Influence and Optimization of Diverse Culture Systems on Chicken Embryonic Stem Cell Culture
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fertilized Eggs and Animal Care
2.2. Cell Culture Media
2.3. Preparation of Feeder Layers
2.4. Isolation and Culture of Blastodermal Cells (BCs)
2.5. Alkaline Phosphatase (AKP) Staining
2.6. Formation and In Vitro Differentiation of Embryoid Bodies (EBs)
2.7. RNA Isolation and Reverse Transcription
2.8. PCR and Agarose Gel Electrophoresis
2.9. Quantitative Real-Time PCR (qRT-PCR)
2.10. Immunofluorescence and Confocal Microscopy
2.11. Statistical Analysis
3. Results
3.1. Influence of Diverse Culture Systems on Chicken ESC Culture
3.2. Prolonging the Maintenance of Chicken ESCs by Adding SCF and bFGF
3.3. Maintaining the Pluripotency of Chicken BCs Under the RLSF Culture Conditions
3.4. ESC-Like Cells Cultured Under RLSF Conditions Exhibit Differentiation Potential
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kagami, H. Perspectives on Avian Stem Cells for Poultry Breeding. Anim. Sci. J. Nihon Chikusan Gakkaiho 2016, 87, 1065–1075. [Google Scholar] [CrossRef] [PubMed]
- Farzaneh, M.; Hassani, S.-N.; Mozdziak, P.; Baharvand, H. Avian Embryos and Related Cell Lines: A Convenient Platform for Recombinant Proteins and Vaccine Production. Biotechnol. J. 2017, 12, 1600598. [Google Scholar] [CrossRef] [PubMed]
- Bednarczyk, M.; Kozłowska, I.; Łakota, P.; Szczerba, A.; Stadnicka, K.; Kuwana, T. Generation of Transgenic Chickens by the Non-Viral, Cell-Based Method: Effectiveness of Some Elements of This Strategy. J. Appl. Genet. 2018, 59, 81–89. [Google Scholar] [CrossRef]
- Giotis, E.S.; Montillet, G.; Pain, B.; Skinner, M.A. Chicken Embryonic-Stem Cells Are Permissive to Poxvirus Recombinant Vaccine Vectors. Genes 2019, 10, 237. [Google Scholar] [CrossRef]
- Bogliotti, Y.S.; Wu, J.; Vilarino, M.; Okamura, D.; Soto, D.A.; Zhong, C.; Sakurai, M.; Sampaio, R.V.; Suzuki, K.; Izpisua Belmonte, J.C.; et al. Efficient Derivation of Stable Primed Pluripotent Embryonic Stem Cells from Bovine Blastocysts. Proc. Natl. Acad. Sci. USA 2018, 115, 2090–2095. [Google Scholar] [CrossRef]
- Thomson, J.A.; Itskovitz-Eldor, J.; Shapiro, S.S.; Waknitz, M.A.; Swiergiel, J.J.; Marshall, V.S.; Jones, J.M. Embryonic Stem Cell Lines Derived from Human Blastocysts. Sci. New Ser. 1998, 282, 1145–1147. [Google Scholar] [CrossRef]
- Beattie, G.M.; Lopez, A.D.; Bucay, N.; Hinton, A.; Firpo, M.T.; King, C.C.; Hayek, A. Activin A Maintains Pluripotency of Human Embryonic Stem Cells in the Absence of Feeder Layers. Stem Cells 2005, 23, 489–495. [Google Scholar] [CrossRef]
- Aubel, P.; Pain, B. Chicken Embryonic Stem Cells: Establishment and Characterization. In Epiblast Stem Cells; Alberio, R., Ed.; Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2013; Volume 1074, pp. 137–150. ISBN 978-1-62703-627-6. [Google Scholar]
