Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum. Mol. Genet. 2003, 12, 205–216. [Google Scholar] [CrossRef]
- Löbrich, M.; Jeggo, P.A. The impact of a negligent G2/M checkpoint on genomic instability and cancer induction. Nat. Rev. Cancer 2007, 7, 861–869. [Google Scholar] [CrossRef] [PubMed]
- Tsyganov, M.M.; Ibragimova, M.K.; Garbukov, E.Y.; Bragina, O.D.; Karchevskaya, A.A.; Usynin, E.A.; Litvyakov, N.V. Determination of BRCAness Phenotype in Breast Tumors for the Appointment of Neoadjuvant Chemotherapy Based on Platinum and Taxanes. Int. J. Mol. Sci. 2022, 24, 207. [Google Scholar] [CrossRef]
- Pylkäs, K.; Erkko, H.; Nikkilä, J.; Sólyom, S.; Winqvist, R. Analysis of large deletions in BRCA1, BRCA2 and PALB2 genes in Finnish breast and ovarian cancer families. BMC Cancer 2008, 8, 146. [Google Scholar] [CrossRef] [Green Version]
- Yazıcı, H.; Kılıç, S.; Akdeniz, D.; Şükrüoğlu, Ö.; Tuncer, Ş.B.; Avşar, M.; Kuru, G.; Çelik, B.; Küçücük, S.; Saip, P. Frequency of rearrangements versus small indels mutations in BRCA1 and BRCA2 genes in Turkish patients with high risk breast and ovarian cancer. Eur. J. Breast Health 2018, 14, 93–99. [Google Scholar]
- Tyulyandina, A.; Kekeeva, T.; Gorbunova, V.; Kolomiets, L.; Statsenko, G.; Saevets, V.; Khokhlova, S.V.; Tkachenko, S.; Koroleva, I.; Lisyanskaya, A.S. Non-interventional study OVATAR final report: Diagnostic and treatment approaches in Russian ovarian cancer population—BRCAm group analysis. J. Clin. Oncol. 2019, 15, e13111. [Google Scholar] [CrossRef]
- Han, S.-A.; Kim, S.-W.; Kang, E.; Park, S.K.; Ahn, S.-H.; Lee, M.H.; Nam, S.-J.; Han, W.; Bae, Y.T.; Kim, H.-A. The prevalence of BRCA mutations among familial breast cancer patients in Korea: Results of the Korean Hereditary Breast Cancer study. Fam. Cancer 2013, 12, 75–81. [Google Scholar] [CrossRef] [PubMed]
- Simhadri, S.; Vincelli, G.; Huo, Y.; Misenko, S.; Foo, T.K.; Ahlskog, J.; Sørensen, C.S.; Oakley, G.G.; Ganesan, S.; Bunting, S.F. PALB2 connects BRCA1 and BRCA2 in the G2/M checkpoint response. Oncogene 2019, 38, 1585–1596. [Google Scholar] [CrossRef]
- Sy, S.M.; Huen, M.S.; Chen, J. PALB2 is an integral component of the BRCA complex required for homologous recombination repair. Proc. Natl. Acad. Sci. USA 2009, 106, 7155–7160. [Google Scholar] [CrossRef] [PubMed]
- Elsakov, P.; Kurtinaitis, J.; Petraitis, S.; Ostapenko, V.; Razumas, M.; Razumas, T.; Meskauskas, R.; Petrulis, K.; Luksite, A.; Lubiński, J. The contribution of founder mutations in BRCA1 to breast and ovarian cancer in Lithuania. Clin. Genet. 2010, 78, 373–376. [Google Scholar] [CrossRef]
- Caramelo, O.; Silva, C.; Caramelo, F.; Frutuoso, C.; Almeida-Santos, T. The effect of neoadjuvant platinum-based chemotherapy in BRCA mutated triple negative breast cancers-systematic review and meta-analysis. Hered. Cancer Clin. Pract. 2019, 17, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.-J.; Xu, Y.; Lin, Y.; Zhu, H.-J.; Zhou, Y.-D.; Mao, F.; Zhang, X.-H.; Huang, X.; Zhong, Y.; Sun, Q. Platinum-based Neoadjuvant chemotherapy for breast Cancer with BRCA mutations: A meta-analysis. Front. Oncol. 2020, 10, 592998. [Google Scholar] [CrossRef]
