Next Article in Journal
Triplication of the PCDH19 Gene as a Novel Disease Mechanism Leading to Epileptic Encephalopathy Resembling Loss-of-Function Pathogenic Variants
Previous Article in Journal
Whole Exome Sequencing and Panel-Based Analysis in 176 Spanish Children with Neurodevelopmental Disorders: Focus on Autism Spectrum Disorder and/or Intellectual Disability/Global Developmental Delay
Previous Article in Special Issue
Silicon Modifies Photosynthesis Efficiency and hsp Gene Expression in European Beech (Fagus sylvatica) Seedlings Exposed to Drought Stress
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 15
Issue 10
10.3390/genes15101311
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Expression Analysis of SNAP Gene Family in Wheat

by
Xiaohan Zhang
,
Yanan Yu
,
Yumeng Sun
,
Yan Bai
*,
Yongjun Shu
and
Changhong Guo
Key Laboratory of Molecular Cytogenetics and Genetic Breeding of Heilongjiang Province, College of Life Science and Technology, Harbin Normal University, Harbin 150025, China
*
Author to whom correspondence should be addressed.
Genes 2024, 15(10), 1311; https://doi.org/10.3390/genes15101311
Submission received: 15 September 2024 / Revised: 1 October 2024 / Accepted: 9 October 2024 / Published: 11 October 2024
(This article belongs to the Special Issue Genes and Genomics of Plants Under Abiotic Stresses)
Browse Figures
Versions Notes

Abstract

:
Background/Objectives: The SNAP gene family is a class of proteins containing a SNAP domain, which plays a crucial role in the growth and development of plants. Methods: Bioinformatics methods were used to systematically analyze the gene structure, phylogenetic evolution, chromosomal distribution, physicochemical properties, conserved motifs, and cis-acting elements of the TaSNAP family members. Results: The TaSNAP family comprises members that encode proteins ranging between 120 and 276 amino acids, with isoelectric points spanning from 4.87 to 7.92. Phylogenetic analysis elucidated the categorization of the eight TaSNAP into three distinct subfamilies, wherein members of the same subfamily display marked similarities in their gene structures. Chromosomal mapping revealed the distribution of TaSNAP family members across chromosomes 2A, 2B, 2D, 7A, 7B, and 7D. Utilizing the Plant CARE tool, we identified ten elements linked to plant hormones and four associated with stress responses. Expression analysis via qRT-PCR was performed to assess the levels of the eight TaSNAP genes in various tissues and under diverse abiotic stress conditions. The results indicated heightened expression of most genes in roots compared to spikes. Notably, under ABA stress, the majority of genes exhibited upregulation, whereas certain genes were downregulated under PEG stress, implying a substantial role for SNAP protein in wheat growth and development. Conclusions: This study conducted a comprehensive bioinformatics analysis of each member of the wheat SNAP family, laying a crucial foundation for future functional investigations.

