Research on Genotype Markers for Plant Height and Assisted Breeding of Key Sorghum Resources in China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Selection of Materials
2.2. Plant Height Genetic Detection Methods
2.3. Phenotypic Verification Methods
2.4. Data Analysis Methods
3. Results
3.1. Detection of Three Plant Height Genes in Main Sorghum Breeding Materials
3.1.1. Detection of dw1 Gene
3.1.2. Detection of dw2 Gene
3.1.3. Detection of dw3 Gene
3.1.4. Detection of dw4 Gene
3.2. Plant Height Gene Types of Main Breeding Materials
3.2.1. “Three-Dwarf” Type
3.2.2. “Two-Dwarf” Type
3.2.3. “One-Dwarf” Type
3.3. Plant Height Genotype and Subfamily Analysis of Main Breeding Materials
3.4. Analysis of the Distribution and Regulation of Plant Height Genes
3.5. Verification Analysis of the Main Plant Height Gene
3.6. Validation Analysis of Sorghum Hybrid Combinations
4. Discussion
4.1. Enhancement of Plant Height Genotype Classification in Sorghum Breeding Materials
4.2. Primary Mechanisms of Gene Regulation in Sorghum Strains
4.3. Additional Genes Influencing Plant Height in Sorghum
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Swigoňová, Z.; Lai, J.; Ma, J.; Ramakrishna, W.; Llaca, V.; Bennetzen, J.L.; Messing, J. Close split of sorghum and maize genome progenitors. Genome Res. 2004, 14, 1916–1923. [Google Scholar] [CrossRef]
- Quinby, J.R. Sorghum Improvement and the Genetics of Growth; Texas A&M University Press: College Station, TX, USA, 1974. [Google Scholar]
- Liang, T.T.; Bi, N. Scientific research road in the sorghum field-Chinese famous sorghum breeder cattle paradise. Seed Technol. 2014, 32, 1–5. [Google Scholar]
- Lu, Q.S.; Sun, Y. Genetic Improvement of Hybrid Sorghum. China Agric. Sci. Technol. Press 2005, 21, 37–38. [Google Scholar]
- Multani, D.S.; Briggs, S.P.; Chamberlin, M.A.; Blakeslee, J.J.; Murphy, A.S.; Johal, G.S. Loss of an MDR transporter in compact stalks of maize br2 and sorghum dw3 mutants. Science 2003, 302, 81–84. [Google Scholar] [CrossRef]
- Karper, E.R.; Quinby, R.J. Sorghum-Its production, utilization and breeding. Econ. Bot. 1947, 1, 355–371. [Google Scholar] [CrossRef]
- Josie, H.; Sandra, T.; Sara, O.; Daryl, M.; John, M. Identification of Dw1, a Regulator of Sorghum Stem Internode Length. PLoS ONE 2016, 11, e0151271. [Google Scholar]
- Hilley, J.L.; Weers, B.D.; Truong, S.K.; McCormick, R.F.; Mattison, A.J.; McKinley, B.A.; Morishige, D.T.; Mullet, J.E. Sorghum Dw2 Encodes a Protein Kinase Regulator of Stem Internode Length. Sci. Rep. 2017, 7, 4616. [Google Scholar] [CrossRef]
- Miki, Y.; Haruka, F.; Ko, H.; Satoko, A.N.; Kozue, O.S.; Akihiro, F.; Masako, T.; Xian, J.S.; Yusuke, I.; Rie, N.; et al. Sorghum Dw1, an agronomically important gene for lodging resistance, encodes a novel protein involved in cell proliferation. Sci. Rep. 2016, 22, 28366. [Google Scholar]
- Klein, R.R.; Mullet, J.E.; Jordan, D.R.; Miller, F.R.; Rooney, W.L.; Menz, M.A.; Franks, C.D.; Klein, P.E. The effect of tropical sorghum conversion and inbred development on genome diversity as revealed by high resolution genotyping. Crop Sci. 2008, 48, 12–26. [Google Scholar] [CrossRef]