- Gervas, P.; Klyuch, B.; Denisov, E.; Kiselev, A.; Molokov, A.; Pisareva, L.; Malinovskaya, E.; Choynzonov, E.; Cherdyntseva, N. New germline BRCA2 gene variant in the Tuvinian Mongol breast cancer patients. Mol. Biol. Rep. 2019, 46, 5537–5541. [Google Scholar] [CrossRef]
- Nguyen-Dumont, T.; MacInnis, R.J.; Steen, J.A.; Theys, D.; Tsimiklis, H.; Hammet, F.; Mahmoodi, M.; Pope, B.J.; Park, D.J.; Mahmood, K. Rare germline genetic variants and risk of aggressive prostate cancer. Int. J. Cancer 2020, 147, 2142–2149. [Google Scholar] [CrossRef]
- Yao, J.; Zhen, Y.; Fan, J.; Gong, Y.; Ye, Y.; Guo, S.; Liu, H.; Li, X.; Li, G.; Yang, P. Comprehensive characterization of CRC with germline mutations reveals a distinct somatic mutational landscape and elevated cancer risk in the Chinese population. Cancer Biol. Med. 2022, 19, 707. [Google Scholar] [CrossRef]
- Talens, F.; Teixeira, V.O.; Rosenberg, E.H.; Nederlof, P.M.; Debipersad, R.D.; Janatova, M.; Zemankova, P.; Kleibl, Z.; Duiker, E.W.; Wisman, G.B.A. Functional RAD51 based assay predicts in vivo PARP inhibitor response in ovarian cancer models beyond BRCA. Homol. Recomb. -Defic. Cancers Approaches Improv. Treat. Patient Sel. 2020, 1, 167–185. [Google Scholar]
- Southey, M.C.; Teo, Z.L.; Winship, I. PALB2 and breast cancer: Ready for clinical translation! Appl. Clin. Genet. 2013, 6, 43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dansonka-Mieszkowska, A.; Kluska, A.; Moes, J.; Dabrowska, M.; Nowakowska, D.; Niwinska, A.; Derlatka, P.; Cendrowski, K.; Kupryjanczyk, J. A novel germline PALB2 deletion in Polish breast and ovarian cancer patients. BMC Med. Genet. 2010, 11, 20. [Google Scholar] [CrossRef] [Green Version]
- Foulkes, W.D.; Ghadirian, P.; Akbari, M.R.; Hamel, N.; Giroux, S.; Sabbaghian, N.; Darnel, A.; Royer, R.; Poll, A.; Fafard, E. Identification of a novel truncating PALB2 mutation and analysis of its contribution to early-onset breast cancer in French-Canadian women. Breast Cancer Res. 2007, 9, R83. [Google Scholar] [CrossRef]
- Erkko, H.; Xia, B.; Nikkilä, J.; Schleutker, J.; Syrjäkoski, K.; Mannermaa, A.; Kallioniemi, A.; Pylkäs, K.; Karppinen, S.-M.; Rapakko, K. A recurrent mutation in PALB2 in Finnish cancer families. Nature 2007, 446, 316–319. [Google Scholar] [CrossRef] [PubMed]
- Teo, Z.L.; Sawyer, S.D.; James, P.A.; Mitchell, G.; Trainer, A.H.; Lindeman, G.J.; Shackleton, K.; Cicciarelli, L.; Southey, M.C. The incidence of PALB2 c. 3113G> A in women with a strong family history of breast and ovarian cancer attending familial cancer centres in Australia. Fam. Cancer 2013, 12, 587–595. [Google Scholar] [CrossRef]
- Teo, Z.L.; Park, D.J.; Provenzano, E.; Chatfield, C.A.; Odefrey, F.A.; Nguyen-Dumont, T.; Dowty, J.G.; Hopper, J.L.; Winship, I.; Goldgar, D.E. Prevalence of PALB2 mutations in Australasian multiple-case breast cancer families. Breast Cancer Res. 2013, 15, R17. [Google Scholar] [CrossRef]
- Xia, B.; Sheng, Q.; Nakanishi, K.; Ohashi, A.; Wu, J.; Christ, N.; Liu, X.; Jasin, M.; Couch, F.J.; Livingston, D.M. Control of BRCA2 cellular and clinical functions by a nuclear partner, PALB2. Mol. Cell 2006, 22, 719–729. [Google Scholar] [CrossRef]