1. Introduction

Wheat (Triticum aestivum L.) is a plant in the Poaceae family and belongs to the genus Triticum. As an important food crop [1], it has an extremely wide cultivation area and a profound socio-economic impact worldwide. The cultivation area accounts for about 1/3 of the arable land, and approximately 35% to 40% of the global population relies on it as their staple food [2]. The production and quality of wheat are influenced by numerous environmental pressures throughout its growth and developmental stages, among which salinity [3], drought conditions [4], and low temperatures [5] stand out as the most significant abiotic stressors. Wheat is a moderately salt-tolerant plant, and when the soil salinity exceeds a certain threshold, wheat growth is inhibited. This can lead to stunted growth and development and, in severe cases, plant death [6]. Saline soils are widely distributed in China, ranging from tropical to cold temperate zones, from coastal to inland areas, and from humid regions to extremely arid desert areas. The total area of saline soils in China is about 3.6 million hectares, accounting for 4.88% of the country’s usable land area [7]. The main concentrated distribution areas of saline soils in China are the northwest, north, and northeast regions and coastal areas. Among them, the saline soil area of the six western provinces and regions (Shaanxi, Gansu, Ningxia, Qinghai, Inner Mongolia, and Xinjiang) accounts for 69.03% of the national total [8]. Under the influence of global warming, drought events are becoming more frequent, with increasing intensity and duration, leading to progressively severe impacts. Over the past half-century, the boundary between semi-arid and semi-humid areas in China has generally moved southward, and the area of drought has been increasing [9]. In particular, drought conditions are more severe in Xinjiang, the Tibetan Plateau, and the southeast regions, while most areas of Central and East China are in a state of light drought or no drought. Therefore, research on salt and drought stresses is of great importance for improving wheat yield and quality. According to previous studies on SNAP proteins in plants, SNAP proteins are involved in various plant stress responses, and SNAP can be expressed under salt stress induction, showing higher tolerance to salt stress in plants [10]. SNAP proteins have been reported in many plants, but so far, no systematic analysis of the wheat SNAP gene family has been conducted. Therefore, this study analyzes the SNAP gene family based on the wheat whole genome, providing a reference for further research on the functions of this gene family. The results of this study are of great significance for further breeding or improving wheat varieties with resistance.
SNARE proteins (Soluble NSF Attachment Protein Receptor) are a class of key proteins involved in membrane fusion. They play a crucial role in processes such as intracellular material transport, secretion, and endocytosis. SNARE proteins can be divided into v-SNAREs (located on vesicle membranes) and t-SNAREs (located on target membranes, including members of the Syntaxin family and SNAP-25) [11]. SNAP (Synaptosome-Associated Protein) is a type of t-SNARE that, together with Syntaxin, forms part of the SNARE complex, which plays a central role in processes such as neurotransmitter release. The SNAP family is a protein family with a SNAP domain, also known as the Soluble NSF Attachment Protein Receptor (SNARE) gene family [11], which is widely present in eukaryotic cells. These proteins play a key role in vesicle transport and membrane fusion within the cell [12].
In plant cells, vesicle transport is a key process for maintaining cell function and responding to environmental challenges. Especially under abiotic stresses such as salt stress, active vesicle transport is crucial for maintaining cellular homeostasis [13]. SNARE proteins, as regulators of vesicle transport, ensure the accurate delivery of substances to target organelles by mediating membrane fusion. Currently, the SNAP gene family has been reported in potatoes, tomatoes, rice, and Arabidopsis, and in the study of potatoes, it has been shown that StSNAP genes are mainly related to vesicle transport. By studying the StSNAP30 gene of ‘Qinghu No. 9’ potatoes, various bioinformatics methods have been used to analyze the structural characteristics, physiological and biochemical properties, gene expression patterns, and subcellular localization of StSNAP30 protein [14]. This has verified the biological function of StSNAP30 in the development of potato pollen and pollen tube growth. In Arabidopsis, it has been found that AtSNAP33 is a t-SNARE protein homologous to SNAP-25, which works with KEULE and KNOLLE proteins in the process of cell division and cell plate formation, promoting vesicle fusion. Mutations in the AtSNAP33 gene can lead to plant growth and development defects and affect the plant’s response to pathogens [15]. In addition, the expression of AtSNAP33 is regulated by salicylic acid (SA), indicating that it may play an important role in the plant’s immune response. Subsequently, scientists have discovered a gene encoding a Qbc-SNARE protein, SlSNAP33.2, in tomatoes, which is induced under salt stress. Transgenic tomato plants overexpressing SlSNAP33.2 show improved salt stress tolerance, which is related to the promotion of endocytosis and the accumulation of sodium ions in vacuoles [16]. This endocytosis helps maintain cellular ion balance and reduce the accumulation of hydrogen peroxide, thus protecting cells from damage caused by salt stress. These studies indicate that AtSNAP33 and SlSNAP33.2, and other SNAP25-type proteins, play an important role in the response of plants to biotic and abiotic stresses. Not only do they participate in the modulation of cell division and exocytosis but also they potentially contribute to the regulation of plant immune responses and stress resilience as well. Improving the expression or function of these proteins through genetic improvement may help cultivate crop varieties that are more tolerant to salinity, drought, or other abiotic stresses [17,18].
Salt stress has a significant impact on the growth, development, yield, and quality of wheat [19]. As an important food crop, wheat productivity is severely limited by abiotic stresses such as soil salinization. Studies have shown that salt stress can cause inhibited wheat growth, yellowing of leaves, and inhibited root growth, and ultimately it can affect overall growth, development, and yield performance [20].
Under salt stress conditions, the physiological response of wheat includes a decrease in osmotic potential and disturbance of ion balance, leading to water deficiency and cellular homeostasis imbalance, which may eventually cause cell death. Wheat activates a variety of physiological and biochemical mechanisms to adapt to salt stress, including osmotic regulation, photosynthesis and respiration metabolism, hormone distribution, ion distribution, and reactive oxygen species (ROS) scavenging [21].
Utilizing wheat whole-genome data retrieved from the Ensembl Plants database [22], this study focuses on the identification of SNAP gene family members. It proceeds to examine their physicochemical attributes, gene architecture, conserved motifs, chromosomal localization, cis-regulatory elements, and phylogenetic evolution [23]. Additionally, qRT-PCR analysis was conducted to elucidate the expression profiles of eight SNAP family genes in various tissues and under diverse abiotic stress conditions, thereby establishing a foundation for an enhanced comprehension of the functions and significance of wheat SNAP proteins [24].

2. Materials and Methods

2.1. Plant Material

Chinese Spring wheat (T. aestivum L.) served as the experimental material for this study. The wheat seeds (provided by the Key Laboratory of Molecular Cytogenetics and Genetic Breeding of Heilongjiang Province, Harbin, China) underwent a disinfection process involving immersion in 75% alcohol for a duration of 3 min. This was followed by three rinses with distilled water and a subsequent soak in 10% sodium hypochlorite for another 3 min. After thorough rinsing with distilled water, the seeds were placed in sterile Petri dishes to facilitate germination and were cultivated for a period of 24 h. Upon sprouting, the seeds were transplanted into hydroponic boxes filled with 1/2 Hoagland nutrient solution and maintained in a greenhouse under constant temperature conditions and a 16 h photoperiod. At the two-week stage of wheat seedling development, root, stem, and leaf tissues were harvested for tissue expression analysis. Subsequently, stress treatments were applied using 0.2 mol/L NaCl (sourced from Hu Shi), 20% PEG (supplied by Solarbio, Beijing, China), 100 μmol/L ABA (from CMBIO, Pennsylvania, PA, USA), and exposure to 4 °C, with plants grown under normal conditions serving as controls. These controls were maintained under optimal temperature, sufficient light, appropriate water supply, without the addition of any exogenous hormones, and in soil devoid of stress-inducing substances. Following a 6 h treatment period, root, stem, and leaf tissues were collected from both treated and control plants, with each sample being replicated three times. Additionally, wheat spikes and pollen, collected from field-grown plants between April and July, were subjected to tissue expression analysis. Each sample of these tissues was also replicated three times. All collected samples were promptly frozen using aluminum foil, stored at −80 °C, and reserved for subsequent RNA extraction procedures.