- Morishige, D.T.; Klein, P.E.; Hilley, J.L.; Sahraeian, S.M.E.; Sharma, A.; Mullet, J.E. Digital genotyping of sorghum-A diverse plant species with a large repeat-rich genome. BMC Genom. 2013, 14, 448. [Google Scholar] [CrossRef] [PubMed]
- Jiang, F.; Guo, M.; Yang, F.; Duncan, K.; Jackson, D.; Rafalski, A.; Wang, S.; Li, B. Mutations in an AP2 transcription factor-like gene affect internode length and leaf shape in maize. PLoS ONE 2012, 7, e37040. [Google Scholar] [CrossRef] [PubMed]
- Morris, G.P.; Ramu, P.; Deshpande, S.P.; Hashc, C.T.; Shahb, T.; Upadhyayab, H.D.; Riera-Lizarazub, O.; Brownd, P.J.; Acharyae, C.B.; Mitchelle, S.E.; et al. Population genomic and genome-wide association studies of agroclimatic traits in sorghum. Proc. Natl. Acad. Sci. USA 2013, 110, 453–458. [Google Scholar] [CrossRef] [PubMed]
- Quinby, J.R.; Karper, R.E. Inheritance of height in sorghum. Agron 1954, 46, 212–216. [Google Scholar]
- Harlan, J.R.; de Wet, J.M.J. A simplified classfication of cultivated sorghum. Crop Sci. 1972, 2, 172–176. [Google Scholar] [CrossRef]
- Vavilov, N.I. Sorghum Production and Utilization; AVI Publishing Company: New York, NY, USA; London, UK, 1951. [Google Scholar]
- Sasaki, A.; Ashikari, M.; Ueguchi-Tanaka, M.; Itoh, H.; Nishimura, A.; Swapan, D.; Ishiyama, K.; Saito, T.; Kobayashi, M.; Khush, G.S.; et al. Green revolution: A mutant gibberellin-synthesis gene in rice. Nature 2002, 416, 701–702. [Google Scholar] [CrossRef] [PubMed]
- Asano, K.; Yamasaki, M.; Takuno, S.; Miuraa, K.; Katagirid, S.; Itod, T.; Doie, K.; Wuf, J.; Ebanag, K.; Matsumotof, T.; et al. Artificial selection for a green revolution gene during japonica rice domestication. Proc. Natl. Acad. Sci. USA 2011, 108, 11034–11039. [Google Scholar] [CrossRef] [PubMed]
- Brooking, I.R.; Kirby, E.J.M. Interrelationships between stem and ear development in winter wheat: The efects of a Norin 10 dwarfing gene, Gai/Rht2. J. Agric. Sci. 1981, 97, 373–381. [Google Scholar] [CrossRef]
- Gale, M.D. The identifcation and exploitation of Norin 10 semidwarfng genes. Plant Breed Inst. Ann. Rep. 1976, 16, 21–24. [Google Scholar]
- Mathews, K.L.; Chapman, S.C.; Trethowan, R.; Singh, R.P.; Crossa, J.; Pfeifer, W.; Ginkel, M.; De, L.I. Global adaptation of spring bread and durum wheat lines near-isogenic for major reduced height genes. Crop Sci. 2006, 46, 603–613. [Google Scholar] [CrossRef]
- Snape, J.W.; Parker, B.B. The efect of the Norin 10 dwarfng gene, Rht2, on yield-biomass relationships in wheat (Triticum aestivum). In Semi-Dwarf Cereal Mutants and Their Use in Crossbreeding II. Research Coordination Meeting, Vienna; International Atomic Energy Agency: Vienna, Austria, 1984; pp. 71–77. [Google Scholar]
- Graham, D.; Lessman, K.J. Effect of Height on Yield and Yield Components of Two Isogenic Lines of Sorghum vulgare Pers. Crop Sci. 1966, 6, 372–374. [Google Scholar] [CrossRef]
- Pereira, M.G.; Lee, M. Identification of genomic regions affecting plant height in sorghum and maize. Theor. Appl. Genet. 1995, 90, 380–388. [Google Scholar] [CrossRef] [PubMed]
- Casady, A.J. Effect of a Single Height (Dw3) Gene of Sorghum on Grain Yield, Grain Yield Components, and Test Weight. Crop Sci. 1965, 5, 385–388. [Google Scholar] [CrossRef]