- Nakano, M.; Arisawa, K.; Yokoyama, S.; Nishimoto, M.; Yamashita, Y.; Sakashita, M.; Ezaki, R.; Matsuda, H.; Furusawa, S.; Horiuchi, H. Characteristics of Novel Chicken Embryonic Stem Cells Established Using Chicken Leukemia Inhibitory Factor. J. Poult. Sci. 2011, 48, 64–72. [Google Scholar] [CrossRef]
- Farzaneh, M.; Zare, M.; Hassani, S.-N.; Baharvand, H. Effects of Various Culture Conditions on Pluripotent Stem Cell Derivation from Chick Embryos. J. Cell. Biochem. 2018, 119, 6325–6336. [Google Scholar] [CrossRef]
- Steiner, D.; Khaner, H.; Cohen, M.; Even-Ram, S.; Gil, Y.; Itsykson, P.; Turetsky, T.; Idelson, M.; Aizenman, E.; Ram, R.; et al. Derivation, Propagation and Controlled Differentiation of Human Embryonic Stem Cells in Suspension. Nat. Biotechnol. 2010, 28, 361–364. [Google Scholar] [CrossRef]
- Llames, S.; García-Pérez, E.; Meana, Á.; Larcher, F.; del Río, M. Feeder Layer Cell Actions and Applications. Tissue Eng. Part B Rev. 2015, 21, 345–353. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Zhang, H.; Zhao, Y.; Li, J.; Cai, J.; Wang, P.; Meng, S.; Feng, J.; Miao, C.; Ding, M.; et al. Noggin and bFGF Cooperate to Maintain the Pluripotency of Human Embryonic Stem Cells in the Absence of Feeder Layers. Biochem. Biophys. Res. Commun. 2005, 330, 934–942. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Wu, Y.; Li, X.; Wei, S.; Xing, Y.; Lian, Z.; Han, H. An Alternative Method for Long-Term Culture of Chicken Embryonic Stem Cell In Vitro. Stem Cells Int. 2018, 2018, 2157451. [Google Scholar] [CrossRef] [PubMed]
- Hassani, S.-N.; Totonchi, M.; Farrokhi, A.; Taei, A.; Larijani, M.R.; Gourabi, H.; Baharvand, H. Simultaneous Suppression of TGF-β and ERK Signaling Contributes to the Highly Efficient and Reproducible Generation of Mouse Embryonic Stem Cells from Previously Considered Refractory and Non-Permissive Strains. Stem Cell Rev. Rep. 2012, 8, 472–481. [Google Scholar] [CrossRef]
- Hassani, S.-N.; Pakzad, M.; Asgari, B.; Taei, A.; Baharvand, H. Suppression of Transforming Growth Factor β Signaling Promotes Ground State Pluripotency from Single Blastomeres. Hum. Reprod. 2014, 29, 1739–1748. [Google Scholar] [CrossRef]
- Kinoshita, M.; Barber, M.; Mansfield, W.; Cui, Y.; Spindlow, D.; Stirparo, G.G.; Dietmann, S.; Nichols, J.; Smith, A. Capture of Mouse and Human Stem Cells with Features of Formative Pluripotency. Cell Stem Cell 2021, 28, 453–471.e8. [Google Scholar] [CrossRef]
- Gao, X.; Nowak-Imialek, M.; Chen, X.; Chen, D.; Herrmann, D.; Ruan, D.; Chen, A.C.H.; Eckersley-Maslin, M.A.; Ahmad, S.; Lee, Y.L.; et al. Establishment of Porcine and Human Expanded Potential Stem Cells. Nat. Cell Biol. 2019, 21, 687–699. [Google Scholar] [CrossRef]
- van de Lavoir, M.; Mather-Love, C. Avian Embryonic Stem Cells. In Methods in Enzymology; Elsevier: Amsterdam, The Netherlands, 2006; Volume 418, pp. 38–64. ISBN 978-0-12-373648-2. [Google Scholar]
- Piedrahita, J.A.; Moore, K.; Oetama, B.; Lee, C.K.; Scales, N.; Ramsoondar, J.; Bazer, F.W.; Ott, T. Generation of Transgenic Porcine Chimeras Using Primordial Germ Cell-Derived Colonies. Biol. Reprod. 1998, 58, 1321–1329. [Google Scholar] [CrossRef]
- Chen, Y.-C.; Chang, W.-C.; Lin, S.-P.; Minami, M.; Jean, C.; Hayashi, H.; Rival-Gervier, S.; Kanaki, T.; Wu, S.-C.; Pain, B. Three-Dimensional Culture of Chicken Primordial Germ Cells (cPGCs) in Defined Media Containing the Functional Polymer FP003. PLoS ONE 2018, 13, e0200515. [Google Scholar] [CrossRef]
- Whyte, J.; Glover, J.D.; Woodcock, M.; Brzeszczynska, J.; Taylor, L.; Sherman, A.; Kaiser, P.; McGrew, M.J. FGF, Insulin, and SMAD Signaling Cooperate for Avian Primordial Germ Cell Self-Renewal. Stem Cell Rep. 2015, 5, 1171–1182. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- van de Lavoir, M.-C.; Mather-Love, C.; Leighton, P.; Diamond, J.H.; Heyer, B.S.; Roberts, R.; Zhu, L.; Winters-Digiacinto, P.; Kerchner, A.; Gessaro, T.; et al. High-Grade Transgenic Somatic Chimeras from Chicken Embryonic Stem Cells. Mech. Dev. 2006, 123, 31–41. [Google Scholar] [CrossRef] [PubMed]
- Park, T.S.; Han, J.Y. Derivation and Characterization of Pluripotent Embryonic Germ Cells in Chicken. Mol. Reprod. Dev. 2000, 56, 475–482. [Google Scholar] [CrossRef] [PubMed]
- van de Lavoir, M.-C.; Diamond, J.H.; Leighton, P.A.; Mather-Love, C.; Heyer, B.S.; Bradshaw, R.; Kerchner, A.; Hooi, L.T.; Gessaro, T.M.; Swanberg, S.E.; et al. Germline Transmission of Genetically Modified Primordial Germ Cells. Nature 2006, 441, 766–769. [Google Scholar] [CrossRef] [PubMed]
- Cogburn, L.A.; Porter, T.E.; Duclos, M.J.; Simon, J.; Burgess, S.C.; Zhu, J.J.; Cheng, H.H.; Dodgson, J.B.; Burnside, J. Functional Genomics of the Chicken--a Model Organism. Poult. Sci. 2007, 86, 2059–2094. [Google Scholar] [CrossRef]
- Kraus, B.; von Fircks, S.; Feigl, S.; Koch, S.M.; Fleischanderl, D.; Terler, K.; Dersch-Pourmojib, M.; Konetschny, C.; Grillberger, L.; Reiter, M. Avian Cell Line—Technology for Large Scale Vaccine Production. BMC Proc. 2011, 5 (Suppl. 8), 52. [Google Scholar] [CrossRef]
- Farzaneh, M. Concise Review: Avian Multipotent Stem Cells as a Novel Tool for Investigating Cell-Based Therapies. J. Dairy Vet. Anim. Res. 2017, 5, 00125. [Google Scholar] [CrossRef]
- Horiuchi, H.; Furusawa, S.; Matsuda, H. Maintenance of Chicken Embryonic Stem Cells in Vitro. Methods Mol. Biol. Clifton NJ 2006, 329, 17–34. [Google Scholar] [CrossRef]
- Pain, B.; Clark, M.E.; Shen, M.; Nakazawa, H.; Sakurai, M.; Samarut, J.; Etches, R.J. Long-Term in Vitro Culture and Characterisation of Avian Embryonic Stem Cells with Multiple Morphogenetic Potentialities. Development 1996, 122, 2339–2348. [Google Scholar] [CrossRef]