2.2. Identification and Physicochemical Property Analysis of Wheat SNAP Gene Family Members

The whole-genome data of wheat, along with its protein sequences and annotation files, were retrieved from the Ensembl Plants database (http://plants.ensembl.org/index.html, accessed on 8 May 2024). The hidden Markov model (HMM) representing the SNAP family member structure domain was obtained from the Pfam database (http://pfam.xfam.org/, accessed on 8 May 2024). Utilizing HMMER 3.0 software in conjunction with this SNAP-specific HMM, a search was conducted through the wheat genome’s functional protein sequence database to identify potential wheat SNAP protein sequences. To validate the authenticity of these predicted genes as SNAP family members, the wheat SNAP protein sequences, after removing duplicates, were subjected to protein structure prediction using both SMART (http://smart.embl-heidelberg.de/, accessed on 8 May 2024) and NCBI’s Conserved Domain Database (CDD) online tool. This was performed to ascertain the presence of the conserved domain unique to SNAP, termed TaSNAP. Additionally, the ExPASy website (https://web.expasy.org/protparam/, accessed on 8 May 2024) was employed to assess fundamental physicochemical properties of the wheat SNAP protein sequence, including molecular weight, isoelectric point, and stability.

2.3. Systematic Evolutionary Analysis of Wheat SNAP Gene Family

For the multiple sequence alignment of wheat SNAP amino acid sequences, ClustalX software (version 2.1) was employed. Subsequently, a phylogenetic tree was constructed using MEGA software (version 11.0.13), applying the Neighbor-Joining algorithm. The parameters for this analysis included Poisson correction, pairwise deletion, and a bootstrap value of 1000 repetitions (the website usage time was May 2024).

2.4. Gene Structure and Conserved Motif Analysis of Wheat SNAP Gene Family

The GSDS website was used to draw the intron and exon gene pattern diagram, and the intron and exon information was downloaded from the Plant Transcription Factor Database (http://planttfdb.cbi.pku.edu.cn/, accessed on 10 May 2024) and SGN (https://solgenomics.net/, accessed on 10 May 2024). The online software MEME (https://meme-suite.org/meme/tools/meme, accessed on 10 May 2024) was used to predict conserved motifs.

2.5. Chromosome Localization Analysis of Wheat SNAP Gene Family

The chromosome position of TaSNAP was extracted from the wheat gene information GFF3 file, and the online website MG2C (http://mg2c.iask.in/mg2c_v2.1/, accessed on 10 May 2024) was used to make a chromosome localization map.

2.6. Cis-Acting Element Analysis of Wheat SNAP Gene Family

The promoter region (upstream 2000 bp) of each wheat SNAP gene was extracted from the wheat whole-genome database, and Plant CARE software (https://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 11 May 2024) was used to analyze cis-acting elements related to plant hormones and stress responses.

2.7. RNA Extraction and Real-Time Fluorescence Quantitative PCR Analysis

The Primer 5 software was used to design specific quantitative primers (see Table 1), with wheat Actin as the reference gene. The extraction of wheat total RNA was accomplished utilizing an RNAprep Pure Plant Kit, followed by the conversion of the isolated RNA into cDNA employing a TransStart®Top Green qPCR SuperMix (AQ131, TRAN) reagent. The composition of the PCR reaction mixture is outlined below: 2 μL of cDNA, 10 μL of 2× TransStart®Top Green qPCR SuperMix, 0.4 μL each of the forward and reverse primers, and 7.2 μL of nuclease-free water. The amplification program is as follows: 94 °C for 30 s, 94 °C for 5 s, 54 °C for 15 s, 72 ° C for 31 s, 40 cycles. Each sample was performed in triplicate, and the data were processed using the 2−ΔΔCT method. R (version 4.2.2) was used for difference significance analysis, with p < 0.05 indicating significant difference and p < 0.01 indicating extremely significant difference.

3. Results

3.1. Basic Information Analysis of Wheat SNAP Gene Family Members

HMMER 3.0 software was utilized to obtain the amino acid sequences of wheat SNAP genes. Subsequently, protein structure predictions were conducted using SMART and NCBI’s online tool CDD to verify that the wheat SNAP genes contain the conserved domain unique to SNAP, resulting in the identification of eight wheat SNAP gene family members. These members were numbered from top to bottom based on their relative positions on the chromosome and named TaSNAP1 to TaSNAP8 (Table 2). These TaSNAP gene family members encode 120 to 276 amino acids, with isoelectric points ranging from 4.87 to 7.92 and molecular weights ranging from 31782.45 to 37561.43 Da. Among them, seven are acidic proteins (isoelectric point < 7.0) and one is a basic protein (isoelectric point > 7.0).

3.2. Systematic Evolutionary Analysis of Wheat SNAP Gene Family Members

MEGA 7.0 software was used to compare the SNAP protein sequences of known model plants Arabidopsis and rice with the SNAP protein sequences of wheat to construct a SNAP phylogenetic tree (Figure 1). As shown in Figure 1, based on the wheat TaSNAP gene structure, they were divided into three subfamilies. Subfamily I members are TaSNAP2 and TaSNAP7, subfamily II members are TaSNAP1, TaSNAP3, and TaSNAP4, and subfamily III members are TaSNAP5, TaSNAP6, and TaSNAP8. It is speculated that members of the same subfamily may have the same function.