- Truong, S.K.; Mc Cormick, R.F.; Rooney, W.L.; Mullet, J.E. Harnessing genetic variation in leaf angle to increase productivity of sorghum bicolor. Genetics 2015, 201, 1229–1238. [Google Scholar] [CrossRef] [PubMed]
- Joel, O.; Ming, Z.F.; Brian, M.; Starla, Z.D.; Federica, B.; Curtis, W.; John, E. The AGCVIII kinase Dw2 modulates cell proliferation, endomembrane trafficking, and MLG/xylan cell wall localization in elongating stem internodes of Sorghum bicolor. Plant J. 2021, 105, 1053–1071. [Google Scholar]
- Olson, S.N.; Ritter, K.; Rooney, W.; Kemanian, A.; McCarl, B.A.; Zhang, Y.; Hall, S.; Packer, D.; Mullet, J. High biomass yield energy sorghum: Developing a genetic model for C4 grass bioenergy crops. Biofuels Bioprod. Biorefining 2012, 6, 640–655. [Google Scholar] [CrossRef]
- Quijano, A.; Morandi, E.N. Leaf area reduction during the pod set period changes the photomorphogenic light balance and increases the pod number and yield in soybean canopies. Field Crops Res. 2023, 303, 109148. [Google Scholar] [CrossRef]
- Gai, J.; Yi, H.; Ji, B. Characteristics, common questions and application prospects of the restrictive, two-stage, multi-site, genome-wide association analysis method (RTM-GWAS). Chin. Agric. Sci. 2020, 53, 1699–1703. [Google Scholar]
- Xin, L.; Xian, R.L.; Eyal, F.; Jian, M.Y. Dissecting repulsion linkage in the dwarfing gene Dw3 region for sorghum plant height provides insights into heterosis. Proc. Natl. Acad. Sci. USA 2015, 112, 11823–11828. [Google Scholar]
Type | Number | Name | Subspecies | Source | Type | Number | Name | Subspecies | Source |
---|---|---|---|---|---|---|---|---|---|
Male sterile line | 1 | SX44B | Durra | China,SXAU,SRI | Restorer line | 10 | 91644(H) | Kafir | Australia |
2 | SX4244B | Durra | China,SXAU,SRI | 11 | 91645(H) | Kafir | Australia | ||
3 | A2V4B | Durra | China,SXAU,SRI | 12 | 91648 | Kafir | Australia | ||
4 | CS3541B | Durra | China,SXAU,SRI | 13 | 961547 | Kafir | USA | ||
5 | 961542B | Durra | China,SXAU,SRI | 14 | 91624(H) | Kafir | Australia | ||
6 | F4B | Durra | China,SXAU,SRI | 15 | TX414 | Kafir/Durra | USA | ||
7 | TX3197B | Kafir | USA | 16 | NJ426 | Kafir/Durra | China,SXAU,SRI | ||
8 | (TXbmr6B/7501B)B | Kafir | China,SXAU,SRI | 17 | SX1042 | Kaoliang/Kafir | China,SXAU,SRI | ||
9 | N1B | Kafir | China,SXAU,SRI | 18 | HBNR436-2 | Kaoliang/Kafir | China,HBAAS | ||
10 | N3B | Kafir | China,SXAU,SRI | 19 | Hong yin zi | Kaoliang | China,Farmer kind | ||
11 | ZSB | Kafir | China,SXAU,SRI | 20 | QKY | Kaoliang | China,Farmer kind | ||
12 | TX414B | Kafir | USA | 21 | chf5933 | Kaoliang | China,CFAI | ||
13 | TX639B | Kafir | USA | 22 | SCS | Kaoliang | China,Farmer kind | ||
14 | TX649B | Kafir | USA | 23 | 20131937 | Kaoliang | China,SXAU,SRI | ||
15 | 7501B | Kafir | USA | 24 | XL7 | Kaoliang/Caudatu | China,XZAI | ||
16 | TX2925B | Kafir | USA | 25 | JL5 | Kaoliang/Caudatu | China,SXAU,SRI | ||
17 | J16VII18B | Kafir | China,JLAAS | 26 | 0-30/DHS | Kaoliang/Caudatu | China,SXAU,SRI | ||
18 | J16VII27B | Kafir | China,JLAAS | 27 | SXR0-30 | Kaoliang/Caudatu | China,SXAU,SRI | ||
19 | SX605B | Kafir | China,SXAU,SRI | 28 | LNR | Kaoliang/Caudatum | China,LNAAS | ||
20 | SX77B | Kafir | China,SXAU,SRI | 29 | XLH*GN2 | Kaoliang/Caudatum | China,SXAU,SRI | ||