- Villarroel, M.C.; Rajeshkumar, N.; Garrido-Laguna, I.; De Jesus-Acosta, A.; Jones, S.; Maitra, A.; Hruban, R.H.; Eshleman, J.R.; Klein, A.; Laheru, D. Personalizing cancer treatment in the age of global genomic analyses: PALB2 gene mutations and the response to DNA damaging agents in pancreatic cancer. Mol. Cancer Ther. 2011, 10, 3–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bleuyard, J.-Y.; Butler, R.M.; Esashi, F. Perturbation of PALB2 function by the T413S mutation found in small cell lung cancer. Wellcome Open Res. 2017, 2, 110. [Google Scholar] [CrossRef] [Green Version]
- Karachaliou, N.; Bracht, J.W.P.; Bruno, M.F.; Drozdowskyj, A.; Capitan, A.G.; Moran, T.; Carcereny, E.; Cobo, M.; Domine, M.; Chaib, I. Association of PALB2 messenger RNA expression with platinum-docetaxel efficacy in advanced non–small cell lung cancer. J. Thorac. Oncol. 2019, 14, 304–310. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Padella, A.; Marconi, G.; Simonetti, G.; Di Rora, A.G.L.; Fontana, M.C.; Papayannidis, C.; Ottaviani, E.; Cavo, M.; Soverini, S.; Martinelli, G. Higher Expression of PALB2 Predict Poor Prognosis in AML Patients and Identifies Potential Targets of Synthetic Lethal Therapies. Blood 2018, 132, 1507. [Google Scholar] [CrossRef]
- Nykamp, K.; Anderson, M.; Powers, M.; Garcia, J.; Herrera, B.; Ho, Y.-Y.; Kobayashi, Y.; Patil, N.; Thusberg, J.; Westbrook, M. Sherloc: A comprehensive refinement of the ACMG–AMP variant classification criteria. Genet. Med. 2017, 19, 1105–1117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- García, M.J.; Fernández, V.; Osorio, A.; Barroso, A.; LLort, G.; Lázaro, C.; Blanco, I.; Caldés, T.; De la Hoya, M.; y Cajal, T.R. Analysis of FANCB and FANCN/PALB2 fanconi anemia genes in BRCA1/2-negative Spanish breast cancer families. Breast Cancer Res. Treat. 2009, 113, 545–551. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cao, A.-Y.; Huang, J.; Hu, Z.; Li, W.-F.; Ma, Z.-L.; Tang, L.-L.; Zhang, B.; Su, F.-X.; Zhou, J.; Di, G.-H. The prevalence of PALB2 germline mutations in BRCA1/BRCA2 negative Chinese women with early onset breast cancer or affected relatives. Breast Cancer Res. Treat. 2009, 114, 457–462. [Google Scholar] [CrossRef] [PubMed]
- Blanco, A.; de la Hoya, M.; Balmaña, J.; y Cajal, T.R.; Teulé, A.; Miramar, M.-D.; Esteban, E.; Infante, M.; Benítez, J.; Torres, A. Detection of a large rearrangement in PALB2 in Spanish breast cancer families with male breast cancer. Breast Cancer Res. Treat. 2012, 132, 307–315. [Google Scholar] [CrossRef] [Green Version]
- Thompson, E.R.; Gorringe, K.L.; Rowley, S.M.; Wong-Brown, M.W.; McInerny, S.; Li, N.; Trainer, A.H.; Devereux, L.; Doyle, M.A.; Li, J. Prevalence of PALB2 mutations in Australian familial breast cancer cases and controls. Breast Cancer Res. 2015, 17, 111. [Google Scholar] [CrossRef]
- Maxwell, K.N.; Hart, S.N.; Vijai, J.; Schrader, K.A.; Slavin, T.P.; Thomas, T.; Wubbenhorst, B.; Ravichandran, V.; Moore, R.M.; Hu, C. Evaluation of ACMG-guideline-based variant classification of cancer susceptibility and non-cancer-associated genes in families affected by breast cancer. Am. J. Hum. Genet. 2016, 98, 801–817. [Google Scholar] [CrossRef] [Green Version]
- Bergstrom, C.; Pence, C.; Berg, J.; Partain, N.; Sadeghi, N.; Mauer, C.; Pirzadeh-Miller, S.; Gao, A.; Li, H.; Unni, N. Clinicopathological features and outcomes in individuals with breast cancer and ATM, CHEK2, or PALB2 Mutations. Ann. Surg. Oncol. 2021, 28, 3383–3393. [Google Scholar] [CrossRef]
Figure 1.