3.3. Structural Feature Analysis of Wheat SNAP Gene Family

As shown in Figure 2, except for subfamily III members, the structures of subfamily I and subfamily II members are relatively similar, and subfamily III members only contain three exons. The exon count remains consistent across members of subfamily I and subfamily II, with each comprising precisely nine exons, indicating a robust uniformity in their gene structures within the respective subfamilies. Furthermore, the gene architecture of these SNAP genes bears resemblance to that observed in Arabidopsis and rice.
In order to analyze the structural characteristics of the wheat SNAP family, 10 conserved motifs in the wheat SNAP gene protein sequence were predicted using the online tool MEME (Figure 2), namely, Motif 1, Motif 2, Motif 3, Motif 4, Motif 5, Motif 6, Motif 7, Motif 8, Motif 9, and Motif 10. As shown in the figure, all members of subfamily I contain Motif 1, Motif 2, Motif 3, Motif 5, Motif 6, and Motif 8; all members of subfamily II contain Motif 1, Motif 2, Motif 3, Motif 4, Motif 7, Motif 9, and Motif 10; subfamily III members only contain Motif 1, and it is found that Motif 1 exists in all members, while Motif 5, Motif 6, and Motif 8 are only present in subfamily I members, and Motif 4, Motif 7, Motif 9, and Motif 10 are only present in subfamily II members. This indicates that the wheat SNAP gene family may have lost or gained conserved motifs during the process of evolution.

3.4. Chromosome Localization Analysis of Wheat SNAP Gene Family

As shown in Figure 3, the eight wheat SNAP genes are unevenly distributed on six chromosomes, with two genes on chromosomes 2B and 7D and one gene on each of the other four chromosomes.

3.5. Cis-Acting Element Analysis of Wheat SNAP Gene Family

To gain insight into the potential regulatory mechanisms governing the expression of wheat SNAP gene family members, we identified the cis-acting elements within eight wheat SNAP genes. Our analysis revealed a total of 20 such elements linked to plant hormones and stress responses (depicted in Figure 4). Notably, numerous elements are associated with stress responses, encompassing the DRE core (Dehydration Responsive Element), MYB, STRE (Stress Responsive Element), CCGTCC motif, and other stress-related elements. These elements are integral to various plant physiological processes, including responses to low temperatures, high salinity, and drought stress. The DRE core element is particularly pivotal in plant stress responses, as DREB transcription factors bind to it to modulate the expression of specific genes, thereby facilitating plant adaptation to adverse environmental conditions. Research conducted by the Fujian Agriculture and Forestry University team on Moso bamboo highlighted the significance of the PeDREB28 gene in enhancing plant tolerance to abiotic stress [25]. DREB transcription factors are known to regulate the expression of genes related to stress responses such as drought, salt, and cold tolerance. Harnessing DRE cis-acting elements and DREB transcription factors can bolster plant stress resistance [26]. Moreover, exploring the interplay between DRE cis-acting elements and DREB transcription factors is crucial for elucidating the molecular mechanisms underlying plant stress signal transduction [27]. Our analysis of the diverse cis-acting elements identified in TaSNAP, along with their interactions and functions, underscores the importance of the SNAP gene family in plants. Given the presence of various stress-related elements within SNAP, it plays distinct roles in different abiotic stresses, enhancing plant cold and drought resistance capabilities.

3.6. Expression of Wheat SNAP Gene Family in Different Tissues and Abiotic Stresses and Hormone Treatments

qRT-PCR was employed to investigate the expression profiles of TaSNAP across various tissues, including roots, stems, leaves, spikes, and pollen, as well as in response to diverse abiotic stress conditions such as osmotic stress, low temperature, salinity, and abscisic acid (ABA) treatment (refer to Figure 5 and Figure 6). The eight genes exhibited differential expression across all tested tissues, with roots demonstrating the highest expression levels and spikes showing the lowest. Specifically, TaSNAP5 displayed minimal expression in leaves, spikes, and pollen. Within the SNAP gene family, a consistent expression pattern emerged across tissues, with roots consistently exhibiting the peak expression, followed by stems. However, notable variations in expression were observed among leaves, spikes, and pollen.
TaSNAP responds to abiotic stress, but the expression levels are different (Figure 6). Under salt stress treatment, the expression of the SNAP family genes was upregulated, but the upregulation levels were different among different family members. Among the TaSNAP3, TaSNAP5, TaSNAP6, TaSNAP7, and TaSNAP8 family members, the upregulation levels were extremely significant, and these five members had higher salt tolerance compared to other members. Under osmotic stress, TaSNAP1, TaSNAP3, TaSNAP4, TaSNAP5, TaSNAP6, TaSNAP7, and TaSNAP8 were all upregulated. Except for the TaSNAP5 gene, the other seven family members were upregulated under ABA stress. In the eight genes of the SNAP family, the expression trend in different tissues was roughly the same, and only the TaSNAP5 gene was different. Through qRT-PCR analysis of the expression patterns of TaSNAP in different tissues (roots, stems, leaves, spikes, pollen) and abiotic stress treatments (osmotic, low temperature, salt, and ABA), further analysis of the TaSNAP gene family revealed that the highest expression was in roots, which also represents the strongest salt and osmotic resistance in roots compared to other tissues, and each family member responded to salt stress and osmotic stress.