21 | 998B | Kafir | China,SXAU,SRI | 30 | 0592F | Kaoliang/Caudatum | China,SXAU,SRI | ||
22 | TV33B | Kafir | China,SXAU,SRI | 31 | SX861 | Kaoliang/Caudatum | China,SXAU,SRI | ||
23 | TX623B | Kafir/Caudatum | USA | 32 | 1602N | Kaoliang/Caudatum | China,SXAU,SRI | ||
24 | (314B/623B)B | Kafir/Caudatum | China,SXAU,SRI | 33 | HC356 | Kaoliang/Caudatum | China,SXAU,SRI | ||
25 | 2055B | Kafir/Durra | China,JLAAS | 34 | 1383-2 | Kaoliang/Caudatum | China,SXAU,SRI | ||
26 | L407B | Kafir/Durra | China,LNAAS | 35 | N133 | Kaoliang/Caudatum | China,JLAAS | ||
27 | TAM428B | Kafir/Durra | USA | 36 | J98H | Kaoliang/Caudatum | China,JLAAS | ||
28 | N2B | Kafir/Durra | China,SXAU,SRI | 37 | JR108 | Kaoliang/Caudatum | China,JLAAS | ||
29 | J4190B | Kafir/Durra | China,JLAAS | 38 | XZ6936R | Kaoliang/Caudatum | China,SXAU,SRI | ||
30 | SX3142B | Kafir/kuban | China,SXAU,SRI | 39 | 9825R-1 | Kaoliang/Caudatum | China,SXAU,SRI | ||
31 | SJB | Kafir/Complex | China,SXAU,SRI | 40 | R111 | Kaoliang/Caudatum | China,SXAU,SRI | ||
32 | L45B | Kafir/Complex | China,SCAAS,SRI | 41 | HM65 | Kaoliang/Caudatum | China,SXAU,SRI | ||
33 | [Tx623B.Bmr6/L199B]B | Kafir/Complex | China,SXAU,SRI | 42 | LNH13 | Kaoliang/Caudatum | China,SCAAS,SRI | ||
34 | [L45B/(TX623B/V4B)]B | Kafir/Complex | China,SXAU,SRI | 43 | 2381 | Kaoliang/Caudatum | China,SXAU,SRI | ||
35 | (SX605B×泸45B)B | Kafir/Complex | China,SXAU,SRI | 44 | LN8RN | Kaoliang/Caudatum | China,LNAAS | ||
36 | 7050B | Kafir/Complex | China,LNAAS | 45 | JR105 | Kaoliang/Caudatum | China,JLAAS | ||
37 | N4B | Kafir/Complex | China,SXAU,SRI | 46 | XLH-1 | Kaoliang/Caudatum | China,HNAAS | ||
38 | SX111B | Complex | China,SXAU,SRI | 47 | ZHOU | Kaoliang/Caudatum | China,LNAAS | ||
Type | Number | Name | Subspecies | Source | 48 | 1603N | Kaoliang/Caudatum | China,SXAU,SRI | |
Restorer line | 1 | Hegari | Caudatum | USA | 49 | 5564F | Kaoliang/Caudatum | China,SXAU,SRI | |
2 | K35-Y5*1383 | Complex | China,SXAU,SRI | 50 | 5577F | Kaoliang/Caudatum | China,SXAU,SRI | ||
3 | F-R | Durra | France | 51 | JR107 | Kaoliang/Caudatum | China,JLAAS | ||
4 | TX7078 | Kafir | USA | 52 | zhzy2-07 | Kaoliang/Caudatum | China,SXAU,SRI | ||
5 | HTX430 | Kafir | USA | 53 | 363C/2691 | Kaoliang/Complex | China,SXAU,SRI | ||
6 | TX432 | Kafir | USA | 54 | 9198/TMS | Kaoliang/Complex | China,SXAU,SRI | ||
7 | TX2737 | Kafir | USA | 55 | IS7444C | Unknown | USA | ||
8 | 91633(H) | Kafir | Australia | 56 | XYLgaoliang | Unknown | Hungary | ||
9 | 91635(H) | Kafir | Australia | 57 | Feterita | Unknown | USA |
Primer Name | Primer Sequence |
---|---|
Dw1-F | TGGCGGTCCAACGTCTAAT |
Dw1-R | CCTGAAGTATGGCGTGTCT |
Dw2-F | CAGTTCAAATCAACGAGGAG |
Dw2-R | TCCGTCGTGAAATGAGAATA |
Dw3-F | CGTCATCGTCCAGAACTCGG |
Dw3-R | GACCCTTGCTCCACCACCTT |
Plant Height Type | Genotype | Material Type | Number | Name | Subspecies | Plant Height (cm) | Stem Height (cm) | Spike Stalk Length (cm) | Spike Length (cm) | Height under Flag Leaf (cm) | Spike Stalk Length/Stem Height |
---|---|---|---|---|---|---|---|---|---|---|---|
Three-dwarf type | Dw1Dw1 dw2dw2 dw3dw3 dw4dw4 | Male sterile line | 1 | SX44B | Durra | 115.00 | 88.67 | 39.00 | 26.33 | 49.67 | 0.44 |