Association of chromosomal aberrations of the BRCA1, BRCA2, and PALB2 genes with metastatic-free survival. Note: Gain—amplification, Loss—deletion, n—normal copy number.
Figure 1.
Association of chromosomal aberrations of the BRCA1, BRCA2, and PALB2 genes with metastatic-free survival. Note: Gain—amplification, Loss—deletion, n—normal copy number.
Figure 2.
Association of the presence of cumulative chromosomal aberrations of the BRCA1, BRCA2, and PALB2 genes with the effectiveness of neoadjuvant chemotherapy. Note: CR—complete regression; PR—partial regression; ST—stabilization; P—progression.
Figure 2.
Association of the presence of cumulative chromosomal aberrations of the BRCA1, BRCA2, and PALB2 genes with the effectiveness of neoadjuvant chemotherapy. Note: CR—complete regression; PR—partial regression; ST—stabilization; P—progression.
Figure 3.
Response to neoadjuvant chemotherapy, depending on the presence of BRCA1 gene mutations in tumor biopsy material in patients with breast cancer. Note: CR—complete regression; PR—partial regression; ST—stabilization; P—progression.
Figure 3.
Response to neoadjuvant chemotherapy, depending on the presence of BRCA1 gene mutations in tumor biopsy material in patients with breast cancer. Note: CR—complete regression; PR—partial regression; ST—stabilization; P—progression.
Figure 4.
Response to neoadjuvant chemotherapy (A) and metastatic survival rates (B), depending on the presence of pathogenetically significant mutations in the BRCA2 gene in tumor biopsy material in patients with breast cancer. Note: CR—complete regression; PR—partial regression; ST—stabilization; P—progression.
Figure 4.
Response to neoadjuvant chemotherapy (A) and metastatic survival rates (B), depending on the presence of pathogenetically significant mutations in the BRCA2 gene in tumor biopsy material in patients with breast cancer. Note: CR—complete regression; PR—partial regression; ST—stabilization; P—progression.
Figure 5.
Association of the presence of PALB2 gene mutations before treatment with the effectiveness of NAC. Note: CR—complete regression; PR—partial regression; ST—stabilization; P—progression.
Figure 5.
Association of the presence of PALB2 gene mutations before treatment with the effectiveness of NAC. Note: CR—complete regression; PR—partial regression; ST—stabilization; P—progression.
Figure 6.
Curves of non-metastatic survival of patients with breast cancer, in accordance with the presence of BRCA1 gene mutations during NAC (A) and in the surgical material (B), for the BRCA2 gene (C,D) and for the PALB2 gene (E,F).
Figure 6.
Curves of non-metastatic survival of patients with breast cancer, in accordance with the presence of BRCA1 gene mutations during NAC (A) and in the surgical material (B), for the BRCA2 gene (C,D) and for the PALB2 gene (E,F).
Table 1.
Clinical and pathological parameters of breast cancer patients.
| Clinical and Pathological Parameter | Number of Patients, abs. (%) | |
|---|---|---|
| Age | ≤45 | 31 (47.0) |
| >45 | 35 (53.0) | |
| Menstrual status | Perimenopause | 35 (53.0) |
| Postmenopause | 31 (47.0) | |
| Histological type | Invasive ductal cancer | 45 (68.2) |
| Invasive lobular carcinoma | 21 (31.8) | |
| Size | T1 | 7 (10.6) |
| T2 | 53 (80.4) | |
| T3 | 3 (4.5) | |
| T4 | 3 (4.5) | |
| Lymphogenous metastasis | N0 | 25 (37.9) |
| N1 | 31 (47.0) | |
| N2 | 7 (10.6) | |
| N3 | 3 (4.5) | |
| Histological form | Unicentric | 31 (47.0) |
| Multicentric | 35 (53.0) | |
| Molecular subtype | Luminal B HER2-negative | 51 (77.3) |
| HER2+ | 5 (7.6) | |
| Triple-negative | 10 (15.2) | |
| NAC scheme | CAX | 11 (16.7) |
| AC | 12 (18.2) | |
| Taxotere | 21 (31.8) | |
| AT/ACT | 8 (12.1) | |
| CP | 14 (21.2) | |
| NAC effect | Complete regression | 8 (12.1) |
| Partial regression | 39 (59.1) | |
| Stabilization | 14 (21.2) | |
| Progression | 5 (7.6) | |
Note: TNM classification: T—tumor; N—nodulus; NAC—neoadjuvant chemotherapy; CAX—cyclophosphamide/adriamycin/xeloda; AC—adriamycin/cyclophosphamide; AT—adriamycin/Taxoter; ACT—adriamycin/cyclophosphamide/Taxoter; CP—cyclophosphamide/cisplatin.