4. Discussion

In plant cells, substance transport is crucial for maintaining cell function and responding to environmental challenges. SNARE proteins (Soluble N-ethylmaleimide-Sensitive Factor Attachment Protein Receptor) play a key role in the fusion of cell membranes, promoting the fusion of vesicles with target membranes by forming specific protein complexes [27]. SNARE proteins play a variety of important roles in the cell, including participating in the formation of cell plates as sites for the synthesis of new cell walls [28], regulating vesicle fusion to control hormone release, and mediating vesicle transport to regulate the secretion of defense-related proteins and compounds, thereby responding to pathogen attacks [29].
The SNAP family is a family of proteins with a SNAP domain, also known as Soluble NSF Attachment Protein. SNARE proteins can be divided into v-SNARE and t-SNARE. SNAP (Synaptosome-Associated Protein) [30] is a type of t-SNARE that, together with Syntaxin, forms part of the SNARE complex, which plays a central role in processes such as neurotransmitter release. SNAP is widely present in eukaryotic cells and plays a key role in intracellular vesicle transport and membrane fusion. In different plant species, members of the SNAP gene family play important roles in pollen development, cell division, and responses to biotic and abiotic stresses [31].
Research results indicate that the SNAP gene family plays a key role in the growth and development of plants, as well as in stress response [32]. For instance, proteins such as Arabidopsis AtSNAP33, tomato’s SlSNAP33.2, rice’s OsSNAP32, and potato’s StSNAP30 exhibit diverse biological functions in vesicle transport, cell division, pollen development, and responses to salt stress and pathogen attacks. Overexpression of the SlSNAP33.2 gene in tomato enhances the plant’s tolerance to salt stress. This is achieved by promoting endocytosis and the accumulation of sodium ions in vacuoles, thereby reducing the accumulation of hydrogen peroxide in the cytoplasm of root hair cells, indicating that SlSNAP33.2 plays a significant role in the endocytic pathway of plants in response to salt stress [14,15,16,17,18].
This study identified eight wheat SNAP family members and conducted bioinformatics analysis, revealing that these members have similar physicochemical properties, with the number of amino acids ranging from 120 to 276 and the isoelectric point (pI) values between four and eight. The chromosomal localization analysis of these genes shows that they are relatively evenly distributed across six chromosomes (2A, 2B, 2D, 7A, 7B, 7D). A phylogenetic analysis of SNAP proteins from wheat, rice, and Arabidopsis was conducted, and based on the gene structure of the SNAP family members, these family members were divided into three subfamilies. Members within the same subfamily have similar structures and the same number of exons, suggesting that they may have similar functions [33].
Cis-acting elements are non-coding DNA segments identified within the promoter region of genes [34]. The analysis of these elements among the TaSNAP gene family members has revealed numerous elements associated with plant hormones and responses to abiotic stresses, including abscisic acid (ABA), ethylene, gibberellins, auxins, low temperature, and drought [35]. Among them, the abscisic acid-responsive element-binding proteins (AREBs/ABFs) can bind to the abscisic acid-responsive element (ABRE) and participate in the response to ABA, dehydration, and high salinity stresses.
qRT-PCR was used to analyze the expression patterns of TaSNAP under different tissues and abiotic stress treatments [36]. All eight genes were expressed to varying degrees in all tested tissues, with the highest expression in roots, followed by stems, and varying expression in leaves, spikes, and pollen. This suggests that the salt and drought tolerance of roots is superior to that of other tissues. At the same time, TaSNAP responds to abiotic stresses, but the expression levels vary under different stresses. Under salt stress treatment, the expression of the SNAP family genes was upregulated; under drought stress, TaSNAP1, TaSNAP3, TaSNAP4, TaSNAP5, TaSNAP6, TaSNAP7, and TaSNAP8 were significantly upregulated; except for the TaSNAP5 gene, the other seven genes were upregulated under ABA stress.
Based on the research, it is speculated that the differential expression of the SNAP gene family is related to the response to environmental stresses. For example, the SNAP genes play a role in the response to biotic and abiotic stresses, and different family members have different expression levels under different stresses. The changes in their expression may also be related to the plant’s ability to adapt to different environmental conditions. In summary, this study provides the identification and analysis of wheat SNAP gene family members, including their physicochemical properties, phylogeny, gene structure, chromosomal location, cis-acting elements, and expression patterns, laying a theoretical foundation for further exploration of the role of this gene family in plant stress responses.

5. Conclusions

This study provides the identification and analysis of wheat SNAP gene family members, including their physicochemical properties, phylogeny, gene structure, chromosomal localization, cis-acting elements, and expression patterns. It is speculated that the differential expression of the SNAP gene family is related to the response to environmental stresses, and different family members have varying expression levels under different stresses. The changes in their expression may also be associated with the plant’s ability to adapt to different environmental conditions, providing a theoretical foundation for further exploration of the role of this gene family in plant stress responses.