2 | SX4244B | Durra | 86.00 | 61.67 | 34.00 | 24.33 | 27.67 | 0.55 | |||
3 | A2V4B | Durra | 126.33 | 101.33 | 37.33 | 25.00 | 64.00 | 0.37 | |||
Restorer line | 4 | 1602N | Kaoliang/Caudatum | 115.00 | 88.00 | 30.67 | 27.00 | 57.33 | 0.35 | ||
Avg | 110.58 | 84.92 | 35.25 | 25.67 | 49.67 | 0.43 | |||||
SD | 17.24 | 16.67 | 3.69 | 1.22 | 15.79 | 0.09 | |||||
COV | 0.16 | 0.20 | 0.10 | 0.05 | 0.32 | 0.21 | |||||
dw1dw1 | Male sterile line | 5 | 2055B | Kafir/Durra | 70.33 | 52.00 | 30.33 | 18.33 | 21.67 | 0.58 | |
Dw2Dw2 | 6 | L407B | Kafir/Durra | 103.00 | 76.00 | 41.67 | 27.00 | 34.33 | 0.55 | ||
dw3dw3 | 7 | TAM428B | Kafir/Durra | 98.33 | 68.33 | 30.00 | 30.00 | 38.33 | 0.44 | ||
dw1dw1 Dw2Dw2 dw3dw3 dw4dw4 | 8 | SJB | Kafir/Complex | 126.33 | 100.33 | 44.67 | 26.00 | 55.67 | 0.45 | ||
9 | L45B | Kafir/Complex | 144.33 | 107.67 | 44.67 | 36.67 | 63.00 | 0.41 | |||
10 | N2B | Kafir/Durra | 107.00 | 72.33 | 39.00 | 34.67 | 33.33 | 0.54 | |||
11 | [Tx623B.Bmr6/L199B]B | Kafir/Complex | 93.33 | 64.67 | 35.17 | 28.67 | 29.50 | 0.54 | |||
12 | TX3197B | Kafir | 115.00 | 94.00 | 44.00 | 21.00 | 50.00 | 0.47 | |||
13 | [L45B/(TX623B/V4B)]B | Kafir/Complex | 117.00 | 79.00 | 39.83 | 38.00 | 39.17 | 0.50 | |||
14 | (SX605B×L45B)B | Kafir/Complex | 132.33 | 106.00 | 37.33 | 26.33 | 68.67 | 0.35 | |||
15 | (TXbmr6B/7501B)B | Kafir | 108.67 | 80.67 | 42.00 | 28.00 | 38.67 | 0.52 | |||
16 | N1B | Kafir | 103.00 | 69.00 | 39.00 | 34.00 | 30.00 | 0.57 | |||
17 | N3B | Kafir | 116.33 | 84.00 | 50.17 | 32.33 | 33.83 | 0.60 | |||
18 | J4190B | Kafir/Durra | 84.00 | 56.33 | 33.00 | 27.67 | 23.33 | 0.59 | |||
19 | ZSB | Kafir | 127.67 | 103.67 | 48.33 | 24.00 | 55.33 | 0.47 | |||
20 | TX414B | Kafir | 87.00 | 64.00 | 34.00 | 23.00 | 30.00 | 0.53 | |||
21 | TX639B | Kafir | 132.50 | 108.33 | 49.00 | 24.17 | 59.33 | 0.45 | |||
22 | TX649B | Kafir | 124.00 | 84.67 | 41.33 | 39.33 | 43.33 | 0.49 | |||
23 | TX623B | Kafir/Caudatum | 128.00 | 96.00 | 52.00 | 32.00 | 44.00 | 0.54 | |||
24 | 7501B | Kafir | 104.33 | 84.00 | 43.50 | 20.33 | 40.50 | 0.52 | |||
25 | 7050B | Kafir/Complex | 128.50 | 95.50 | 37.00 | 33.00 | 58.50 | 0.39 | |||
26 | TX2925B | Kafir | 113.00 | 87.67 | 43.67 | 25.33 | 44.00 | 0.50 | |||
27 | J16VII18B | Kafir | 108.33 | 71.00 | 33.67 | 37.33 | 37.33 | 0.47 | |||
28 | J16VII27B | Kafir | 102.67 | 73.33 | 36.00 | 29.33 | 37.33 | 0.49 | |||
29 | SX605B | Kafir | 128.00 | 94.00 | 39.67 | 34.00 | 54.33 | 0.42 | |||
30 | SX77B | Kafir | 104.00 | 70.33 | 44.33 | 33.67 | 26.00 | 0.63 | |||
31 | CS3541B | Durra | 111.33 | 82.33 | 50.67 | 29.00 | 31.67 | 0.62 | |||
32 | SX3142B | Kafir/kuban | 89.67 | 65.67 | 26.33 | 24.00 | 39.33 | 0.40 | |||
33 | (314B/623B)B | Kafir/Caudatum | 112.67 | 88.00 | 39.67 | 24.67 | 48.33 | 0.45 | |||
Restorer line | 34 | LNR | Kaoliang/Caudatum | 131.67 | 108.67 | 20.67 | 23.00 | 88.00 | 0.19 | ||
35 | XLH*GN2 | Kaoliang/Caudatum | 104.00 | 78.67 | 29.00 | 25.33 | 49.67 | 0.37 | |||
36 | 0592F | Kaoliang/Caudatum | 92.17 | 63.17 | 37.10 | 29.00 | 26.07 | 0.59 | |||
37 | TX7078 | Kafir | 112.67 | 89.67 | 46.67 | 23.00 | 43.00 | 0.52 | |||
38 | HTX430 | Kafir | 108.00 | 74.00 | 44.25 | 34.00 | 29.75 | 0.60 | |||
39 | TX432 | Kafir | 91.00 | 67.00 | 44.00 | 24.00 | 23.00 | 0.66 | |||