Table 2.
Association of the presence of chromosomal aberrations in the BRCA1, BRCA2, and PALB2 genes with the effectiveness of neoadjuvant chemotherapy.
Table 2.
Association of the presence of chromosomal aberrations in the BRCA1, BRCA2, and PALB2 genes with the effectiveness of neoadjuvant chemotherapy.
| Gene/CNA | BRCA1 | BRCA2 | PALB2 | |||
|---|---|---|---|---|---|---|
| Effect of NAC/Scheme of NAC | ||||||
| All Patients (abs. Number, %) | ||||||
| CR + PR | ST + P | CR + PR | ST + P | CR + PR | ST + P | |
| Gain | 11 (23.4) | 5 (26.3) | 1 (2.1) | 1 (5.3) | 15 (31.9) | 3 (15.8) |
| Loss | 21 (44.7) | 4 (21.1) | 15 (31.9) | 9 (47.4) | 12 (25.5) | 2 (10.5) |
| n | 15 (31.9) | 10 (52.6) | 31 (66) | 9 (47.4) | 20 (42.6) | 14 (73.7) |
| p-level | 0.16 | 0.19 | 0.07 | |||
| CAX (abs. number, %) | ||||||
| Gain | 3 (42.9) | 3 (75.0) | 0 (0) | 1 (25.0) | 2 (28.6) | 1 (25.0) |
| Loss | 2 (28.6) | 0 (0) | 4 (57.1) | 3 (75.0) | 2 (28.6) | 0 (0) |
| n | 2 (28.6) | 1 (25.0) | 3 (42.9) | 0 (0) | 3 (42.9) | 3 (75.0) |
| p-level | 0.44 | 0.16 | 0.44 | |||
| AC (abs. number, %) | ||||||
| Gain | 1 (11.1) | 1 (33.3) | 1 (11.1) | 0 (0) | 3 (33.3) | 2 (66.7) |
| Loss | 2 (22.2) | 0 (0) | 3 (33.3) | 1 (33.3) | 3 (33.3) | 0 (0) |
| n | 6 (66.7) | 2 (66.7) | 5 (55.6) | 2 (66.7) | 3 (33.3) | 1 (33.3) |
| p-level | 0.51 | 0.82 | 0.44 | |||
| Taxotere/AT/ACT (abs. number, %) | ||||||
| Gain | 6 (30.0) | 1 (11.1) | 0 (0) | 0 (0) | 8 (40.0) | 0 (0) |
| Loss | 7 (35.0) | 3 (33.3) | 4 (20.0) | 4 (44.4) | 3 (15.0) | 1 (11.1) |
| n | 7 (35.0) | 5 (55.6) | 16 (80.0) | 5 (55.6) | 9 (45.0) | 8 (88.9) |
| p-level | 0.45 | 0.39 | 0.05 | |||
| CP (abs. number, %) | ||||||
| Gain | 1 (9.1) | 0 (0) | 0 (0) | 0 (0) | 2 (18.2) | 0 (0) |
| Loss | 10 (90.9) | 1 (33.3) | 4 (36.4) | 1 (33.3) | 4 (36.4) | 1 (33.3) |
| n | 0 (0) | 2 (66.7) | 7 (63.6) | 2 (66.7) | 5 (45.5) | 2 (66.7) |
| p-level | 0.04 | 0.99 | 0.36 | |||
Note: CR—complete regression; PR—partial regression; ST—stabilization; P—progression. Abs. number—absolute number. CR + PR—a group of patients with response to neoadjuvant chemotherapy; ST + P—a group of patients without response to neoadjuvant chemotherapy. Gain—amplification, Loss—deletion, n—normal copy number. Statistically significant differences are highlighted in bold.