- Greber, B.; Lehrach, H.; Adjaye, J. Fibroblast Growth Factor 2 Modulates Transforming Growth Factor Beta Signaling in Mouse Embryonic Fibroblasts and Human ESCs (hESCs) to Support hESC Self-Renewal. Stem Cells Dayt. Ohio 2007, 25, 455–464. [Google Scholar] [CrossRef]
- James, D.; Levine, A.J.; Besser, D.; Hemmati-Brivanlou, A. TGFbeta/Activin/Nodal Signaling Is Necessary for the Maintenance of Pluripotency in Human Embryonic Stem Cells. Dev. Camb. Engl. 2005, 132, 1273–1282. [Google Scholar] [CrossRef]
- Vallier, L.; Alexander, M.; Pedersen, R.A. Activin/Nodal and FGF Pathways Cooperate to Maintain Pluripotency of Human Embryonic Stem Cells. J. Cell Sci. 2005, 118, 4495–4509. [Google Scholar] [CrossRef] [PubMed]
- Srihawong, T.; Kuwana, T.; Siripattarapravat, K.; Tirawattanawanich, C. Chicken Primordial Germ Cell Motility in Response to Stem Cell Factor Sensing. Int. J. Dev. Biol. 2015, 59, 453–460. [Google Scholar] [CrossRef] [PubMed]
- Jean, C.; Aubel, P.; Soleihavoup, C.; Bouhallier, F.; Voisin, S.; Lavial, F.; Pain, B. Pluripotent Genes in Avian Stem Cells. Dev. Growth Differ. 2013, 55, 41–51. [Google Scholar] [CrossRef]
Gene | Primer Sequence | Annealing Temp. | Product Size (bp) | Reference |
---|---|---|---|---|
POUV F | GTTGTCCGGGTCTGGTTCT | 60 °C | 189 | [21] |
POUV R | GTGGAAAGGTGGCATGTAGAC | |||
SOX2 F | GTGAACCAGAGGATGGACAGTTACG | 60 °C | 185 | [22] |
SOX2 R | TGCGAGCTGGTCATGGAGTTG | |||
NANOG F | GGTTTCAGAACCAACGGATG | 60 °C | 121 | [21] |
NANOG R | GTGGGGGGTCATATCCAGGTA | |||
PAX6 F | GAGAACCCACTATCCCGATGT | 60 °C | 200 | — |
PAX6 R | GGTAAACGCTTGTGCTGAAAC | |||
HNF1A F | AGCCAGAACCTACTGAGCAC | 60 °C | 288 | — |
HNF1A R | GCTCCCCATGCTGTTTATCAC | |||
PPARA F | AATCACCCAGTGGAGCAGAAA | 60 °C | 266 | — |
PPARA R | CTCAGACCTTGGCATTCGTC | |||
GAPDH F | GAGGGTAGTGAAGGCTGCTG | 60 °C | 113 | [21] |
GAPDH R | CATCAAAGGTGGAGGAATGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ren, W.; Wu, J.; Lu, X.; Zheng, D.; Liu, G.; Wu, G.; Peng, Y.; Jin, K.; Li, G.; Han, W.; et al. Influence and Optimization of Diverse Culture Systems on Chicken Embryonic Stem Cell Culture. Genes 2024, 15, 1400. https://doi.org/10.3390/genes15111400
Ren W, Wu J, Lu X, Zheng D, Liu G, Wu G, Peng Y, Jin K, Li G, Han W, et al. Influence and Optimization of Diverse Culture Systems on Chicken Embryonic Stem Cell Culture. Genes. 2024; 15(11):1400. https://doi.org/10.3390/genes15111400
Chicago/Turabian StyleRen, Wenjie, Jun Wu, Xiaohang Lu, Dan Zheng, Guangzheng Liu, Gaoyuan Wu, Yixiu Peng, Kai Jin, Guohui Li, Wei Han, and et al. 2024. "Influence and Optimization of Diverse Culture Systems on Chicken Embryonic Stem Cell Culture" Genes 15, no. 11: 1400. https://doi.org/10.3390/genes15111400
APA StyleRen, W., Wu, J., Lu, X., Zheng, D., Liu, G., Wu, G., Peng, Y., Jin, K., Li, G., Han, W., Cui, X.-S., Chen, G., Li, B., & Niu, Y.-J. (2024). Influence and Optimization of Diverse Culture Systems on Chicken Embryonic Stem Cell Culture. Genes, 15(11), 1400. https://doi.org/10.3390/genes15111400