Author Contributions

X.Z. and Y.B. conceived and designed the experiments. X.Z. drafted the manuscript. X.Z., Y.Y. and Y.S. (Yumeng Sun). performed the experiments. X.Z. and Y.Y. analyzed the data. C.G. and Y.B. contributed to reagents and materials. C.G., Y.B. and Y.S. (Yongjun Shu). reviewed and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Excellent Youth Project of Natural Science Foundation of Heilongjiang Province (Grant No. YQ2022C025), Heilongjiang Postdoctoral Fund to pursue scientific research (Grant No. LBH-Z20159), Doctoral Startup Scientific Research Foundation of Harbin Normal University (Grant No. 370611704).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bao, J.; Xu, J.H. Molecular Research for Cereal Grain Quality. Int. J. Mol. Sci. 2023, 24, 13687. [Google Scholar] [CrossRef] [PubMed]
  2. Gupta, P.K.; Balyan, H.S.; Sharma, S.; Kumar, R. Genetics of yield, abiotic stress tolerance and biofortification in wheat (Triticum aestivum L.). Theor. Appl. Genet. 2020, 133, 1569–1602. [Google Scholar] [CrossRef] [PubMed]
  3. Sharma, P.; Mishra, S.; Pandey, B.; Singh, G. Genome-wide identification and expression analysis of the NHX gene family under salt stress in wheat (Triticum aestivum L.). Front. Plant Sci. 2023, 14, 1266699. [Google Scholar] [CrossRef] [PubMed]
  4. Zhao, Q.; Ma, Y.; Huang, X.; Song, L.; Li, N.; Qiao, M.; Li, T.; Hai, D.; Cheng, Y. GABA Application Enhances Drought Stress Tolerance in Wheat Seedlings (Triticum aestivum L.). Plants 2023, 12, 2495. [Google Scholar] [CrossRef]
  5. Xu, K.; Zhao, Y.; Zhao, S.; Liu, H.; Wang, W.; Zhang, S.; Yang, X. Genome-Wide Identification and Low Temperature Responsive Pattern of Actin Depolymerizing Factor (ADF) Gene Family in Wheat (Triticum aestivum L.). Front. Plant Sci. 2021, 12, 618984. [Google Scholar] [CrossRef]
  6. Yu, M.; Yu, Y.; Guo, S.; Zhang, M.; Li, N.; Zhang, S.; Zhou, H.; Wei, F.; Song, T.; Cheng, J.; et al. Identification of TaBADH-A1 allele for improving drought resistance and salt tolerance in wheat (Triticum aestivum L.). Front. Plant Sci. 2022, 13, 942359. [Google Scholar] [CrossRef]
  7. Yang, J. The development and prospect of saline soil research in China. Acta Pedol. Sin. 2008, 45, 837–845. [Google Scholar]
  8. Wei, B. Distribution and genesis analysis of saline-alkali soils in China. J. Soil Water Conserv. Technol. 2012, 6, 27–28. [Google Scholar]
  9. Zheng, D. Ecological construction issues in the arid areas of Northwest China. In Proceedings of the Symposium on Physical Geography and Ecological Construction; Institute of Geographic Sciences and Natural Resources Research, Chinese Academy of Sciences: Beijing, China, 2006; p. 6. [Google Scholar]
  10. Wang, Y.; Ling, L.; Zhang, W.; Wang, D.; Guo, G. Genome-wide identification and expression analysis of the B-box gene family in wheat. J. Crop Sci. 2021, 47, 1437–1449. [Google Scholar]
  11. Rizo, J. Molecular Mechanisms Underlying Neurotransmitter Release. Annu. Rev. Biophys. 2022, 51, 377–408. [Google Scholar] [CrossRef]
  12. Stenbeck, G. Soluble NSF-attachment proteins. Int. J. Biochem. Cell Biol. 1998, 30, 573–577. [Google Scholar] [CrossRef] [PubMed]
  13. Grote, E.; Novick, P.J. Promiscuity in Rab-SNARE interactions. Mol. Biol. Cell. 1999, 10, 4149–4161. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, X.; Li, Y.; Guo, H.; Wang, Q. Cloning, expression, and bioinformatics analysis of the StSNAP30 gene in potato. Mol. Plant Breed. 2022, 20, 1425–1434. [Google Scholar]
  15. Salinas-Cornejo, J.; Madrid-Espinoza, J.; Verdugo, I.; Pérez-Díaz, J.; Martín-Davison, A.S.; Norambuena, L.; Ruiz-Lara, S. The Exocytosis Associated SNAP25-Type Protein, SlSNAP33, Increases Salt Stress Tolerance by Modulating Endocytosis in Tomato. Plants 2021, 10, 1322. [Google Scholar] [CrossRef]
  16. Bao, Y.M.; Wang, J.F.; Huang, J.; Zhang, H.S. Molecular cloning and characterization of a novel SNAP25-type protein gene OsSNAP32 in rice (Oryza sativa L.). Mol. Biol. Rep. 2008, 35, 145–152. [Google Scholar] [CrossRef]
  17. Heese, M.; Gansel, X.; Sticher, L.; Wick, P.; Grebe, M.; Granier, F.; Jurgens, G. Functional characterization of the KNOLLE-interacting t-SNARE AtSNAP33 and its role in plant cytokinesis. J. Cell Biol. 2001, 155, 239–249. [Google Scholar] [CrossRef]
  18. Wick, P.; Gansel, X.; Oulevey, C.; Page, V.; Studer, I.; Dürst, M.; Sticher, L. The expression of the t-SNARE AtSNAP33 is induced by pathogens and mechanical stimulation. Plant Physiol. 2003, 132, 343–351. [Google Scholar] [CrossRef]