Table 3.
Mutations of the BRCA1 gene in breast tumors.
| № | Mutation | rs | Class | Type |
|---|---|---|---|---|
| 1 | c.1067A>G (p.Gln356Arg) | rs1799950 | Non-synonymous SNV | VUS |
| 2 | c.1114A>C (p.Asn372His) | rs144848 | Non-synonymous SNV | Little Clinical Significance |
| 3 | c.2077G>A (p.Asp693Asn) | rs4986850 | Non-synonymous SNV | Benign |
| 4 | c.2082C>T (p.Ser694=) | rs1799949 | Synonymous SNV | Benign |
| 5 | c.2311T>C (p.Leu771=) | rs16940 | Synonymous SNV | Benign |
| 6 | c.2470_2471insTTCCGATCTTAGTCC (p.Pro 824delinsLPILVP) | - | Non-frameshift insertion | VUS |
| 7 | c.2608G>A (p.Ala870Thr) | rs753256448 | Non-synonymous SNV | VUS |
| 8 | c.2609C>G (p.Ala870Gly) | rs1060502324 | Non-synonymous SNV | VUS |
| 9 | c.2612_2613insT (p.Phe872fs) | rs80357948 | Frameshift insertion | Pathogenic |
| 10 | c.2612C>T (p.Pro871Leu) | rs799917 | Non-synonymous SNV | Benign |
| 11 | c.3113A>G (p.Glu1038Gly) | rs16941 | Non-synonymous SNV | Benign |
| 12 | c.3396A>G (p.Lys1132=) | rs1801406 | Synonymous SNV | Little Clinical Significance |
| 13 | c.3548A>G (p.Lys1183Arg) | rs16942 | Non-synonymous SNV | Benign |
| 14 | c.4035delA (p.Glu1345fs) | rs80357711 | Frameshift deletion | Pathogenic |
| 15 | c.4308T>C (p.Ser1436=) | rs1060915 | Synonymous SNV | Benign |
| 16 | c.4563A>G (p.Leu1521=) | rs206075 | Synonymous SNV | Benign |
| 17 | c.4807_4821del (p.Pro1603_Val1607del) | rs80359888 | Non-frameshift deletion | VUS |
| 18 | c.4837A>G (p.Ser1613Gly) | rs1799966 | Non-synonymous SNV | Benign |
| 19 | c.4900A>G (p.Ser1634Gly) | rs1799966 | Non-synonymous SNV | Benign |
| 20 | c.4946T>C (p.Met1649Thr) | rs4986854 | Non-synonymous SNV | Benign |
| 21 | c.5019G>A (p.Met1673Ile) | rs1799967 | Non-synonymous SNV | Benign |
| 22 | c.5329dupC (p.Gln1777fs) | rs397507247, rs397507246, rs431825413; rs80357906 | Frameshift duplication | Pathogenic |
| 23 | c.6513G>C (p.Val2171=) | rs206076 | Synonymous SNV | Benign |
| 24 | c.7242A>G (p.Ser2414=) | rs1799955 | Synonymous SNV | Little Clinical Significance |
| 25 | c.999T>C (p.Ser333=) | - | Synonymous SNV | Benign |
Note: VUS—variants of uncertain significance.
Table 4.
Mutations of the BRCA2 gene in breast tumors.