40 | TX414 | Kafir/Durra | 87.33 | 66.67 | 36.67 | 20.67 | 30.00 | 0.55 | |||
41 | TX2737 | Kafir | 69.83 | 46.00 | 26.67 | 23.83 | 19.33 | 0.58 | |||
42 | 91633(H) | Kafir | 97.67 | 74.33 | 37.83 | 23.33 | 36.50 | 0.51 | |||
43 | 91635(H) | Kafir | 91.00 | 69.00 | 39.00 | 22.00 | 30.00 | 0.57 | |||
44 | 91644(H) | Kafir | 103.50 | 74.50 | 46.00 | 29.00 | 28.50 | 0.62 | |||
45 | 91645(H) | Kafir | 105.67 | 77.67 | 43.33 | 28.00 | 34.33 | 0.56 | |||
46 | 91648 | Kafir | 94.33 | 70.33 | 42.33 | 24.00 | 28.00 | 0.60 | |||
47 | SX1042 | Kaoliang/Kafir | 107.00 | 74.33 | 38.67 | 32.67 | 35.67 | 0.52 | |||
48 | 961547 | Kafir | 95.00 | 73.33 | 42.33 | 21.67 | 31.00 | 0.58 | |||
49 | 91624(H) | Kafir | 92.50 | 63.07 | 39.17 | 29.43 | 23.90 | 0.62 | |||
50 | SX861 | Kaoliang/Caudatum | 97.67 | 68.67 | 19.33 | 29.00 | 49.33 | 0.28 | |||
Avg | 106.56 | 78.65 | 39.20 | 27.91 | 39.45 | 0.51 | |||||
SD | 16.47 | 15.14 | 7.34 | 5.22 | 13.88 | 0.10 | |||||
COV | 0.15 | 0.19 | 0.19 | 0.19 | 0.35 | 0.19 | |||||
dw1dw1,dw2dw2 Dw3Dw3,dw4dw4 | Restorer line | 51 | NJ426 | Kafir/Durra | 90.33 | 62.67 | 39.00 | 27.67 | 23.67 | 0.62 | |
Two-dwarf type | dw1dwd1,Dw2Dw2 Dw3Dw3,dw4dw4 | Male sterile line | 52 | SX111B | Complex | 97.33 | 74.67 | 37.50 | 22.67 | 37.17 | 0.50 |
53 | 998B | Kafir | 117.67 | 91.67 | 49.17 | 26.00 | 42.50 | 0.54 | |||
54 | 961542B | Durra | 95.67 | 69.00 | 47.00 | 26.67 | 22.00 | 0.68 | |||
Avg | 103.56 | 78.45 | 44.56 | 25.11 | 33.89 | 0.57 | |||||
SD | 12.25 | 11.80 | 6.21 | 2.14 | 10.64 | 0.09 | |||||
COV | 0.12 | 0.15 | 0.14 | 0.09 | 0.31 | 0.16 | |||||
Dw1Dw1,dw2dw2 Dw3Dw3,dw4dw4 | Restorer line | 55 | Hegari | Caudatum | 217.00 | 195.00 | 53.00 | 22.00 | 142.00 | 0.27 | |
Dw1Dw1 Dw2Dw2 dw3dw3 dw4dw4 | Male sterile line | 56 | TV33B | Kafir | 78.00 | 66.00 | 28.67 | 12.00 | 37.33 | 0.43 | |
57 | N4B | Kafir/Complex | 143.67 | 102.67 | 43.67 | 41.00 | 59.00 | 0.43 | |||
58 | F4B | Durra | 153.50 | 126.00 | 32.50 | 27.50 | 93.50 | 0.26 | |||
Restorer line | 59 | HC356 | Kaoliang/Caudatum | 157.00 | 129.00 | 33.33 | 28.00 | 95.67 | 0.26 | ||
60 | 1383-2 | Kaoliang/Caudatum | 133.67 | 108.00 | 21.00 | 25.67 | 87.00 | 0.19 | |||
61 | zhzy2-07 | Kaoliang/Caudatum | 116.00 | 95.00 | 23.00 | 21.00 | 72.00 | 0.24 | |||
62 | N133 | Kaoliang/Caudatum | 118.00 | 99.00 | 26.50 | 19.00 | 72.50 | 0.27 | |||
63 | 363C/2691 | Kaoliang/Caudatum | 136.33 | 117.67 | 27.67 | 18.67 | 90.00 | 0.24 | |||
64 | J98H | Kaoliang/Caudatum | 126.00 | 91.33 | 28.33 | 34.67 | 63.00 | 0.31 | |||
65 | F-R | Durra | 104.00 | 80.33 | 42.67 | 23.67 | 37.67 | 0.53 | |||
66 | JR108 | Kaoliang/Caudatum | 130.67 | 99.33 | 39.33 | 31.33 | 60.00 | 0.40 | |||
67 | X6936R | Kaoliang/Caudatum | 95.00 | 66.00 | 40.00 | 29.00 | 26.00 | 0.61 | |||
68 | 9198/TMS | Kaoliang/Caudatum | 110.00 | 74.00 | 33.67 | 36.00 | 40.33 | 0.46 | |||
69 | IS7444C | Unknown | 129.00 | 111.67 | 51.60 | 17.33 | 60.07 | 0.46 | |||
70 | HBNR436-2 | Kaoliang/Kafir | 105.50 | 73.50 | 26.50 | 32.00 | 47.00 | 0.36 | |||
71 | 9825R-1 | Kaoliang/Caudatum | 93.67 | 66.67 | 31.33 | 27.00 | 35.33 | 0.47 | |||
72 | R111 | Kaoliang/Caudatum | 137.50 | 113.00 | 26.00 | 24.50 | 87.00 | 0.23 | |||
73 | XYLgaoliang | Unknown | 137.67 | 110.33 | 32.33 | 27.33 | 78.00 | 0.29 | |||
74 | HM65 | Kaoliang/Caudatum | 161.33 | 136.33 | 37.00 | 25.00 | 99.33 | 0.27 | |||
75 | LNH13 | Kaoliang/Caudatum | 133.33 | 103.67 | 24.00 | 29.67 | 79.67 | 0.23 | |||
76 | 2381 | Kaoliang/Caudatum | 134.00 | 110.00 | 26.50 | 24.00 | 83.50 | 0.24 | |||
77 | XL7 | Kaoliang/Caudatum | 142.33 | 118.67 | 34.33 | 23.67 | 84.33 | 0.29 | |||
78 | Jing liang 5 | Kaoliang/Caudatum | 138.00 | 109.73 | 26.83 | 28.27 | 82.90 | 0.24 | |||
79 | SXR0-30 | Kaoliang/Caudatum | 124.67 | 101.33 | 33.33 | 23.33 | 68.00 | 0.33 | |||
80 | ZHOU | Kaoliang/Caudatum | 111.00 | 85.67 | 28.67 | 25.33 | 57.00 | 0.33 | |||
81 | JR105 | Kaoliang/Caudatum | 124.67 | 93.67 | 37.00 | 31.00 | 56.67 | 0.40 | |||
82 | 1603N | Kaoliang/Caudatum | 113.67 | 85.33 | 27.00 | 28.33 | 58.33 | 0.32 | |||
83 | 0-30/DHS | Kaoliang/Caudatum | 136.67 | 112.00 | 35.00 | 24.67 | 77.00 | 0.31 | |||
84 | 5564F | Kaoliang/Caudatum | 94.33 | 69.00 | 26.67 | 25.33 | 42.33 | 0.39 | |||
85 | 5577F | Kaoliang/Caudatum | 100.67 | 73.67 | 29.67 | 27.00 | 44.00 | 0.40 | |||
Avg | 124.00 | 97.62 | 31.80 | 26.38 | 65.82 | 0.34 | |||||
SD | 20.28 | 19.97 | 6.84 | 5.74 | 20.55 | 0.10 | |||||
COV | 0.16 | 0.20 | 0.21 | 0.22 | 0.31 | 0.30 | |||||
One-dwarf type | Dw1Dw1 Dw2Dw2 Dw3Dw3 dw4dw4 | Restorer line | 86 | LN8RN | Kaoliang/Caudatum | 128.33 | 106.33 | 28.67 | 22.00 | 77.67 | 0.27 |
87 | XLH-1 | Kaoliang/Caudatum | 179.00 | 153.67 | 35.00 | 25.33 | 118.67 | 0.23 | |||
88 | Hong yin zi | Kaoliang | 247.33 | 228.00 | 48.33 | 19.33 | 179.67 | 0.21 | |||
89 | Feterita | Unknown | 215.00 | 188.50 | 31.83 | 26.50 | 156.67 | 0.17 | |||
90 | QKY | Kaoliang | 291.00 | 270.67 | 35.00 | 20.33 | 235.67 | 0.13 | |||
91 | K35-Y5*1383 | Complex | 101.33 | 78.00 | 21.67 | 23.33 | 56.33 | 0.28 | |||
92 | JR107 | Kaoliang/Caudatum | 120.67 | 87.33 | 35.50 | 33.33 | 51.83 | 0.41 | |||
93 | chf5933 | Kaoliang | 153.67 | 121.00 | 35.33 | 32.67 | 85.67 | 0.29 | |||
94 | SCS | Kaoliang | 138.00 | 109.73 | 26.83 | 28.27 | 82.90 | 0.24 | |||
95 | 20131937 | Kaoliang | 221.00 | 205.33 | 32.27 | 15.67 | 173.07 | 0.16 | |||
Avg | 179.53 | 154.86 | 33.04 | 24.68 | 121.82 | 0.24 | |||||
SD | 62.00 | 65.36 | 7.01 | 5.71 | 61.57 | 0.08 | |||||
COV | 0.35 | 0.42 | 0.21 | 0.23 | 0.51 | 0.34 |
Male Sterile Line A/B and Genotype | A2V4B | SX44B | CS3541B | TX623B | TX3197B | |
---|---|---|---|---|---|---|
(Durra) | (Durra) | (Durra) | (Kafir/Caudatum) | (Kafir) | ||
Dw1-dw2-dw3-dw4 | Dw1-dw2-dw3-dw4 | dw1-Dw2-dw3-dw4 | dw1-Dw2-dw3-dw4 | dw1-Dw2-dw3-dw4 | ||
A2V4A (Durra) | F1 genotype | Dw1Dw1-dw2dw2-dw3dw3-dw4dw4 | Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | |
Dw1-dw2-dw3-dw4 | Plant height (cm) | 126.33 | 132.60 | 220.11 | 206.67 | 181.00 |
Stem height (cm) | 101.33 | 108.25 | 189.33 | 178.01 | 147.67 | |
Spike stalk length (cm) | 37.33 | 38.54 | 72.33 | 52.67 | 50.33 | |
Spike stalk length/stem height | 0.37 | 0.36 | 0.38 | 0.30 | 0.34 | |
SX44A (Durra) | F1 genotype | Dw1Dw1-dw2dw2-dw3dw3-dw4dw4 | Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | |
Dw1-dw2-dw3-dw4 | Plant height (cm) | 130.26 | 115.12 | 175.22 | 177.21 | 187.55 |
Stem height (cm) | 102.53 | 90.21 | 149.52 | 151.25 | 161.32 | |
Spike stalk length (cm) | 37.25 | 32.14 | 50.12 | 52.26 | 57.35 | |
Spike stalk length/stem height | 0.36 | 0.36 | 0.34 | 0.35 | 0.36 | |
CS3541A (Durra) | F1 genotype | Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | dw1dw1-Dw2DW2-dw3dw3-dw4dw4 | dw1dw1-Dw2DW2-dw3dw3-dw4dw4 | |
dw1-Dw2-dw3-dw4 | Plant height (cm) | 217.00 | 177.32 | 111.33 | 164.33 | 106.33 |
Stem height (cm) | 176.67 | 150.23 | 82.33 | 133.00 | 83.67 | |
Spike stalk length (cm) | 67.00 | 52.12 | 50.67 | 66.01 | 43.67 | |
Spike stalk length/stem height | 0.38 | 0.35 | 0.62 | 0.50 | 0.52 | |
TX623A (Kafir/Caudatum) | F1 genotype | Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | dw1dw1-Dw2DW2-dw3dw3-dw4dw4 | dw1dw1-Dw2DW2-dw3dw3-dw4dw4 | |
dw1-Dw2-dw3-dw4 | Plant height (cm) | 200.01 | 182.21 | 154.67 | 128.12 | 140.33 |
Stem height (cm) | 167.67 | 150.23 | 124.67 | 96.01 | 114.33 | |
Spike stalk length (cm) | 54.67 | 49.52 | 67.67 | 52.00 | 40.01 | |
Spike stalk length/stem height | 0.33 | 0.33 | 0.54 | 0.54 | 0.35 | |
TX3197A (Kafir) | F1 genotype | Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | dw1dw1-Dw2DW2-dw3dw3-dw4dw4 | dw1dw1-Dw2DW2-dw3dw3-dw4dw4 | |
dw1-Dw2-dw3-dw4 | Plant height (cm) | 175.12 | 168.41 | 107.67 | 143.67 | 115.01 |
Stem height (cm) | 147.67 | 140.12 | 83.67 | 115.01 | 94.00 | |
Spike stalk length (cm) | 46.33 | 44.21 | 40.10 | 48.00 | 44.00 | |
Spike stalk length/stem height | 0.31 | 0.32 | 0.48 | 0.42 | 0.47 |
Hybridized Combination Genotype | Hybridized Combination | Average (cm) | ||||
---|---|---|---|---|---|---|
Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 | Hybridized combination | A2V4A × TX7078 | A2V4A × SX1042 | SX44A × TX7078 | SX44A × SX1042 | |
Plant height (cm) | 192.33 | 193.5 | 172.58 | 182.53 | 185.24 | |
Dw1Dw1-Dw2dw2-dw3dw3-dw4dw4 | Hybridized combination | A2V4A × Jing liang 5 | A2V4A × SXR0-30 | SX44A × Jing liang 5 | SX44A × SXR0-30 | |
Plant height (cm) | 232.4 | 220.67 | 202.15 | 175.21 | 207.61 | |
dw1dw1-Dw2Dw2-dw3dw3-dw4dw4 | Hybridized combination | TX623A × TX7078 | TX623A × SX1042 | TX3197A × TX7078 | TX3197A × SX1042 | |
Plant height (cm) | 133.33 | 135.22 | 110 | 127.33 | 126.47 | |
Dw1dw1-Dw2Dw2-dw3dw3-dw4dw4 | Hybridized combination | TX623A × Jing liang 5 | TX623A × SXR0-30 | TX3197A × Jing liang 5 | TX3197A × SXR0-30 | |
Plant height (cm) | 203.67 | 194.33 | 195.33 | 184 | 194.33 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Lv, N.; Yin, F.; Duan, G.; Niu, H.; Chu, J.; Yan, H.; Ju, L.; Fan, F.; Lv, X.; et al. Research on Genotype Markers for Plant Height and Assisted Breeding of Key Sorghum Resources in China. Genes 2024, 15, 83. https://doi.org/10.3390/genes15010083
Wang Y, Lv N, Yin F, Duan G, Niu H, Chu J, Yan H, Ju L, Fan F, Lv X, et al. Research on Genotype Markers for Plant Height and Assisted Breeding of Key Sorghum Resources in China. Genes. 2024; 15(1):83. https://doi.org/10.3390/genes15010083
Chicago/Turabian StyleWang, Yubin, Na Lv, Feng Yin, Guoqi Duan, Hao Niu, Jianqiang Chu, Haisheng Yan, Lan Ju, Fangfang Fan, Xin Lv, and et al. 2024. "Research on Genotype Markers for Plant Height and Assisted Breeding of Key Sorghum Resources in China" Genes 15, no. 1: 83. https://doi.org/10.3390/genes15010083