  19. Lei, P.; Wei, X.; Gao, R.; Huo, F.; Nie, X.; Tong, W.; Song, W. Genome-wide identification of PYL gene family in wheat: Evolution, expression and 3D structure analysis. Genomics 2021, 113, 854–866. [Google Scholar] [CrossRef]
  20. Wang, L.; Qin, L.; Sun, X.; Zhao, S.; Yu, L.; Chen, S.; Wang, M. Salt stress-induced changes in soil metabolites promote cadmium transport into wheat tissues. J. Environ. Sci. 2023, 127, 577–588. [Google Scholar] [CrossRef]
  21. Zhao, S.; Zhang, Q.; Liu, M.; Zhou, H.; Ma, C.; Wang, P. Regulation of Plant Responses to Salt Stress. Int. J. Mol. Sci. 2021, 22, 4609. [Google Scholar] [CrossRef]
  22. Bolser, D.; Staines, D.M.; Pritchard, E.; Kersey, P. Ensembl Plants: Integrating Tools for Visualizing, Mining, and Analyzing Plant Genomics Data. Methods Mol. Biol. 2016, 1374, 115–140. [Google Scholar] [PubMed]
  23. Hyeon Jeong, J.; Joo Jung, W.; Weon Seo, Y. Genome-wide identification and expression analysis of the annexin gene family in rye (Secale cereale L.). Gene 2022, 838, 146704. [Google Scholar] [CrossRef] [PubMed]
  24. Bolser, D.M.; Kerhornou, A.; Walts, B.; Kersey, P. Triticeae resources in Ensembl Plants. Plant Cell Physiol. 2015, 56, e3. [Google Scholar] [CrossRef] [PubMed]
  25. Wu, H.; Lv, H.; Li, L.; Liu, J.; Mu, S.; Li, X.; Gao, J. Genome-Wide Analysis of the AP2/ERF Transcription Factors Family and the Expression Patterns of DREB Genes in Moso Bamboo (Phyllostachys edulis). PLoS ONE 2015, 10, e0126657. [Google Scholar] [CrossRef] [PubMed]
  26. Mei, F.; Chen, B.; Du, L.; Li, S.; Zhu, D.; Chen, N.; Zhang, Y.; Li, F.; Wang, Z.; Cheng, X.; et al. A gain-of-function allele of a DREB transcription factor gene ameliorates drought tolerance in wheat. Plant Cell. 2022, 34, 4472–4494. [Google Scholar] [CrossRef]
  27. Zhang, M.; Liu, W.; Bi, Y.P. [Dehydration-responsive element-binding (DREB) transcription factor in plants and its role during abiotic stresses]. Yi Chuan 2009, 31, 236–244. (In Chinese) [Google Scholar] [CrossRef]
  28. Yoon, T.Y.; Munson, M. SNARE complex assembly and disassembly. Curr. Biol. 2018, 28, R397–R401. [Google Scholar] [CrossRef]
  29. Lou, X.; Shin, Y.K. SNARE zippering. Biosci. Rep. 2016, 36, e00327. [Google Scholar] [CrossRef]
  30. Wang, T.; Li, L.; Hong, W. SNARE proteins in membrane trafficking. Traffic 2017, 18, 767–775. [Google Scholar] [CrossRef]
  31. Lakhssassi, N.; Liu, S.; Bekal, S.; Zhou, Z.; Colantonio, V.; Lambert, K.; Barakat, A.; Meksem, K. Characterization of the Soluble NSF Attachment Protein gene family identifies two members involved in additive resistance to a plant pathogen. Sci. Rep. 2017, 24, 45226. [Google Scholar] [CrossRef]
  32. Kádková, A.; Radecke, J.; Jakob; Sørensen, B. The SNAP-25 Protein Family. Neuroscience 2019, 420, 50–71. [Google Scholar] [CrossRef] [PubMed]
  33. Wang, G.; Wang, T.; Jia, Z.H.; Xuan, J.P.; Pan, D.L.; Guo, Z.R.; Zhang, J.Y. Genome-Wide Bioinformatics Analysis of MAPK Gene Family in Kiwifruit (Actinidia chinensis). Int. J. Mol. Sci. 2018, 24, 2510. [Google Scholar] [CrossRef] [PubMed]
  34. Hernandez-Garcia, C.M.; Finer, J.J. Identification and validation of promoters and cis-acting regulatory elements. Plant Sci. 2014, 217–218, 109–119. [Google Scholar] [CrossRef] [PubMed]
  35. Furihata, T.; Maruyama, K.; Fujita, Y.; Umezawa, T.; Yoshida, R.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Abscisic acid-dependent multisite phosphorylation regulates the activity of a transcription activator AREB1. Proc. Natl. Acad. Sci. USA 2006, 103, 1988–1993. [Google Scholar] [CrossRef]
  36. Ma, H.; Bell, K.N.; Loker, R.N. qPCR and qRT-PCR analysis: Regulatory points to consider when conducting biodistribution and vector shedding studies. Mol. Ther. Methods Clin. Dev. 2020, 17, 152–168. [Google Scholar] [CrossRef]
Genes 15 01311 g001
Figure 1. The unrooted phylogenetic tree of SNAP gene family in wheat and the phylogenetic tree of SNAP proteins in Arabidopsis, wheat, and rice. The NJ tree was constructed using the TaSNAP amino acid sequence with MEGA software (version 11.0.13) and 1000 bootstrap repetitions. Wheat SNAP proteins were divided into three groups (Group I marked with blue solid circles, Group II marked with yellow solid circles, and Group III marked with green solid circles; red solid circles do not contain wheat SNAP proteins, so they were not included in the grouping). The numbers at the nodes are bootstrap values, representing support levels.