| № | Mutation | rs | Class | Type |
|---|---|---|---|---|
| 1 | c.10076A>G (p.Glu3359Gly) | rs80358389 | Non-synonymous SNV | VUS |
| 2 | c.10234A>G (p.Ile3412Val) | rs1801426 | Non-synonymous SNV | Benign |
| 3 | c.1114A>C (p.Asn372His) | rs144848 | Non-synonymous SNV | Little Clinical Significance |
| 4 | c.125A>G (p.Tyr42Cys) | rs4987046 | Non-synonymous SNV | Benign |
| 5 | c.1295A>T (p.Glu432Val) | - | Non-synonymous SNV | VUS |
| 6 | c.1305A>G (p.Arg435=) | - | Synonymous SNV | VUS |
| 7 | c.1309_1310insAAATC | - | Frameshift insertion | VUS |
| 8 | c.1365A>G (p.Ser455=) | rs1801439 | Synonymous SNV | Benign |
| 9 | c.1514T>C (p.Ile505Thr) | rs28897708 | Non-synonymous SNV | Benign |
| 10 | c.2229T>C (p.His743=) | rs1801499 | Synonymous | Benign |
| 11 | c.-26G>A | rs1799943 | 5 prime UTR | VUS |
| 12 | c.2971A>G (p.Asn991Asp) | rs1799944 | Non-synonymous SNV | Benign |
| 13 | c.3396A>G (p.Lys1132=) | rs1801406 | Synonymous SNV | Little Clinical Significance |
| 14 | c.3807T>C (p.Val1269=) | rs543304 | Synonymous SNV | Likely Benign |
| 15 | c.3823_3824insAGCAGTTCC (p.Ile1275delinsKQFL) | - | Frameshift insertion | VUS |
| 16 | c.3824_3825del p.(Ile1275ArgfsTer4) | - | Frameshift deletion | Pathogenic |
| 17 | c.3824delT (p.Ile 1275fs) | - | Frameshift deletion | VUS |
| 18 | c.4068G>A (p.Leu1356=) | rs28897724 | Synonymous SNV | Benign |
| 19 | c.4258G>T (p.Asp1420Tyr) | rs28897727 | Non-synonymous SNV | Benign |
| 20 | c.4288_4289insGGAACTGAGT (p.Thr1430_1431Ala_delinsRNX) | - | Stop-gain | VUS |
| 21 | c.4563A>G (p.Leu1521=) | rs206075 | Synonymous SNV | Benign |
| 22 | c.5455C>T (p.Pro1819Ser) | rs80358768 | Non-synonymous SNV | Benign |
| 23 | c.5744C>T (p.Thr1915Met) | rs4987117 | Non-synonymous SNV | Benign |
| 24 | c.590C>G (p.Ser197Cys) | rs876659940 | Non-synonymous SNV | VUS |
| 25 | c.6513G>C (p.Val2171=) | rs206076 | Synonymous SNV | Benign |
| 26 | c.6577G>C (p.Glu2193Gln) | - | Non-synonymous SNV | VUS |
| 27 | c.7108_7109insCAT (p.K2370delinsTX) | - | Stop-gain | VUS |
| 28 | c.7110_7111insATATGTGGG (p.Lys2370delinsKICG) | - | Non-frameshift insertion | VUS |
| 29 | c.7242A>G (p.Ser2414=) | rs1799955 | Synonymous SNV | Little Clinical Significance |
| 30 | c.7397T>C (p.Val2466Ala) | rs169547 | Non-synonymous SNV | Benign |
| 31 | c.7544C>T (p.Thr2515Ile) | rs28897744 | Non-synonymous SNV | Benign |
| 32 | c.8208_8209insAG (p.Leu2737fs) | rs483353122 | Frameshift insertion | Pathogenic |
| 33 | c.865A>C (p.Asn289His) | rs766173 | Non-synonymous SNV | Benign |
| 34 | c.8673_8674delAA (p.Thr2891fs) | rs80359724 | Frameshift deletion | Pathogenic |
| 35 | c.8878C>G (p.Gln2960Glu) | - | Non-synonymous SNV | VUS |
| 36 | c.8878C>T p.(Gln2960Ter) | - | Non-synonymous SNV | Pathogenic |
| 37 | c.8881_8884del (p.Gly2961fs) | - | Frameshift deletion | VUS |
| 38 | c.8885T>A | - | Stop-gain | VUS |
| 39 | c.9038C>T (p.Thr3013Ile) | rs28897755 | Non-synonymous SNV | Benign |
| 40 | c.9090delA (p.T3030fs) | rs397507420 | Frameshift deletion | Pathogenic |
| 41 | c.9090dupA (p.Thr3030fs) | - | Frameshift duplication | VUS |
| 42 | c.9976A>T (p.Lys3326*) | rs11571833 | Stop-gain | Benign |
Note: VUS—variants of uncertain significance.
Table 5.
Mutations of the PALB2 gene in breast tumors.
| № | Mutation | rs | Class | Type |
|---|---|---|---|---|
| 1 | c.1010T>C (p.Leu337Ser) | rs45494092 | Non-synonymous SNV | Benign |
| 2 | c.1288delC (p.Gln467fs) | - | Frameshift deletion | VUS |
| 3 | c.1675_1676insGAGTGAAAGGTAA ATCAAGATGTGTGCTCTTCCGACTCC (p.Q559delinsRVKGKSRCVLFRLQ) | - | Non-frameshift insertion | VUS |
| 4 | c.1676A>G (p.Gln559Arg) | rs152451 | Non-synonymous SNV | Benign |
| 5 | c.1686delG (p.Gly562fs) | - | Frameshift deletion | Pathogenic |
| 6 | c.1693delA (p.Ser565fs) | - | Frameshift deletion | VUS |
| 7 | c.1706_1707del (p.Lys569fs) | rs1060502759 | Frameshift deletion | Pathogenic |
| 8 | c.1706delA (p.Lys569fs) | - | Frameshift deletion | VUS |
| 9 | c.2014G>C (p.Glu672Gln) | rs45532440 | Non-synonymous SNV | Benign |
| 10 | c.212-58A>C | rs80291632 | Intronic | Benign |
| 11 | c.2552delA (p.Asn851fs) | - | Frameshift deletion | VUS |
| 12 | c.255dupA (p.Thr86fs) | - | Frameshift duplication | VUS |
| 13 | c.256delA (p.Thr86fs) | - | Frameshift deletion | VUS |
| 14 | c.2586+58C>T | rs249954 | Intronic | Benign |
| 15 | c.2587-38C>T | rs180177119 | Intronic | Likely benign |
| 16 | c.2993G>A (p.Gly998Glu) | rs45551636 | Non-synonymous SNV | Benign |
| 17 | c.3114-51T>A | rs249936 | Intronic | Benign |
| 18 | c.3300T>G (p.Thr1100=) | rs45516100 | Synonymous SNV | Benign |
| 19 | c.3351-53delT | rs35294437 | Intronic | VUS |
| 20 | c.3465dupT (p. Asp1156 Gln1157delinsX) | - | Stop-gain | VUS |
| 21 | c.747T>A (p.Pro249=) | - | Synonymous SNV | VUS |
| 22 | c.833T>A (p.Leu278Gln) | rs200843485 | Non-synonymous SNV | VUS |
| 23 | c.834A>T (p.Leu278=) | rs199919863 | Synonymous SNV | Likely benign |
| 24 | c.92_94del (p.31_32del) | - | Non-frameshift deletion | VUS |
| 25 | c.921delA (p. Lys307fs) | rs202151522 | Frameshift deletion | VUS |
| 26 | c.94C>G (p.Leu32Val) | rs151316635 | Non-synonymous SNV | Conflicting interpretations of pathogenicity |
| 27 | c.95_96insCGGAAG (p.Leu32 delinsLGR) | - | Non-frameshift insertion | VUS |
Note: VUS—variants of uncertain significance.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Tsyganov, M.M.; Sorokovikova, S.S.; Lutzkaya, E.A.; Ibragimova, M.K. Mutations of BRCA1, BRCA2, and PALB2 Genes in Breast Tumor Tissue: Relationship with the Effectiveness of Neoadjuvant Chemotherapy and Disease Prognosis. Genes 2023, 14, 1554. https://doi.org/10.3390/genes14081554
AMA Style
Tsyganov MM, Sorokovikova SS, Lutzkaya EA, Ibragimova MK. Mutations of BRCA1, BRCA2, and PALB2 Genes in Breast Tumor Tissue: Relationship with the Effectiveness of Neoadjuvant Chemotherapy and Disease Prognosis. Genes. 2023; 14(8):1554. https://doi.org/10.3390/genes14081554
Chicago/Turabian StyleTsyganov, Matvey M., Sofia S. Sorokovikova, Elizaveta A. Lutzkaya, and Marina K. Ibragimova. 2023. "Mutations of BRCA1, BRCA2, and PALB2 Genes in Breast Tumor Tissue: Relationship with the Effectiveness of Neoadjuvant Chemotherapy and Disease Prognosis" Genes 14, no. 8: 1554. https://doi.org/10.3390/genes14081554
APA StyleTsyganov, M. M., Sorokovikova, S. S., Lutzkaya, E. A., & Ibragimova, M. K. (2023). Mutations of BRCA1, BRCA2, and PALB2 Genes in Breast Tumor Tissue: Relationship with the Effectiveness of Neoadjuvant Chemotherapy and Disease Prognosis. Genes, 14(8), 1554. https://doi.org/10.3390/genes14081554
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