Figure 1. The unrooted phylogenetic tree of SNAP gene family in wheat and the phylogenetic tree of SNAP proteins in Arabidopsis, wheat, and rice. The NJ tree was constructed using the TaSNAP amino acid sequence with MEGA software (version 11.0.13) and 1000 bootstrap repetitions. Wheat SNAP proteins were divided into three groups (Group I marked with blue solid circles, Group II marked with yellow solid circles, and Group III marked with green solid circles; red solid circles do not contain wheat SNAP proteins, so they were not included in the grouping). The numbers at the nodes are bootstrap values, representing support levels.
Genes 15 01311 g001
Genes 15 01311 g002aGenes 15 01311 g002b
Figure 2. (A) presents the phylogenetic and gene structure analysis of TaSNAP, while (B) shows the protein structure analysis of TaSNAP. Through the results, the grouping and function of TaSNAP are analyzed. (A): Phylogenetic tree; gene structure; (B): protein structure; (C): conserved domains of B-box genes family in wheat.
Figure 2. (A) presents the phylogenetic and gene structure analysis of TaSNAP, while (B) shows the protein structure analysis of TaSNAP. Through the results, the grouping and function of TaSNAP are analyzed. (A): Phylogenetic tree; gene structure; (B): protein structure; (C): conserved domains of B-box genes family in wheat.
Genes 15 01311 g002aGenes 15 01311 g002b
Genes 15 01311 g003
Figure 3. The chromosome location of the SNAP gene family in wheat.
Figure 3. The chromosome location of the SNAP gene family in wheat.
Genes 15 01311 g003
Genes 15 01311 g004
Figure 4. Cis-acting element analysis of TaSNAP.
Figure 4. Cis-acting element analysis of TaSNAP.
Genes 15 01311 g004
Genes 15 01311 g005
Figure 5. Expression profile of TaSNAP gene family in different tissues of wheat. a: root; b: stem; c: leaf; d: spike; e: pollen.
Figure 5. Expression profile of TaSNAP gene family in different tissues of wheat. a: root; b: stem; c: leaf; d: spike; e: pollen.
Genes 15 01311 g005
Genes 15 01311 g006
Figure 6. Expression profile of SNAP gene family under different treatments in wheat. Note: a: control; b: six hours of 0.2 mol L−1 NaCl treatment; c: six hours of 100 μmol L−1 ABA treatment; d: six hours of 20% PEG treatment.
Figure 6. Expression profile of SNAP gene family under different treatments in wheat. Note: a: control; b: six hours of 0.2 mol L−1 NaCl treatment; c: six hours of 100 μmol L−1 ABA treatment; d: six hours of 20% PEG treatment.
Genes 15 01311 g006
Table 1. Primers for quantitative real-time PCR of TaSNAP family.
Table 1. Primers for quantitative real-time PCR of TaSNAP family.
Gene NameForward Primer (5′–3′)Reverse Primer (5′–3′)
TaSNAP1GCCAAGGCCGACAAACTAGCATCCCACGGTGATGAG
TaSNAP2CCGACCTAGCCGAGTTCCAATCCCACGCACTTCCGTTT
TaSNAP3GAAGAGTGCTACCGCCTTGTGTCGGAAACTTCATTCCAGAGT
TaSNAP4AGAGTGCTACCGCCTTGTCATCAGAGGCAGGTTGTG
TaSNAP5TATGTGGAAGCCGCAAACCGGCCCTTTCTAGGTAATC
TaSNAP6CCGCCGACCTATACGATAGCAGCCATGCTCAATCTAC
TaSNAP7TGGAGTTAGCCGAGTTCTACATGCCGGTGGAGTAGTTGAAAGGAA
TaSNAP8CCGCCGACCTATACGATAGCAGCCATGCTCAATCTAC
Table 2. TaSNAP gene information identified in the wheat genome.
Table 2. TaSNAP gene information identified in the wheat genome.
Gene NameGene IDCoded Amino AcidsIsoelectric
Point		Molecular WeightLength
(aa)		Group
TaSNAP1TraesCS2A02G461600.12984.9733083.88899II
TaSNAP2TraesCS2B02G109300.13307.9237561.43995I
TaSNAP3TraesCS2B02G483200.12985.0333025.84899II
TaSNAP4TraesCS2D02G461500.12865.0831782.45863II
TaSNAP5TraesCS7A02G292400.12894.8732473.27872III
TaSNAP6TraesCS7B02G182700.12894.8732505.33872III
TaSNAP7TraesCS7D02G170100.12965.1834045.13893I
TaSNAP8TraesCS7D02G284600.13014.8733725.76906III
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, X.; Yu, Y.; Sun, Y.; Bai, Y.; Shu, Y.; Guo, C. Genome-Wide Identification and Expression Analysis of SNAP Gene Family in Wheat. Genes 2024, 15, 1311. https://doi.org/10.3390/genes15101311

AMA Style

Zhang X, Yu Y, Sun Y, Bai Y, Shu Y, Guo C. Genome-Wide Identification and Expression Analysis of SNAP Gene Family in Wheat. Genes. 2024; 15(10):1311. https://doi.org/10.3390/genes15101311

Chicago/Turabian Style

Zhang, Xiaohan, Yanan Yu, Yumeng Sun, Yan Bai, Yongjun Shu, and Changhong Guo. 2024. "Genome-Wide Identification and Expression Analysis of SNAP Gene Family in Wheat" Genes 15, no. 10: 1311. https://doi.org/10.3390/genes15101311

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop