Molecular and Functional Assessment of TSC1 and TSC2 in Individuals with Tuberous Sclerosis Complex
by
, , , ,
Luiz Gustavo Dufner-Almeida
1,2
,
Laís F. M. Cardozo
3,
Mariana R. Schwind
3,
Danielly Carvalho
3,
Juliana Paula G. Almeida
4,
Andrea Maria Cappellano
5,
Thiago G. P. Alegria
1,
Santoesha Nanhoe
2,
Mark Nellist
2,
Maria Rita Passos-Bueno
1,
Silvana Chiavegatto
6,7,
Nasjla S. Silva
5,
Sérgio Rosemberg
4,
Ana Paula A. Pereira
8,
Sérgio Antônio Antoniuk
3 and
Luciana A. Haddad
1,* 1
Human Genome and Stem Cell Research Center, Department of Genetics and Evolutionary Biology, Instituto de Biociências, Universidade de São Paulo, São Paulo 05508-090, Brazil
2
Department of Clinical Genetics, Erasmus Medical Center, 3015 Rotterdam, The Netherlands
3
Pediatric Neurology Center, Department of Pediatrics, Hospital de Clínicas, Universidade Federal do Paraná, Curitiba 80060-900, Brazil
4
Division of Neurology, Department of Pediatrics, Santa Casa de Misericórdia, São Paulo 01221-010, Brazil
5
Grupo de Apoio ao Adolescente e à Criança com Câncer, Instituto de Oncologia Pediátrica, Universidade Federal de São Paulo, São Paulo 04039-001, Brazil
6
Department of Pharmacology, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo 05508-000, Brazil
7
Department of Psychiatry, Instituto de Psiquiatria, Faculdade de Medicina da Universidade de São Paulo, São Paulo 05403-903, Brazil
8
Department of Psychology, Universidade Federal do Paraná, Curitiba 80060-000, Brazil
*
Author to whom correspondence should be addressed.
Genes 2024, 15(11), 1432; https://doi.org/10.3390/genes15111432
Submission received: 14 June 2024
/
Revised: 8 July 2024
/
Accepted: 9 July 2024
/
Published: 3 November 2024
(This article belongs to the Special Issue Molecular Genetics of Neurodevelopmental Disorders)
Abstract
:Tuberous sclerosis complex (TSC) is an autosomal dominant neurodevelopmental disorder and multisystem disease caused by pathogenic DNA alterations in the TSC1 and TSC2 tumor suppressor genes. A molecular genetic diagnosis of TSC confirms the clinical diagnosis, facilitating the implementation of appropriate care and surveillance. TSC1 and TSC2 encode the core components of the TSC1/2 complex (TSC1/2), a negative regulator of the mechanistic target of rapamycin (MTOR) complex 1 (TORC1). Functional analysis of the effects of TSC1 and TSC2 variants on TORC1 activity can help establish variant pathogenicity. We searched for pathogenic alterations to TSC1 and TSC2 in DNA isolated from 116 individuals with a definite clinical diagnosis of TSC. Missense variants and in-frame deletions were functionally assessed. Pathogenic DNA alterations were identified in 106 cases (91%); 18 (17%) in TSC1 and 88 (83%) in TSC2. Of these, 35 were novel. Disruption of TSC1/2 activity was demonstrated for seven TSC2 variants. Molecular diagnostics confirms the clinical diagnosis of TSC in a large proportion of cases. Functional assessment can help establish variant pathogenicity and is a useful adjunct to DNA analysis.
1. Introduction
Tuberous sclerosis complex (TSC) is a neurodevelopmental disorder and multisystem disease with autosomal dominant inheritance, characterized by brain hamartia (cortical tubers and heterotopic neurons) and hamartomas in multiple organs [1,2]. TSC affects 1:6000–10,000 individuals [1,3,4,5] and is caused by inactivating mutations to the TSC1 or TSC2 tumor suppressor genes [6,7]. TSC1 (NG_012386.1, MIM#605284) maps to 9q34.1, comprises 23 exons, and encodes the TSC1 protein, hamartin (NP_000359.1). TSC2 (NG_005895.1, MIM#191092) maps to 16p13.3, consists of 42 exons, and encodes the TSC2 protein, tuberin (NP_000539.2). TSC1 and TSC2 are the core components of the TSC molecular complex (TSC1/2), a critical negative regulator of the mechanistic target of rapamycin (mTOR) complex 1 (TORC1). The TSC1/2 is a GTPase-activating protein (GAP) specific for the small GTPase Ras homologue enriched in brain (RHEB). Inactivation of the TSC1/2 results in increased levels of RHEB-GTP, activation of TORC1 kinase activity, and the phosphorylation of downstream TORC1 targets, including p70 S6 kinase (S6K), thus leading to up-regulation of anabolic metabolism and excessive cell growth [8,9,10].
TSC diagnostics has evolved since Gómez first established a broad set of clinical diagnostic criteria [1,11]. In 2012, the International TSC Clinical Consensus Group updated the clinical criteria for TSC and proposed the genetic diagnostic criterion, whereby detection of a pathogenic DNA variant in either the TSC1 or TSC2 gene in normal tissue is sufficient for a definite diagnosis of TSC if it prevents protein synthesis or hyperactivates TORC1 according to a functional assay [1,2]. Genetic testing can confirm the clinical definite and possible diagnoses of TSC, allowing early implementation of clinical surveillance and appropriate treatment [2].
Current molecular diagnostic tests identify a pathogenic TSC1 or TSC2 variant in nearly 90% of patients with a definite clinical diagnosis of TSC [12], and studies indicate that clinically diagnosed TSC patients with ‘no mutation identified’ (NMI) are most likely to carry either a somatic, mosaic mutation, or a deep intronic variant that affects splicing [13,14,15,16,17,18,19]. In some cases, variants of uncertain clinical significance (VUSs) are identified in individuals with TSC. Functional assessment of the effects of DNA alterations on pre-mRNA splicing and/or TSC1/2 activity can help establish pathogenicity and provide information on how DNA alterations affect the formation, stability, and activity of the TSC1/2.
We conducted a descriptive study on molecular alterations to TSC1 and TSC2 in a cohort of 116 Brazilian individuals who had previously received a definite clinical diagnosis of TSC. In 106 cases (91%), a pathogenic TSC1 or TSC2 alteration was identified, including single nucleotide changes and large genomic rearrangements. To support pathogenicity, we evaluated the effects of specific missense and in-frame deletion variants on mTORC1 activity using in vitro functional analysis, demonstrating the importance of specific amino acid residues in TSC2 for TSC1/2 function.
2. Materials and Methods
2.1. Ethical Considerations
This study was approved by the Institutional Ethics Review Boards of the four participating institutions (main protocols under certificate of presentation for ethical consideration numbers CAAE 12572913.3.0000.5464 and CAAE 48259715.2.0000.5464). All patients had informed consent signed by a parent or tutor to provide a blood sample for DNA extraction and analysis.
2.2. Patient Cohort
A definite clinical diagnosis of TSC [1,2] was the only inclusion criterion. Individuals were referred for testing from three clinical centers: 74 were referred from the Clinics Hospital of the Universidade Federal do Paraná (UFPR), Curitiba, Brazil; 23 from the Child Neurology service of São Paulo Santa Casa de Misericórdia (SPSC), São Paulo, Brazil; and 19 from Grupo de Apoio ao Adolescente e Criança com Câncer (GRAACC), São Paulo, Brazil. Genetic counseling was offered to all families.
2.3. DNA Analysis
Peripheral blood samples (4 mL) were harvested by venipuncture and sent to the University of São Paulo (Instituto de Biociências, University of São Paulo, São Paulo, Brazil) for molecular testing. Genomic DNA was extracted from peripheral blood leukocytes using the QIASymphony kit (QIAGEN, Germantown, MD, USA) and quantified on a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Analysis of subject DNA samples was performed over an extended period (years 2014–2022), following the arrival of the samples to the laboratory. The choice of the DNA sequencing method, either Sanger or next-generation sequencing (NGS), was solely based on accessibility to equipment. All samples that did not have TSC1 and TSC2 sequences fully sequenced by the Sanger method were submitted to NGS.
2.4. PCR and Sanger Sequencing
Oligonucleotides for PCR and Sanger sequencing were designed with Primer3 v. 0.4.0 [20]. PCR amplicons covered all exons, intron boundaries, and the core promoter regions of both TSC1 (NG_012386.1) and TSC2 (NG_005895.1) (Appendix A Table A1 and Table A2). For TSC1, the sequenced region consisted of ~9.4 kb of the total genomic locus (60 kb; ~16%), including 517 bp of the core promoter [21] and upstream sequences, 3.5 kb of exonic sequences, and 5.4 kb of intronic sequences. For TSC2, the sequenced region consisted of ~17.8 kb (46 kb; ~39%), including 485 bp of the core promoter and upstream sequence, 5.6 kb of exonic sequences, and 11.7 kb of intronic sequences. Coding sequence annotation was according to reference transcripts NM_000368.4 (TSC1) and NM_000548.3 (TSC2). Primer specificity was tested against the human genome build GRCh37/hg19 with the BLAT program (UCSC Genome Browser, http://genome.ucsc.edu/cgi-bin/hgBlat?command=start, accessed on 13 June 2024) and nucleotide BLAST (BLAST NCBI, http://blast.ncbi.nlm.nih.gov, accessed on 13 June 2024). The conditions for each PCR were standardized with DNA samples from three unrelated non-TSC individuals (non-TSC control). For segments with a high proportion of cytosine and guanine, we adopted the slowdown PCR protocol [22]. PCR products were electrophoresed on 1.5% agarose gels and images were captured on a Gel Doc™ EZ System using Image Lab™ software (Version 6.1; Bio-Rad, Hercules, CA, USA). For Sanger sequencing, PCR products were treated with exonuclease I/shrimp alkaline phosphatase (5U:1U; Affymetrix, Santa Clara, CA, USA) for 60 min at 37 °C, followed by enzymatic inactivation for 15 min at 60 °C, prior to Sanger sequencing according to the ABI BigDye terminator protocol (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). Reaction products were purified using Sephadex columns (Cytiva Life Sciences, Wilmington, DE, USA) and submitted to capillary electrophoresis on an ABI 3730xl DNA Analyzer (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). The results were analyzed using Sequencher 5.3 (Gene Codes Corporation, Ann Arbor, MI, USA).
2.5. Next-Generation Sequencing (NGS)
For NGS, DNA library preparation and capture of coding and intronic boundary sequences for both TSC1 and TSC2 were performed using Nextera rapid capture (Illumina, San Diego, CA, USA) with specific probes designed as part of a custom gene panel. The library was quantified using the Qubit 2.0 fluorometer (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) and Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA), and sequencing was performed on the MiSeq platform (Illumina, San Diego, CA, USA), employing a mean read depth of 195.26 (standard deviation [sd]: 34.18). An average >99.3% coverage of target regions at a minimum depth of 10 reads per nucleotide and >98.9% coverage at depth of 20 reads were obtained (Appendix A Table A3). A minimum threshold of 20 reads and a variant allele frequency (VAF) >40% were employed. VUSs, probable pathogenic, or pathogenic variants detected by NGS were confirmed by PCR followed by Sanger sequencing. All reads were aligned to the human genome (build GRCh37/hg19) using the BWA algorithm [23], followed by GATK [24] and ANNOVAR variant calling and annotation [25].
2.6. Multiplex Ligation-Dependent Probe Amplification (MLPA)
The SALSA MLPA kits P124-C1 TSC1 and P046-C1 TSC2 (MRC-Holland, Amsterdam, The Netherlands) were used for detection of duplications and deletions affecting TSC1 and TSC2, essentially as described previously [15,26,27]. Three non-TSC control samples were used as reference samples. Ligated products were separated by capillary electrophoresis on an ABI 3730xl DNA Analyzer (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) and analyzed using Coffalyser.NET software (MRC-Holland, Amsterdam, The Netherlands). Signal intensities were compared per subject using Student’s t test (p value < 0.05). Peak heights of <0.70 or >1.30 were considered deletion or duplication of a probe. Reductions or increases in peak height resulting in values between 0.70 and 1 or 1 and 1.30, respectively, were considered indicative of mosaicism and confirmed by quantitative PCR [28].
2.7. Quantitative PCR
Quantitative PCR (qPCR) was employed to validate MLPA data and to further assess the extension of the segmental deletions and duplication. It was performed as described previously [29] using the SYBR Green system (Applied Biosystems) on a 7500 Fast Real-Time PCR System apparatus (Applied Biosystems). Primers were designed using Primer-Blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 13 June 2024) and tested in silico with the Beacon Designer Free Edition (http://www.premierbiosoft.com/qOligo/Oligo.jsp?PID=1, accessed on 13 June 2024), Blat-UCSC Genome Browser (GRCh37/hg19 assembly), and BLAST-NCBI (Appendix A Table A4). Optimal DNA and primer concentrations were determined by titration, leading to the following conditions for a 12 µL reaction: 25 ng DNA and 4 pmol of each primer with 6 µL PCR SYBR Green master mix. A non-TSC control sample was used as reference. Amplification parameters were 95 °C for 10 min, followed by 30 cycles at 95 °C for 15 s and 60 °C for 60 s, with fluorescence acquisition at the end of each step. A melting step (dissociation curve) was performed following each run to confirm product specificity and the absence of primer dimers. For copy number calibration, the reaction was normalized to GADPH (Glyceraldehyde-3-phosphate dehydrogenase, NM_002046.1, human chromosome 12). All samples were run in triplicate, and the data were analyzed using the comparative ΔΔCt cycle threshold method. A ratio coefficient (RQ) between 0.7 and 1 was considered indicative of mosaic deletion. Student’s t test with significance for p value < 0.05 was applied to compare test and reference sample results.
2.8. In Silico Analysis and Structural Assessment of DNA Variants
Variant nomenclature was noted according to the recommendations of the Human Genome Variation Society (HGVS) and was checked using both the Variant Validator (University of Leicester [30]) and Mutalyzer (LUMC [31]) web tools. Pathogenic DNA variants were defined according to ACMG standards and guidelines [32].
All DNA variants were submitted to the Variant Effect Predictor (VEP) web tool (https://www.ensembl.org/Tools/VEP, accessed on 13 June 2024) and allele frequencies were verified in databases of human population sequence variants (1000 Genomes, gnomAD, ExaC and ABraOM). In addition, variants were evaluated by comparison with the TSC1 and TSC2 Leiden Open Variation Databases (LOVD) (Version 2; Leiden, The Netherlands), Ensembl (http://www.ensembl.org/index.html, release 93—July 2018) [33], PolyPhen-2 [34], Mutation Taster [35], SIFT [36,37], PROVEAN [38], PhosphositePlus [39], Alamut Visual (Interactive biosoftware, version 2.7-1). The Combined Annotation Dependent Depletion (CADD—v1.6) was calculated for all SNVs (single nucleotide variants) using the webtool CADD (https://cadd.gs.washington.edu/, accessed on 13 June 2024) [40]. In silico analysis of variants potentially affecting pre-mRNA splicing was performed using Acescan2, SpliceAid2 [41], Human Splicing Finder [42], and Alamut Visual. To identify repetitive elements, RepeatMasker (Version open-3.0, Institute for Systems Biology, Seattle, WA, USA) was used. Final assessment of DNA variants was in June 2024. Information on all identified DNA variants has been deposited in the TSC1 and TSC2 LOVD (https://www.lovd.nl/TSC1; https://www.lovd.nl/TSC2) and ABraOM (https://abraom.ib.usp.br/, accessed on 13 June 2024) databases.
Alignment of the Homo sapiens TSC2 (NP_000539.2) and Homo sapiens RAP1GAP (NP_001337453.1) GAP domains [43] was performed using UniProtKB BLAST (EMBL-EBI, https://www.uniprot.org/blast, accessed on 13 June 2024). Human RAP1GAP crystal structure was retrieved from the protein data bank (PDB accession number 1SRQ; http://www.wwpdb.org, accessed on 13 June 2024), and the variant was highlighted in the space-filling diagram using PyMOL (Graphic System Version 2.1.1; http://www.pymol.org, accessed on 13 June 2024; maintained by Schrödinger, San Diego, CA, USA).
2.9. Functional Assessment of TSC2 Variants
Functional assessment was performed as previously described [44,45], except that a HEK293T cell line (3H9-1B1), in which both TSC1 and TSC2 genes had been inactivated by CRISPR/Cas9 genome editing, was used [46]. Briefly, a full-length TSC2 expression construct encoding the variant of interest was derived by site-directed mutagenesis. All constructs were verified by Sanger sequencing. The transfections were performed, and cells were lysed 18 h later. The cleared cell lysates were submitted to SDS-PAGE and transferred to nitrocellulose membranes. All blots were scanned using the Odyssey scanner (Li-Cor Biosciences, Lincoln, NE, USA). Signal intensities were measured and normalized to the intensities corresponding to wild-type TSC2, and the ratio of the signal for S6K phosphorylated at Thr389 to the total S6K (T389/S6K) signal was determined for each variant.
3. Results
Review of the available clinical data identified 116 individuals, 53 male and 63 female, who fulfilled the clinical criteria for definite TSC [2]. Age at the time of enrolment varied between 5 months and 19 years (mean: 9.62 years; median: 11 years). In total, DNA samples from 116 individuals were assessed by Sanger sequence analysis of polymerase chain reaction (PCR) products for both TSC1 and TSC2. In 40 cases, DNA was also analyzed by MLPA, and DNA from 21 subjects was submitted to next-generation sequencing (NGS), in addition to Sanger sequencing and MLPA.
3.1. TSC1 and TSC2 Variant Identification
3.1.1. DNA Sequencing
A total of 262 distinct DNA variants was detected. Of these, 90 were classified as pathogenic according to the ACMG guidelines (Table 1 and Table 2; Figure 1 [32]); 151 were frequent SNVs (population frequency > 0.01); and 21 were novel and not present in 1000 Genomes, ABraOM or dbSNP data banks but were not classified as pathogenic according to the ACMG guidelines. Of these novel variants, 18 (86%) were identified in subjects with a pathogenic TSC1 or TSC2 variant (Appendix A Table A5 and Table A6).
In total, seven recurrent pathogenic variants, three in TSC1 and four in TSC2, were identified in 15 unrelated individuals. The remaining pathogenic variants were identified in singleton individuals. To our knowledge, 6 pathogenic TSC1 and 28 pathogenic TSC2 variants have not been reported previously (Table 1 and Table 2).
Splicing variants were only identified in TSC2: 13 variants disrupted a canonical splice donor or acceptor site, and 5 variants were either exonic, deep intronic, or adjacent to the acceptor site (Table 2 and Figure 2). One variant, c.2838-122G>A, had been reported previously as pathogenic in multiple TSC cases [17,47]. The rare synonymous variant, c.1119G>A, affecting the last nucleotide of TSC2 exon 11, was considered pathogenic because it leads to exon 11 skipping, as recently reported by analysis of leukocyte cDNA of a TSC patient [48]. Skipping exon 11 causes an in-frame deletion in the TSC2 hamartin-binding domain (p.(A326_Q373del)). The variant c.3132-3T>G is predicted to cause skipping of exon 28, leading to an in-frame deletion of 50 amino acids (TSC2 p.R1044_S1094del). In silico analysis of variant c.848+4_848+9del predicted skipping of exon 8, leading to a frameshift: p.L259Sfs*52. Finally, although classified as a missense change (Table 2), the c.4493G>T, p.(S1498I) variant affects the last nucleotide of exon 34 and is predicted to result in skipping of exon 34: p.S1336fs*25.
3.1.2. MLPA Analysis for Copy Number Variation Identification in TSC1 and TSC2
MLPA was performed on DNA samples from 40 individuals, including 20 who remained NMI after PCR/Sanger sequence analysis. We identified one deletion encompassing TSC1 exons 9 through 23 (TSC1:c.(737+1_738-1)_(*1+_?)del); Table 1), six deletions partially or totally encompassing TSC2, and a duplication of TSC2 (Table 2 and Table 3).
The TSC1:c.(737+1_738-1)_(*1+_?)del (PS = 0.55, p-value = 1.06 × 10−8) was corroborated by qPCR (RQ = 0.41; SEM = 0.01; p-value = 7 × 10−4) and found to extend into the adjacent SPACA9 locus (qPCR of SPACA9 exon 4: RQ = 0.34; SEM = 0.06; p = 9.3 × 10−3).
The six TSC2 deletions and duplication detected by MLPA were confirmed by qPCR (Table 3). Analysis of the 6.2 kb intragenic TSC2 deletion c.975+627_1716+41del was indicative of somatic mosaicism by MLPA (PS = 0.74, p-value = 1.13 × 10−4), although unconfirmed by qPCR (Table 3). PCR and Sanger sequencing identified the breakpoints in TSC2 introns 10 and 16, close to multiple repetitive elements, two of them with high homology (Figure 3).
Two deletions and the duplication extended to the 3′ end of the TSC2 gene. To evaluate whether these rearrangements affected PKD1, exons 45 (NG_008617.1:g.50379-50490 targeted region) and 46 (NG_008617.1:g.51726–51832) of PKD1 were tested by qPCR. TSC2 deletion (c.(5068+1_5069-1)_(*102_?)del) was consistent with somatic mosaicism (Table 3) and extended from TSC2 exon 39 through PKD1 exon 46, as validated by qPCR (RQ = 0.57; SEM = 0.06; p = 0.02); exon 45 was preserved (RQ = 1.0; SEM = 0.2; p = 0.99). Similarly, the TSC2 c.(?_-30)_(*102_?)del deletion encompassed PKD1 exon 46 (RQ = 0.58; SEM = 0.02; p = 2.2 × 10−3) but not exon 45 (RQ = 0.92; SEM = 0.1; p = 0.42). In addition, NTHL1 exon 6, upstream of TSC2, was deleted (RQ = 0.50; SEM = 0.05; p = 8.6 × 10−3).
PKD1 exons 45 and 46 of the individual with the segmental duplication were not different from controls, as assessed by qPCR (exon 45: RQ = 1.18, SEM = 0.1; p = 0.14; exon 46: RQ = 0.83; SEM = 0.09; p = 0.19). We could not confirm if the TSC2 partial duplication was in tandem.
3.2. Functional Analyses of TSC2 Missense and In-Frame Deletion Variants
We performed in vitro functional testing of ten TSC2 variants: p.L18V, p.W167R, p.T509P, p.I723V, p.L847P, p.R1044_S1094del, p.S1498I, p.Y1608del, p.I1614del, and p.R1743G. The variant p.R611Q (c.1832G>A), previously shown to be pathogenic [49,50], was employed as a positive control.
The p.S1498I and p.1608del variants resulted in significantly decreased TSC2 signals (Figure 4A,B), and the p.T509P, p.L847P, and p.R611Q variants were associated with reduced TSC1 and TSC2 signals (Figure 4A–C). The p.T509P, p.L847P, p.R1743G, p.Y1608del, p.I1614del, and p.R1044_S1094del variants were unable to inactivate TORC1-dependent S6K-T389 phosphorylation, similar to the pathogenic p.R611Q variant (Figure 4A,E). The Y1608 residue within the TSC2 GAP domain is conserved among TSC2 orthologues and human RAP1 GAP (residue Y256; Figure 5).
In contrast, the p.L18V, p.W167R, and p.I723V variants did not disrupt TSC1/2 function in our assay: S6K-T389 phosphorylation (T389/S6K ratio) was not significantly different to wild-type (WT) TSC2 (Figure 4E). The p.S1498I variant exhibited an intermediate effect on TSC1/2 function. The T389/S6K ratio for the p.S1498I variant was significantly reduced compared to the inactive p.R611Q variant (p = 0.002; paired Student’s t-test, with Bonferroni correction) but was still increased more than three-fold relative to WT TSC2 (p = 0.042) (Figure 4).
Altogether, among the 116 unrelated individuals clinically diagnosed with TSC, 18 had pathogenic alterations in the TSC1 gene and 88 in TSC2, yielding a mutation detection rate of 91.4% (106/116; Table 1, Table 2 and Table 4). Finally, the TSC2 variant c.1443G>T (p.E481D) that does not inactivate the TSC1/2 (Nellist, personal communication) was identified in an NMI patient. The c.1443G>T substitution is predicted to disrupt the 5′ donor site of exon 14, possibly resulting in skipping of this exon: r.1362_1443del, (p.R454fs*3). The same variant has been identified in two unrelated individuals with TSC from other studies, but in the absence of RNA data, we considered the variant a VUS.
4. Discussion
As a multisystem disorder owing to loss of function of the tumor suppressor genes TSC1 or TSC2, TSC has variable expressivity. TSC morbidity commonly relates to refractory epilepsy, kidney angiomyolipoma leading to acute bleeding and/or renal insufficiency, and pulmonary lymphangioleiomyomatosis (LAM). Proper control of epilepsy in the first two years of life is directly associated with better cognitive outcome. In addition, untreated growing subependymal giant cell astrocytoma (SEGA) may aggravate epilepsy and lead to hydrocephalus. The availability of mTOR inhibitors for clinical treatment of TSC patients with growing angiomyolipoma, SEGA, LAM, and as adjuvant therapy for refractory epilepsy positively impacts the clinical outcome and highlights the need for early diagnosis of the disease [2].
Molecular analysis of TSC1 and TSC2 was performed in this study in 116 Brazilian individuals with a definite clinical diagnosis of TSC. Individuals were referred from three large tertiary clinics. We report a mutation detection rate (106/116; 91.4%) similar to previous reports but with a relatively high ratio (1:5) of cases with an inactivating variant in TSC2 [5,26,51,52,53,54,55,56]. The three referring hospitals are from two neighboring states, São Paulo and Paraná, respectively, in the southeast and south of Brazil. A Brazilian report on TSC patients from these two regions disclosed a TSC1:TSC2 pathogenic alteration ratio of 1:2.5 [57]. In our study, two clinics that together contributed 97 TSC patient DNA samples are referral centers for epilepsy treatment, which might lead to a higher recruitment of severe, refractory epilepsy cases and therefore a higher rate of mutation detection as well as a preponderance of pathogenic TSC2 variants [12,51,52]. The third hospital is a reference for brain tumor treatment and follows up severe patients with genetic tumor syndromes referred to by neurologists, which may additionally justify a higher number of patients with TSC2 alterations.
Although this study did not aim at clinical characterization, it is possible that case severity might explain the limited number of NMI cases or the high frequency of TSC2 pathogenic variants. Contiguous gene deletion syndrome, characterized by both TSC and polycystic kidney disease, affects up to 5% of TSC patients [2] and has been diagnosed in the two patients with TSC2 segmental deletions encompassing PKD1 exon 46, assisted in a multispecialty clinic. The largest cohort of patients from an individual hospital in this study (n = 74) disclosed a TSC1:TSC2 mutation ratio of 1:8.9 (7:62) and is mostly composed of sporadic cases, according to family reports. The low number of patients with a TSC1 pathogenic alteration in this cohort prevented a robust genotype–phenotype correlation as recently reported [58,59]. The cohort from another epilepsy center (n = 23) has a TSC1:TSC2 ratio of 1:1.4 (9:13) and more familial cases. This is consistent with previous reports of a significantly higher number of TSC2 pathogenic alterations among sporadic TSC cases [51,52]. Moreover, NMI cases appear milder and frequently consist of TSC patients whose pathogenic variant presents somatic mosaicism or lies in regulatory segments of either TSC1 or TSC2 genes [13].
We identified novel DNA variants, including 35 pathogenic alterations (Table 1 and Table 2, Appendix A Table A5 and Table A6). Nonsense and frameshifting variants were the most common types of pathogenic DNA variants for both genes (Table 3). Splicing variants constituted an important fraction of TSC2 pathogenic alterations (Table 2) and VUSs (Appendix A Table A6).
Well-established in vitro functional studies supportive of a damaging effect on a gene product or pathway have been classified as a strong criterion for helping determine the pathogenicity of missense variants [32]. Functional assessment of TSC1 and TSC2 missense variants can provide insight into their effects on mTORC1 activity [44,45,60]. We investigated seven missense variants and three predicted in-frame deletions affecting TSC2. Four missense variants, two in-frame deletions, and the predicted in-frame 50-amino acid deletion (p.1044del50) inactivated the TSC1/2 complex and were thus classified as pathogenic. The four missense variants, p.T509P, p.L847P, p.S1498I, and p.R1743G, clearly disrupted TSC1/2 complex activity in our functional assay. Although the c.4493G>T (p.S1498I) did not completely inactivate the TSC1/2, we considered the clear disruption of activity as good evidence to support pathogenicity. Furthermore, the c.4493G>T variant is predicted to disrupt TSC2 pre-mRNA splicing.
We classified the p.L18V, p.W167R, and p.I1723V variants as unlikely to be pathogenic. These variants did not have a significant effect on TSC1/2 activity in our assay and, in each case, other pathogenic changes were identified in the individual concerned (Table 5).
In our study, the c.1443G>T (p.Glu481Asp) variant was detected in two individuals. In one of these cases, we also identified the TSC2 c.1790A>G (p.H597R) pathogenic variant. Functional testing and RNA studies should help resolve whether these variants are likely to be pathogenic.
Among seven large deletions (7/106; 6.6%), two were analyzed in detail, one extending from TSC1 c.(737+1_738-1)_(*1+_?)del) into the downstream SPACA9 locus and another mapping into TSC2 c.(975+628)_(1716+41)del. In this case, the breakpoints were identified and shown to lie close to Alu repeats (Figure 4). The high identity between the Alu-Sp repeat in TSC2 intron 10 and the Alu-Sq repeat in intron 16 suggests homologous unequal recombination or intra-chromosomal recombination as likely mechanisms to generate the deletion [61,62,63].
In summary, 106 out of 116 individuals with a clinical diagnosis of TSC had pathogenic DNA alterations in TSC1 or TSC2 identified by DNA sequencing or MLPA, confirmed by functional assessment or qPCR, if indicated. We detected 35 novel pathogenic DNA alterations as well as Alu-associated breakpoints leading to an intergenic TSC2 deletion. Functional assessment of TSC2 missense and in-frame deletion variants increased the number of variants that could be classified as (likely) pathogenic by ~7% and identified novel residues in the TSC2 protein that are critical for TSC1/2 complex function.
Author Contributions
Conceptualization, L.G.D.-A., M.N. and L.A.H.; methodology, L.G.D.-A., M.N., M.R.P.-B., S.C. and L.A.H.; validation, L.G.D.-A., T.G.P.A., S.C., and L.A.H.; formal analysis, L.G.D.-A., M.R.P.-B., S.C. and L.A.H.; investigation, L.G.D.-A., T.G.P.A. and S.N.; resources, L.F.M.C., M.R.S., D.C., J.P.G.A., A.M.C., N.S.S., S.R., A.P.A.P., S.A.A. and M.N.; data curation, L.F.M.C., M.R.S., D.C., J.P.G.A., A.M.C., N.S.S., S.R., A.P.A.P. and S.A.A.; writing—original draft preparation, L.G.D.-A. and L.A.H.; writing—review and editing, L.G.D.-A., L.F.M.C., M.N., M.R.P.-B., S.C. and L.A.H.; visualization, L.G.D.-A., T.G.P.A., S.N., M.N., S.C. and L.A.H.; supervision, L.A.H.; project administration, L.A.H.; funding acquisition, M.R.P.-B., M.N. and L.A.H. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by São Paulo Research Foundation/FAPESP grants 2011/14329-9 (LAH), 2013/08028-1 (MRPB), 2017/06100-8 (SC) and 2019/10868-4 (LAH). LGDA and LFMMC were recipients of CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior, Brasília, Brazil) fellowships (finance codes CAPES-PROEX/001, CAPES 1570747, and CAPES-DSE 88881.132401/2016-01). Financial support for SN and MN was provided by the Michelle Foundation (The Netherlands), the TS Alliance (USA; award 06-16), and the TS Association (UK; award 2016-P07). The APC was in part funded by Fundação da Universidade Federal do Paraná—FUNPAR (Curitiba, Brazil) and in part by Child and Adolescent Health Graduate Program at the School of Medicine—Federal University of Paraná (Curitiba, Brazil).
Institutional Review Board Statement
The study was conducted in accordance with the Declaration of Helsinki and approved by the Institutional Ethics Committee of the Institute of Bioscience of the University of São Paulo, São Paulo, Brazil (protocol codes CAAE 12572913.3.0000.5464 and CAAE 48259715.2.0000.5464, approved on 24 August 2015 and 14 September 2016, respectively).
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
DNA variants identified in the study are openly available in TSC1 and TSC2 LOVD (https://www.lovd.nl/TSC1; https://www.lovd.nl/TSC2, after 1 August 2024) and ABraOM (https://abraom.ib.usp.br/, after 1 October 2024) databases.
Acknowledgments
LGDA thanks Adriano Bonaldi, Fernando Gomes, Leandro U Alves, and Renan B Lemos for helping in NGS and MLPA analysis.
Conflicts of Interest
The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.
Appendix A
Table A1.
PCR and Sanger sequencing primers for the TSC1 gene.
| Targeted Segment | Name | Oligonucleotide Sequence (5′–3′) |
|---|---|---|
| Promoter + exon 01 | gTSC1_1S | AAATGTTTAGCCCAGGAAGGA |
| gTSC1_1A | GCCGGAGATAGCGTGTAATAA | |
| gTSC1_2A | CATCTTGGACGTACAGCACCT | |
| gTSC1_2S | CCGTCTATCCTTCCTTTCGAG | |
| Exon 02 | gTSC1_3S | TTGGATTTTAACCCGGAACTC |
| gTSC1_3A | TCAGGCACTGAATACAAGCAA | |
| Exon 03 | gTSC1_4A | GGGGTTCACTGCATGATTCT |
| gTSC1_4S | CCTCTTCATAAACTCGCCAAAG | |
| Exon 04 | gTSC1_5S | CAGAACTGTAATGCTGCACAAA |
| gTSC1_5A | TTCAAGAATCATGGGTCCTACA | |
| Exon 05 | gTSC1_6S | TTTTATCTGCATGACCCTTGC |
| gTSC1_6A | CCATACTTGCATGGACAAGGT | |
| Exon 06 | gTSC1_7S | CAGTAGAGTTGGGGCTCAGTG |
| gTSC1_7A | GCACCCAAGATATTCCCTCA | |
| Exons 07 + 08 | gTSC1_8S | CTGAAGAGGAGGGCAGAAGTT |
| gTSC1_8A | ATTAGTCCTCCGCCTGTGAA | |
| gTSC1_9A | AATTTCCCTGTCTGCCGTTA | |
| gTSC1_29S | CAATCCCTAGGCAGCCACTA | |
| Exon 09 | gTSC1_10S | TTTCCATTTTGAGGCTACACC |
| gTSC1_10A | TTCCAGAGACAAAGTTGCAAAA | |
| Exon 10 | gTSC1_28S | ACCTAAAACCACACACTAACCC |
| gTSC1_11A | GGAATGCTAAGTCATCCACGA | |
| Exons 11 + 12 | gTSC1_12S | GGGAAAATTTCACACTGCTCA |
| gTSC1_12A | CACACCTTGAGAGCAGCTTGT | |
| gTSC1_13A | CCCAGGGATTTGCAATAAGT | |
| gTSC1_13S | CGGCAGTTTTTCTAATAGTTGG | |
| Exons 13 + 14 | gTSC1_14S | CATCCCAACAATTTGAGAATCA |
| gTSC1_14A | GGCATCACTTTACCTGGCATA | |
| gTSC1_15A | TCCCAGAATTTCCTTGTTTCC | |
| gTSC1_15S | CCATGTCCAGCCTTCTCTGT | |
| Exon 15 | gTSC1_16S | GGATGCCACTTTTTCTCCTCT |
| gTSC1_16A | TCCCAATTTAGGTGCACAGAG | |
| gTSC1_17A | GATGACAAAATGATGGGCTGT | |
| gTSC1_17S | CACACCAAAGCAAGCCTTTAC | |
| Exons 16+17 | gTSC1_18S | TTATGCCATTGCAGATTTTGAC |
| gTSC1_18A | GGAAGGACTGGGAACTCTGAC | |
| gTSC1_19A | ACTTGGCAACACTTGAGATCCT | |
| gTSC1_19S | AAGCTAACAACACATGGGAAGG | |
| Exon 18 | gTSC1_20S | GCAAACTGATCCCTGAGAAGA |
| gTSC1_20A | AGTTGGGGAACCTCTGTCCTA | |
| Exon 19 | gTSC1_21S | CAGAATCTTTCTGCAGCATCC |
| gTSC1_21A | CAGCACCAAAAACATGAACCT | |
| Exon 20 | gTSC1_22S | CCATTATGTCAGGGACTGTGAA |
| gTSC1_22A | TAGCTGGACCACGGAGTAGTG | |
| Exons 21 + 22 | gTSC1_23S | GCTTGGGGATAGATTTCAAGG |
| gTSC1_23A | ACACGGAGTGAGCTGAGTGTT | |
| gTSC1_24A | TGCAGCTGTCCTCTGAAAGAT | |
| gTSC1_24S | GTCAAACTCCAGGCAAGGTAA | |
| Exon 23 | gTSC1_25S | CATATGGCCACAGGAAGTGTT |
| gTSC1_28A | CCGTCCCATTTCCACACATG | |
| gTSC1_26A | CAGAAAGGCTACTGGTCATGC | |
| gTSC1_26S | GGGAGACGACTATGGGAGAAG |
Table A2.
PCR and Sanger sequencing primers for the TSC2 gene.
| Targeted Segment | Name | Oligonucleotide Sequence (5′–3′) |
|---|---|---|
| Promoter + exon 01 | gTSC2_1S | CGAGGACAGCAAGTTCACTG |
| gTSC2_1A | GTTTGCCGTCTCTCCTCTACC | |
| gTSC2_2A | GAGCTTGCTGGGAGTTGTAGTT | |
| gTSC2_2S | CTACCTGCTGCAGCCTCTCT | |
| Exon 02 | gTSC2_3S | GGTAGAGGAGAGACGGCAAAC |
| gTSC2_3A | AAGTGTGCCTGAACCAGGTC | |
| Exon 03 | gTSC2_4S | CGGCTCGTCAAGTGAATCTT |
| gTSC2_4A | GTCAGCTGTCAACCATGTTCC | |
| Exon 04 | gTSC2_5S | TGAGACTGTCCCATGACTTCC |
| gTSC2_5A | AGGGCAAAACAACACCGTAG | |
| Exon 05 | gTSC2_43S | CCTGCCCTGTACAATGCTGA |
| gTSC2_43A | CAAGCCCCAGAGACTCACAG | |
| Exon 06 | gTSC2_44S | GATCCTAGTGTCCGTGCGTAG |
| gTSC2_44A | CGGAGCTGAACTTAGGACCAT | |
| Exon 07 | gTSC2_8S | GCTCTCATCTGATGTCTTGGTT |
| gTSC2_8A | GTCATTGATGCTGTCATCCAC | |
| Exon 08 | gTSC2_9S | GTCCCCCATGTAAGTCAGGAT |
| gTSC2_9A | ATCTCCTCCCAAAGACAGAGG | |
| Exon 09 | gTSC2_10S | CTGTCTCCCATGAATGGTTGT |
| gTSC2_10A | GGCTAAGTAGTTGGGGAGCAC | |
| Exon 10 | gTSC2_45S | GTGTTACTGCTGGCCTCTGT |
| gTSC2_11A | CAGCTCACTGCACACAGAAAC | |
| Exon 11 | gTSC2_12S | GGATTCAGTTGCTGGTCTGTC |
| gTSC2_12A | ACTAATGCGGTCCTCCAAAGT | |
| Exon 12 | gTSC2_46S | CCTCTGGTGCCAAGTCCATG |
| gTSC2_45A | CCCTAAGCTGAGTGTTCCTGG | |
| Exon 13 | gTSC2_14S | CAGTTTCCTCCCACCTGTGT |
| gTSC2_14A | GGAGCATCTCTCCAGACGAC | |
| Exon 14 | gTSC2_15S | GTGCTAGCTTGCTTTCCAGTC |
| gTSC2_15A | AGACTGGCTGAAACGAACTCA | |
| Exon 15 | gTSC2_16S | GCTGCTCCTTGTGAGTTGTG |
| gTSC2_16A | ACTGTGCAGAAACCAAAATGC | |
| Exon 16 | gTSC2_17S | CTCAGAACCATGAGCCTGTGT |
| gTSC2_17A | AGCGTGTGCTACTGGTATGCT | |
| Exon 17 | gTSC2_18S | GTTGATGACTGCCCTGATGAT |
| gTSC2_18A | TTAGAGCGACAAGCCACAGAT | |
| Exon 18 | gTSC2_19S | CAGAGTCCTGTTCAGCCTGTC |
| gTSC2_19A | GAAGCAAGAGAAGCAGCTGAG | |
| Exon 19 | gTSC2_20S | CTACATGTACGCGGGACCTC |
| gTSC2_20A | GCCTTCTGGACCCTAGAGACA | |
| Exon 20 | gTSC2_21S | GTGCCCTACTCCCTGCTCTT |
| gTSC2_46A | GCTCGCAGTCTTTTGGGGAA | |
| Exon 21 | gTSC2_47S | GTGTGTTACTTGGCAGGCAC |
| gTSC2_22A | GTGGACAGGGAACACTGGAT | |
| Exon 22 | gTSC2_23S | GAGTCTGCTCGGGTAGCTCA |
| gTSC2_23A | ACCTGAGCTCCTGAAGTCACA | |
| Exon 23 | gTSC2_24S | TCACGGATCACACAAATGGTA |
| gTSC2_24A | GAGCCCACCTTAGTGATGAAA | |
| Exon 24 | gTSC2_25S | CGCACCTCTACAGGAACTTTG |
| gTSC2_25A | GAGTGAGCACACCCAGACAGT | |
| Exon 25 | gTSC2_26S | TCATCACTAAGGTGGGCTCAG |
| gTSC2_26A | AACCCCCAATTCCACAAGTAG | |
| Exon 26 | gTSC2_27S | ACCCACACACGTTTAATTTGC |
| gTSC2_27A | GAATACGAAAAGGCCAAAACC | |
| Exons 27 + 28 | gTSC2_28S | AATGTGGTCCACGTGATTCTC |
| gTSC2_28A | GACTTAGTCCCCAGGCTGGTA | |
| Exon 29 | gTSC2_29S | CGCTCCCTGTCTTCTAGGTCT |
| gTSC2_29A | CAGAGAAGGGCTCCAGGACT | |
| Exon 30 | gTSC2_48S | CTTGAGGCTGGTGGTTTTGC |
| gTSC2_47A | AGAGGGCCAAGTCTGCAATC | |
| Exon 31 | gTSC2_31S | TGAGGGGTGCAAAGAGTAGG |
| gTSC2_31A | GGAGAACAATGGTGCTGAGG | |
| Exon 32 | gTSC2_32S | GACGTCTATTCACGGGAGGA |
| gTSC2_32A | CTAAACAGCTGCCACCCATC | |
| Exon 33 | gTSC2_33S | GTTACGAGGGCTGGTTTCAG |
| gTSC2_33A | ACACTGCGTGAGCAGAGGTAT | |
| Exon 34 | gTSC2_34S | ATACCTCTGCTCACGCAGTGT |
| gTSC2_34A | AGCTGCAGGAACACGAAACT | |
| gTSC2_35A | CTCTTTAAGGCGTCCCTCTCT | |
| gTSC2_35S | CTGTGGACCTCTCCTTCCAG | |
| Exon 35 | gTSC2_36S | AGCCTCCAATGCAGAGAAAGT |
| gTSC2_36A | GTGTCGTATGATGGGATCTGG | |
| Exon 36 | gTSC2_37S | TGTTCCTGCAGCTCTACCATT |
| gTSC2_37A | TGTCAGCTCACTGACCAACAG | |
| Exon 37 | gTSC2_38S | GAGGGAAGAGAGGGAGTCAAG |
| gTSC2_38A | GGCACCTCCTGATTACTCCA | |
| Exon 38 | gTSC2_39S | CTCCCATCCAGTCCTGCTAC |
| gTSC2_39A | TCTGCACTTGCCAGTTACTCC | |
| Exons 39 + 40 | gTSC2_49S | CAGAGGGGAAAGTTCAGGGG |
| gTSC2_40A | GTAGATATCGGTGGGGTTGGA | |
| Exon 41 | gTSC2_41S | AAGTCTCCCCAGACATGGAG |
| gTSC2_41A | CACAAACTCGGTGAAGTCCTC | |
| Exon 42 | gTSC2_42S | CCGATATCTACCCCTCCAAGT |
| gTSC2_48A | CTTCTAGAGCCTCGACACCC |
Table A3.
Nextera Flex capture coverage per individual. Total reads, mean reads per nucleotide, granular, and target region covered are shown.
Table A3.
Nextera Flex capture coverage per individual. Total reads, mean reads per nucleotide, granular, and target region covered are shown.
| ID | Coverage. | Granular | Target Region Covered (%) | ||||
|---|---|---|---|---|---|---|---|
| Total | Mean | Third_Quartile | Median | First_Quartile | >10 Reads | >20 Reads | |
| 14 | 193108927 | 164.54 | 215 | 160 | 110 | 98.40% | 97.40% |
| 34 | 206241477 | 175.73 | 230 | 168 | 114 | 98.50% | 97.60% |
| 46 | 51912227 | 205.33 | 252 | 198 | 151 | 99.50% | 99.10% |
| 50 | 34975423 | 138.34 | 173 | 122 | 84 | 99.50% | 98.90% |
| 53 | 60450935 | 239.1 | 294 | 226 | 170 | 99.90% | 99.40% |
| 56 | 47703937 | 188.68 | 235 | 169 | 119 | 99.70% | 99.30% |
| 60 | 35594649 | 140.79 | 175 | 126 | 89 | 99.60% | 99.20% |
| 63 | 43388916 | 171.61 | 215 | 151 | 106 | 99.70% | 99.30% |
| 64 | 56625909 | 223.97 | 278 | 218 | 165 | 99.40% | 99.00% |
| 65 | 64631748 | 255.64 | 314 | 249 | 190 | 99.40% | 99.10% |
| 66 | 45574283 | 180.26 | 225 | 178 | 134 | 99.20% | 98.70% |
| 82 | 41660923 | 164.78 | 205 | 162 | 122 | 99.20% | 98.70% |
| 87 | 56281945 | 222.61 | 274 | 219 | 167 | 99.40% | 99.00% |
| 100 | 52273457 | 206.76 | 255 | 203 | 154 | 99.40% | 99.00% |
| 104 | 48197580 | 190.63 | 235 | 180 | 136 | 99.60% | 99.20% |
| 113 | 57003770 | 225.46 | 277 | 215 | 163 | 99.70% | 99.30% |
| 116 | 41915283 | 165.79 | 207 | 157 | 117 | 99.60% | 99.10% |
| 117 | 40770943 | 161.26 | 200 | 159 | 120 | 99.10% | 98.50% |
| 118 | 46434270 | 183.66 | 226 | 179 | 136 | 99.40% | 99.00% |
| 119 | 48891382 | 193.38 | 241 | 192 | 144 | 99.20% | 98.80% |
| 123 | 65664401 | 259.72 | 335 | 246 | 170 | 99.50% | 99.20% |
| 124 | 60099947 | 237.71 | 307 | 221 | 152 | 99.50% | 99.10% |
Table A4.
Quantitative PCR primers for TSC1, TSC2, GAPDH, and SPACA9 genes.
| Segment | Name | Oligonucleotide Sequence (5′–3′) |
|---|---|---|
| TSC1 | ||
| Exon 01 | qPCRgTSC1_1S | AGGGACTGTGAGGTAAACAGC |
| qPCRgTSC1_1A | AGGAAGCCCCCATAAAAAGGAG | |
| Exon 17 | qPCRgTSC1_4S | CAGATGAGATCCGCACCCTC |
| qPCRgTSC1_4A | AGCTGCTGCTTTGATCACCT | |
| TSC2 | ||
| Exon 12 | qPCRgTSC2_2S | TCCATGACCTGTTGACCACG |
| qPCRgTSC2_2A | CGCACATCTCTCCACCAGTT | |
| PKD1 | ||
| Exon 45 | qPCRgPKD1_1S | GGCTCTCTACCCTGTGTCCT |
| qPCRgPKD1_1A | CGGAGAATAACAGCCCCCAG | |
| Exon 46 | qPCRgPKD1_2S | TAGGTGTGGTGGCGTTATGG |
| qPCRgPKD1_2A | CTCTGGGGTGATGAGAGTGC | |
| GADPH | ||
| Intron 01 | gGAPDH_1S | GCTCCCACCTTTCTCATCC |
| gGAPDH_1A | CTGCAGCGTACTCCCCAC | |
| SPACA9 | ||
| Exon 04 | qPCRgSPACA9_1S | GAGGCCCGGAACCACTAC |
| qPCRgSPACA9_1A | GAGTGGGCGATCCATTCTTTC | |
| qPCRgSPACA9_2S | GAGGCCCGGAACCACTAC | |
| qPCRgSPACA9_2A | GAGTGGGCGATCCATTCTTTC | |
Table A5.
Novel non-pathogenic exonic variants identified in TSC1 and TSC2 (LovD and dbSNP databases were accessed in June/2024).
Table A5.
Novel non-pathogenic exonic variants identified in TSC1 and TSC2 (LovD and dbSNP databases were accessed in June/2024).
| Segment | Variant | Variant Type | Highest Reported Frequency/Database |
|---|---|---|---|
| TSC1 | |||
| 3′UTR | c.*1G>A | 3′ UTR | NR |
| 3′UTR | c.*191dup a | 3′ UTR | NR |
| 3′UTR | c.*1362C>T | 3′ UTR | NR |
| TSC2 | |||
| Exon 30 | c.3431T>A (p.V1144E) | Missense | NR |
NR: not reported. a Identified in two patients.
Table A6.
Novel non-pathogenic upstream and intronic variants identified in TSC1 and TSC2 (LovD and dbSNP databases were accessed in June/2024).
Table A6.
Novel non-pathogenic upstream and intronic variants identified in TSC1 and TSC2 (LovD and dbSNP databases were accessed in June/2024).
| Segment | Variant | Variant Type | Highest Reported Frequency/Database |
|---|---|---|---|
| TSC1 | |||
| 5′ UTR | c.-606_-605delGCinsTG | 5′ UTR | NR |
| 5′ UTR | c.-568C>T | 5′ UTR | NR |
| 5′ UTR | c.-282_-281insC | 5′ UTR | NR |
| Intron 11 | c.1142-26_1142-25del | Intron variant | NR |
| TSC2 | |||
| Intron 07 | c.648+12C>A | Intron variant | NR |
| Intron 12 | c.1257+109dup | Intron variant | NR |
| Intron 15 | c.1599+85_1599+87del | Intron variant | NR |
| Intron 15 | c.1599+282_1599+283inCTGGGG b | Intron variant | NR |
| Intron 21 | c.2356-63A>G | Intron variant | NR |
| Intron 25 | c.2837+93G>A | Intron variant | 0.000008 |
| Intron 30 | c.3610+46dup a | Intron variant | NR |
| Intron 34 | c.4493+110G>A | Intron variant | NR |
| Intron 36 | c.4663-56C>G | Intron variant | 0.000004 |
| Intron 37 | c.4850-133C>T a | Intron variant | NR |
NR: not reported. a Identified in two patients. b Identified in three patients.
References
- Northrup, H.; Krueger, D.A.; International Tuberous Sclerosis Complex Consensus Group. Tuberous sclerosis complex diagnostic criteria update: Recommendations of the 2012 International Tuberous Sclerosis Complex Consensus Conference. Pediatr. Neurol. 2013, 49, 243–254. [Google Scholar] [CrossRef] [PubMed]
- Northrup, H.; Aronow, M.E.; Bebin, E.M.; Bissler, J.; Darling, T.N.; de Vries, P.J.; Frost, M.D.; Fuchs, Z.; Gosnell, E.S.; Gupta, N.; et al. Updated International Tuberous Sclerosis Complex Diagnostic Criteria and Surveillance and Management Recommendations. Pediatr. Neurol. 2021, 123, 50–66. [Google Scholar] [CrossRef] [PubMed]
- Sampson, J.R.; Scahill, S.J.; Stephenson, J.B.; Mann, L.; Connor, J.M. Genetic aspects of tuberous sclerosis in the west of Scotland. J. Med. Genet. 1989, 26, 28–31. [Google Scholar] [CrossRef] [PubMed]
- O’Callaghan, F.J.; Shiell, A.W.; Osborne, J.P.; Martyn, C.N. Prevalence of tuberous sclerosis estimated by capture-recapture analysis. Lancet 1998, 351, 1490. [Google Scholar] [CrossRef] [PubMed]
- Au, K.S.; Williams, A.T.; Roach, E.S.; Batchelor, L.; Sparagana, S.P.; Delgado, M.R.; Wheless, J.W.; Baumgartner, J.E.; Roa, B.B.; Wilson, C.M.; et al. Genotype/phenotype correlation in 325 individuals referred for a diagnosis of tuberous sclerosis complex in the United States. Genet. Med. 2007, 9, 88–100. [Google Scholar] [CrossRef]
- European Chromosome 16 Tuberous Sclerosis Consortium. Identification and characterization of the tuberous sclerosis gene on chromosome 16. Cell 1993, 75, 1305–1315. [Google Scholar] [CrossRef] [PubMed]
- van Slegtenhorst, M.; de Hoogt, R.; Hermans, C.; Nellist, M.; Janssen, B.; Verhoef, S.; Lindhout, D.; van den Ouweland, A.; Halley, D.; Young, J.; et al. Identification of the tuberous sclerosis gene TSC1 on chromosome 9q34. Science 1997, 277, 805–808. [Google Scholar] [CrossRef] [PubMed]
- Dibble, C.C.; Elis, W.; Menon, S.; Qin, W.; Klekota, J.; Asara, J.M.; Finan, P.M.; Kwiatkowski, D.J.; Murphy, L.O.; Manning, B.D. TBC1D7 is a third subunit of the TSC1-TSC2 complex upstream of mTORC1. Mol. Cell 2012, 47, 535–546. [Google Scholar] [CrossRef] [PubMed]
- Dibble, C.C.; Manning, B.D. Signal integration by mTORC1 coordinates nutrient input with biosynthetic output. Nat. Cell Biol. 2013, 15, 555–564. [Google Scholar] [CrossRef] [PubMed]
- Hoxhaj, G.; Hughes-Hallett, J.; Timson, R.C.; Ilagan, E.; Yuan, M.; Asara, J.M.; Ben-Sahra, I.; Manning, B.D. The mTORC1 Signaling Network Senses Changes in Cellular Purine Nucleotide Levels. Cell Rep. 2017, 21, 1331–1346. [Google Scholar] [CrossRef]
- Roach, E.S.; Gomez, M.R.; Northrup, H. Tuberous sclerosis complex consensus conference: Revised clinical diagnostic criteria. J. Child Neurol. 1998, 13, 624–628. [Google Scholar] [CrossRef] [PubMed]
- Peron, A.; Au, K.S.; Northrup, H. Genetics, genomics, and genotype-phenotype correlations of TSC: Insights for clinical practice. Am. J. Med. Genet. Part C Semin. Med. Genet. 2018, 178, 281–290. [Google Scholar] [CrossRef]
- Camposano, S.E.; Greenberg, E.; Kwiatkowski, D.J.; Thiele, E.A. Distinct clinical characteristics of tuberous sclerosis complex patients with no mutation identified. Ann. Hum. Genet. 2009, 73, 141–146. [Google Scholar] [CrossRef]
- Qin, W.; Kozlowski, P.; Taillon, B.E.; Bouffard, P.; Holmes, A.J.; Janne, P.; Camposano, S.; Thiele, E.; Franz, D.; Kwiatkowski, D.J. Ultra deep sequencing detects a low rate of mosaic mutations in tuberous sclerosis complex. Hum. Genet. 2010, 127, 573–582. [Google Scholar] [CrossRef]
- Kozlowski, P.; Roberts, P.; Dabora, S.; Franz, D.; Bissler, J.; Northrup, H.; Au, K.S.; Lazarus, R.; Domanska-Pakiela, D.; Kotulska, K.; et al. Identification of 54 large deletions/duplications in TSC1 and TSC2 using MLPA, and genotype-phenotype correlations. Hum. Genet. 2007, 121, 389–400. [Google Scholar] [CrossRef] [PubMed]
- Tyburczy, M.E.; Wang, J.A.; Li, S.; Thangapazham, R.; Chekaluk, Y.; Moss, J.; Kwiatkowski, D.J.; Darling, T.N. Sun exposure causes somatic second-hit mutations and angiofibroma development in tuberous sclerosis complex. Hum. Mol. Genet. 2013, 23, 20232029. [Google Scholar] [CrossRef]
- Nellist, M.; Brouwer, R.W.; Kockx, C.E.; van Veghel-Plandsoen, M.; Withagen-Hermans, C.; Prins-Bakker, L.; Hoogeveen-Westerveld, M.; Mrsic, A.; van den Berg, M.M.; Koopmans, A.E.; et al. Targeted Next Generation Sequencing reveals previously unidentified TSC1 and TSC2 mutations. BMC Med. Genet. 2015, 16, 10. [Google Scholar] [CrossRef]
- Tyburczy, M.E.; Dies, K.A.; Glass, J.; Camposano, S.; Chekaluk, Y.; Thorner, A.R.; Lin, L.; Krueger, D.; Franz, D.N.; Thiele, E.A.; et al. Mosaic and Intronic Mutations in TSC1/TSC2 Explain the Majority of TSC Patients with No Mutation Identified by Conventional Testing. PLoS Genet. 2015, 11, e1005637. [Google Scholar] [CrossRef] [PubMed]
- Klonowska, K.; Giannikou, K.; Grevelink, J.M.; Boeszoermenyi, B.; Thorner, A.R.; Herbert, Z.T.; Afrin, A.; Treichel, A.M.; Hamieh, L.; Kotulska, K.; et al. Comprehensive genetic and phenotype analysis of 95 individuals with mosaic tuberous sclerosis complex. Am. J. Hum. Genet. 2023, 110, 979–988. [Google Scholar] [CrossRef]
- Rozen, S.; Skaletsky, H.J. Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Gerstein, M.B.; Bruce, C.; Rozowsky, J.S.; Zheng, D.; Du, J.; Korbel, J.O.; Emanuelsson, O.; Zhang, Z.D.; Weissman, S.; Snyder, M. What is a gene, post-ENCODE? History and updated definition. Genome Res. 2007, 17, 669–681. [Google Scholar] [CrossRef]
- Frey, U.H.; Bachmann, H.S.; Peters, J.; Siffert, W. PCR-amplification of GC-rich regions: ‘Slowdown PCR’. Nat. Protoc. 2008, 3, 1312–1317. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows—Wheeler Transform. Bioinformatics. Bioinformatics 2009, 25, 7. [Google Scholar] [CrossRef] [PubMed]
- McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.; Cibulskis, K.; Kernytsky, A.; Garimella, K.; Altshuler, D.; Gabriel, S.; Daly, M.; et al. The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010, 20, 1297–1303. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Li, M.; Hakonarson, H. ANNOVAR: Functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 2010, 38, e164. [Google Scholar] [CrossRef] [PubMed]
- Rendtorff, N.D.; Bjerregaard, B.; Frodin, M.; Kjaergaard, S.; Hove, H.; Skovby, F.; Brondum-Nielsen, K.; Schwartz, M.; The Danish Tuberous Sclerosis Group. Analysis of 65 tuberous sclerosis complex (TSC) patients by TSC2 DGGE, TSC1/TSC2 MLPA, and TSC1 long-range PCR sequencing, and report of 28 novel mutations. Hum. Mutat. 2005, 26, 374–383. [Google Scholar] [CrossRef] [PubMed]
- Padma Priya, T.; Dalal, A.B. Tuberous sclerosis: Diagnosis and prenatal diagnosis by MLPA. Indian J. Pediatr. 2012, 79, 1366–1369. [Google Scholar] [CrossRef]
- van Veghel-Plandsoen, M.M.; Wouters, C.H.; Kromosoeto, J.N.; den Ridder-Klunnen, M.C.; Halley, D.J.; van den Ouweland, A.M. Multiplex ligation-depending probe amplification is not suitable for detection of low-grade mosaicism. Eur. J. Hum. Genet. 2011, 19, 1009–1012. [Google Scholar] [CrossRef] [PubMed]
- Ambar, G.; Chiavegatto, S. Anabolic—androgenic steroid treatment induces behavioral disinhibition and downregulation of serotonin receptor messenger RNA in the prefrontal cortex and amygdala of male mice. Genes. Brain Behav. 2009, 8, 161–173. [Google Scholar] [CrossRef]
- Freeman, P.J.; Hart, R.K.; Gretton, L.J.; Brookes, A.J.; Dalgleish, R. VariantValidator: Accurate validation, mapping, and formatting of sequence variation descriptions. Hum. Mutat. 2018, 39, 61–68. [Google Scholar] [CrossRef]
- Wildeman, M.; van Ophuizen, E.; den Dunnen, J.T.; Taschner, P.E. Improving sequence variant descriptions in mutation databases and literature using the Mutalyzer sequence variation nomenclature checker. Hum. Mutat. 2008, 29, 6–13. [Google Scholar] [CrossRef]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. Off. J. Am. Coll. Med. Genet. 2015, 17, 405–424. [Google Scholar] [CrossRef] [PubMed]
- Zerbino, D.R.; Achuthan, P.; Akanni, W.; Amode, M.R.; Barrell, D.; Bhai, J.; Billis, K.; Cummins, C.; Gall, A.; Giron, C.G.; et al. Ensembl 2018. Nucleic Acids Res. 2018, 46, D754–D761. [Google Scholar] [CrossRef] [PubMed]
- Adzhubei, I.A.; Schmidt, S.; Peshkin, L.; Ramensky, V.E.; Gerasimova, A.; Bork, P.; Kondrashov, A.S.; Sunyaev, S.R. A method and server for predicting damaging missense mutations. Nat. Methods 2010, 7, 248–249. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, J.M.; Rodelsperger, C.; Schuelke, M.; Seelow, D. MutationTaster evaluates disease-causing potential of sequence alterations. Nat. Methods 2010, 7, 575–576. [Google Scholar] [CrossRef]
- Ng, P.C.; Henikoff, S. Predicting the effects of amino acid substitutions on protein function. Annu. Rev. Genom. Hum. Genet. 2006, 7, 61–80. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.; Henikoff, S.; Ng, P.C. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat. Protoc. 2009, 4, 1073–1081. [Google Scholar] [CrossRef]
- Choi, Y.; Chan, A.P. PROVEAN web server: A tool to predict the functional effect of amino acid substitutions and indels. Bioinformatics 2015, 31, 2745–2747. [Google Scholar] [CrossRef]
- Hornbeck, P.V.; Zhang, B.; Murray, B.; Kornhauser, J.M.; Latham, V.; Skrzypek, E. PhosphoSitePlus, 2014: Mutations, PTMs and recalibrations. Nucleic Acids Res 2015, 43, D512–D520. [Google Scholar] [CrossRef]
- Kircher, M.; Witten, D.M.; Jain, P.; O’Roak, B.J.; Cooper, G.M.; Shendure, J. A general framework for estimating the relative pathogenicity of human genetic variants. Nat. Genet. 2014, 46, 310–315. [Google Scholar] [CrossRef]
- Piva, F.; Giulietti, M.; Burini, A.B.; Principato, G. SpliceAid 2: A database of human splicing factors expression data and RNA target motifs. Hum. Mutat. 2012, 33, 81–85. [Google Scholar] [CrossRef]
- Desmet, F.O.; Hamroun, D.; Lalande, M.; Collod-Beroud, G.; Claustres, M.; Beroud, C. Human Splicing Finder: An online bioinformatics tool to predict splicing signals. Nucleic Acids Res. 2009, 37, e67. [Google Scholar] [CrossRef]
- Daumke, O.; Weyand, M.; Chakrabarti, P.P.; Vetter, I.R.; Wittinghofer, A. The GTPase-activating protein Rap1GAP uses a catalytic asparagine. Nature 2004, 429, 197–201. [Google Scholar] [CrossRef]
- Hoogeveen-Westerveld, M.; Ekong, R.; Povey, S.; Mayer, K.; Lannoy, N.; Elmslie, F.; Bebin, M.; Dies, K.; Thompson, C.; Sparagana, S.P.; et al. Functional assessment of TSC2 variants identified in individuals with tuberous sclerosis complex. Hum. Mutat. 2013, 34, 167–175. [Google Scholar] [CrossRef]
- Hoogeveen-Westerveld, M.; Wentink, M.; van den Heuvel, D.; Mozaffari, M.; Ekong, R.; Povey, S.; den Dunnen, J.T.; Metcalfe, K.; Vallee, S.; Krueger, S.; et al. Functional assessment of variants in the TSC1 and TSC2 genes identified in individuals with Tuberous Sclerosis Complex. Hum. Mutat. 2011, 32, 424–435. [Google Scholar] [CrossRef] [PubMed]
- Dufner Almeida, L.G.; Nanhoe, S.; Zonta, A.; Hosseinzadeh, M.; Kom-Gortat, R.; Elfferich, P.; Schaaf, G.; Kenter, A.; Kummel, D.; Migone, N.; et al. Comparison of the functional and structural characteristics of rare TSC2 variants with clinical and genetic findings. Hum. Mutat. 2019, 41, 759–773. [Google Scholar] [CrossRef]
- Overwater, I.E.; Swenker, R.; van der Ende, E.L.; Hanemaayer, K.B.; Hoogeveen-Westerveld, M.; van Eeghen, A.M.; Lequin, M.H.; van den Ouweland, A.M.; Moll, H.A.; Nellist, M.; et al. Genotype and brain pathology phenotype in children with tuberous sclerosis complex. Eur. J. Hum. Genet. 2016, 24, 1688–1695. [Google Scholar] [CrossRef] [PubMed]
- Blasco-Perez, L.; Iranzo-Nuez, L.; Lopez-Ortega, R.; Martinez-Cruz, D.; Camprodon-Gomez, M.; Tenes, A.; Antolin, M.; Tizzano, E.F.; Garcia-Arumi, E. An Integral Approach to the Molecular Diagnosis of Tuberous Sclerosis Complex: The Role of Mosaicism and Splicing Variants. J. Mol. Diagn. 2023, 25, 692–701. [Google Scholar] [CrossRef]
- Nellist, M.; Sancak, O.; Goedbloed, M.A.; Rohe, C.; van Netten, D.; Mayer, K.; Tucker-Williams, A.; van den Ouweland, A.M.; Halley, D.J. Distinct effects of single amino-acid changes to tuberin on the function of the tuberin-hamartin complex. Eur. J. Hum. Genet. 2005, 13, 59–68. [Google Scholar] [CrossRef]
- Kwiatkowski, D.J.; Palmer, M.R.; Jozwiak, S.; Bissler, J.; Franz, D.; Segal, S.; Chen, D.; Sampson, J.R. Response to everolimus is seen in TSC-associated SEGAs and angiomyolipomas independent of mutation type and site in TSC1 and TSC2. Eur. J. Hum. Genet. 2015, 23, 1665–1672. [Google Scholar] [CrossRef]
- Jones, A.C.; Shyamsundar, M.M.; Thomas, M.W.; Maynard, J.; Idziaszczyk, S.; Tomkins, S.; Sampson, J.R.; Cheadle, J.P. Comprehensive mutation analysis of TSC1 and TSC2—and phenotypic correlations in 150 families with tuberous sclerosis. Am. J. Hum. Genet. 1999, 64, 1305–1315. [Google Scholar] [CrossRef]
- Dabora, S.L.; Jozwiak, S.; Franz, D.N.; Roberts, P.S.; Nieto, A.; Chung, J.; Choy, Y.S.; Reeve, M.P.; Thiele, E.; Egelhoff, J.C.; et al. Mutational analysis in a cohort of 224 tuberous sclerosis patients indicates increased severity of TSC2, compared with TSC1, disease in multiple organs. Am. J. Hum. Genet. 2001, 68, 64–80. [Google Scholar] [CrossRef] [PubMed]
- Sancak, O.; Nellist, M.; Goedbloed, M.; Elfferich, P.; Wouters, C.; Maat-Kievit, A.; Zonnenberg, B.; Verhoef, S.; Halley, D.; van den Ouweland, A. Mutational analysis of the TSC1 and TSC2 genes in a diagnostic setting: Genotype–phenotype correlations and comparison of diagnostic DNA techniques in Tuberous Sclerosis Complex. Eur. J. Hum. Genet. 2005, 13, 731–741. [Google Scholar] [CrossRef]
- Hung, C.C.; Su, Y.N.; Chien, S.C.; Liou, H.H.; Chen, C.C.; Chen, P.C.; Hsieh, C.J.; Chen, C.P.; Lee, W.T.; Lin, W.L.; et al. Molecular and clinical analyses of 84 patients with tuberous sclerosis complex. BMC Med. Genet. 2006, 7, 72. [Google Scholar] [CrossRef] [PubMed]
- Rosengren, T.; Nanhoe, S.; de Almeida, L.G.D.; Schonewolf-Greulich, B.; Larsen, L.J.; Hey, C.A.B.; Duno, M.; Ek, J.; Risom, L.; Nellist, M.; et al. Mutational analysis of TSC1 and TSC2 in Danish patients with tuberous sclerosis complex. Sci. Rep. 2020, 10, 9909. [Google Scholar] [CrossRef] [PubMed]
- Reyna-Fabian, M.E.; Hernandez-Martinez, N.L.; Alcantara-Ortigoza, M.A.; Ayala-Sumuano, J.T.; Enriquez-Flores, S.; Velazquez-Aragon, J.A.; Varela-Echavarria, A.; Todd-Quinones, C.G.; Gonzalez-Del Angel, A. First comprehensive TSC1/TSC2 mutational analysis in Mexican patients with Tuberous Sclerosis Complex reveals numerous novel pathogenic variants. Sci. Rep. 2020, 10, 6589. [Google Scholar] [CrossRef] [PubMed]
- Rosset, C.; Vairo, F.; Bandeira, I.C.; Correia, R.L.; de Goes, F.V.; da Silva, R.T.B.; Bueno, L.S.M.; de Miranda Gomes, M.C.S.; Galvao, H.C.R.; Neri, J.; et al. Molecular analysis of TSC1 and TSC2 genes and phenotypic correlations in Brazilian families with tuberous sclerosis. PLoS ONE 2017, 12, e0185713. [Google Scholar] [CrossRef] [PubMed]
- Nunes, B.A.; Romano, A.; Pasa Morgan, M.A.; Goncalves, A.A.; Cardozo, L.F.M.; de Almeida, L.G.D.; Haddad, L.A.; Crippa, A.C.S.; Antoniuk, S.A.; Abagge, K.T. A dermatological assessment of pediatric patients with tuberous sclerosis complex (TSC). An. Bras. Dermatol. 2024. [Google Scholar] [CrossRef] [PubMed]
- Cardozo, L.F.M.; Schwind, M.R.; Pereira, A.P.A.; Dufner-Almeida, L.G.; Haddad, L.A.; Bruck, I.; Antoniuk, S.A. Neuropsychological profile in tuberous sclerosis complex: A study of clinical and cognitive variables in a cohort from Brazil. Arq. Neuropsiquiatr. 2024, 82, s00441787797. [Google Scholar] [CrossRef] [PubMed]
- Hoogeveen-Westerveld, M.; Ekong, R.; Povey, S.; Karbassi, I.; Batish, S.D.; den Dunnen, J.T.; van Eeghen, A.; Thiele, E.; Mayer, K.; Dies, K.; et al. Functional assessment of TSC1 missense variants identified in individuals with tuberous sclerosis complex. Hum. Mutat. 2012, 33, 476–479. [Google Scholar] [CrossRef]
- Abo-Dalo, B.; Kutsche, K.; Mautner, V.; Kluwe, L. Large intragenic deletions of the NF2 gene: Breakpoints and associated phenotypes. Genes Chromosomes Cancer 2010, 49, 171–175. [Google Scholar] [CrossRef]
- Abeysinghe, S.S.; Chuzhanova, N.; Krawczak, M.; Ball, E.V.; Cooper, D.N. Translocation and gross deletion breakpoints in human inherited disease and cancer I: Nucleotide composition and recombination-associated motifs. Hum. Mutat. 2003, 22, 229–244. [Google Scholar] [CrossRef] [PubMed]
- Gu, S.; Yuan, B.; Campbell, I.M.; Beck, C.R.; Carvalho, C.M.; Nagamani, S.C.; Erez, A.; Patel, A.; Bacino, C.A.; Shaw, C.A.; et al. Alu-mediated diverse and complex pathogenic copy-number variants within human chromosome 17 at p13.3. Hum. Mol. Genet. 2015, 24, 4061–4077. [Google Scholar] [CrossRef] [PubMed]
Figure 1.
Schematic representation of TSC1 (A) and TSC2 (B) protein domains according to NP_000359.1 and NP_000539.2. (A) Location of each pathogenic variant detected in TSC1. (B) Location of each pathogenic variant detected in TSC2. Splicing variants and CNVs are not represented in this figure.
Figure 1.
Schematic representation of TSC1 (A) and TSC2 (B) protein domains according to NP_000359.1 and NP_000539.2. (A) Location of each pathogenic variant detected in TSC1. (B) Location of each pathogenic variant detected in TSC2. Splicing variants and CNVs are not represented in this figure.
Figure 2.
Schematic representation of pathogenic TSC2 splice variants. Intron canonical splice sites and splicing branchpoint are underlined in a putative RNA sequence. Exon-intron borders are represented by vertical bars.
Figure 2.
Schematic representation of pathogenic TSC2 splice variants. Intron canonical splice sites and splicing branchpoint are underlined in a putative RNA sequence. Exon-intron borders are represented by vertical bars.
Figure 3.
TSC2 c.(975+627)_(1716+41)del intragenic deletion. (A) Sanger sequencing of the intragenic TSC2 deletion c.(975+627)_(1716+41)del identifies the breakpoints. (B) UCSC genome browser mapping of the breakpoints in TSC2 introns 10 and 16. (C) Diagram illustrating the positions of SINE/Alu and LINE/L1 repeat sequences in TSC2 introns 10 and 16, respectively, within and adjacent to each breakpoint (BP1 and BP2). Exons are shown as patterned boxes. The segments of introns 10 and 16 that display 83% similarity are indicated by lines.
Figure 3.
TSC2 c.(975+627)_(1716+41)del intragenic deletion. (A) Sanger sequencing of the intragenic TSC2 deletion c.(975+627)_(1716+41)del identifies the breakpoints. (B) UCSC genome browser mapping of the breakpoints in TSC2 introns 10 and 16. (C) Diagram illustrating the positions of SINE/Alu and LINE/L1 repeat sequences in TSC2 introns 10 and 16, respectively, within and adjacent to each breakpoint (BP1 and BP2). Exons are shown as patterned boxes. The segments of introns 10 and 16 that display 83% similarity are indicated by lines.
Figure 4.
Functional assessment of the TSC2 c.52C>G (p.L18V), c.499T>C (p.W167R), c.3132_3282del (p.1044_1094del) indicated as 1044del50, c.4493G>T (p.S1498I), c.4823_4825del (p.1608del), c.4840_4842del (p.1614del), and c.5227C>G (p.R1743G) variants. 3H9-1B1 (TSC2/TSC1 double knockout HEK 293T) cells were transfected with the indicated TSC2 variant expression constructs, together with expression constructs for myc-tagged TSC1 and S6K. WT-TSC2 as well as the pathogenic TSC2 c.1832G>A (p.R611Q) variant (R611Q) and cells with no TSC2 expression (TSC1/S6K only) were included as controls. GFP-TSC2 (GFP-TSC2 only) was employed to monitor transfection efficiency. Twenty-four hours after transfection, the cells were harvested, and the cleared cell lysates were analyzed by immunoblotting (A). The signals for TSC2, TSC1, total S6K (S6K), and T389-phosphorylated S6K (T389) were determined per variant, relative to the wild-type control (TSC2) in two independent experiments. Mean TSC2 (B), TSC1 (C), and S6K (D) signals and mean T389/S6K ratio (E) are shown for each variant. In each case, the dotted line indicates the signal/ratio for wild-type TSC2 (normalized to 1.0). Error bars represent the standard error of the mean. Statistical significance for comparisons with WT-TSC2 is indicated with an asterisk (p < 0.025; Student’s paired t-test).
Figure 4.
Functional assessment of the TSC2 c.52C>G (p.L18V), c.499T>C (p.W167R), c.3132_3282del (p.1044_1094del) indicated as 1044del50, c.4493G>T (p.S1498I), c.4823_4825del (p.1608del), c.4840_4842del (p.1614del), and c.5227C>G (p.R1743G) variants. 3H9-1B1 (TSC2/TSC1 double knockout HEK 293T) cells were transfected with the indicated TSC2 variant expression constructs, together with expression constructs for myc-tagged TSC1 and S6K. WT-TSC2 as well as the pathogenic TSC2 c.1832G>A (p.R611Q) variant (R611Q) and cells with no TSC2 expression (TSC1/S6K only) were included as controls. GFP-TSC2 (GFP-TSC2 only) was employed to monitor transfection efficiency. Twenty-four hours after transfection, the cells were harvested, and the cleared cell lysates were analyzed by immunoblotting (A). The signals for TSC2, TSC1, total S6K (S6K), and T389-phosphorylated S6K (T389) were determined per variant, relative to the wild-type control (TSC2) in two independent experiments. Mean TSC2 (B), TSC1 (C), and S6K (D) signals and mean T389/S6K ratio (E) are shown for each variant. In each case, the dotted line indicates the signal/ratio for wild-type TSC2 (normalized to 1.0). Error bars represent the standard error of the mean. Statistical significance for comparisons with WT-TSC2 is indicated with an asterisk (p < 0.025; Student’s paired t-test).
Figure 5.
Structural analysis of TSC2 variants affecting the TSC2 GAP domain. (A) Amino acid sequence alignment of human TSC2 (NP_000539.2) and the human RAP1GAP domain (NP_001337453.1). TSC2 Y1608 and RAP1GAP Y256 are indicated in red. (B) The TSC2:Y1608 residue is highlighted in red in the gray β-sheet part of the ribbon diagram of protein data bank structure (accession number: 1SRQ).
Figure 5.
Structural analysis of TSC2 variants affecting the TSC2 GAP domain. (A) Amino acid sequence alignment of human TSC2 (NP_000539.2) and the human RAP1GAP domain (NP_001337453.1). TSC2 Y1608 and RAP1GAP Y256 are indicated in red. (B) The TSC2:Y1608 residue is highlighted in red in the gray β-sheet part of the ribbon diagram of protein data bank structure (accession number: 1SRQ).
Table 1.
TSC1 pathogenic DNA variants in a cohort of 116 TSC patients.
| DNA Variant Type | DNA Variant | Location | Reported e | Frequency f | CADD g |
|---|---|---|---|---|---|
| Frameshift | c.683dup (p.I229Nfs*13) a | Exon 08 | - | - | - |
| Frameshift | c.989dup (p.S331Efs*10) | Exon 10 | 30 | - | - |
| Frameshift | c.1431_1434del (p.E478Kfs*53) d | Exon 14 | 14 | - | - |
| Frameshift | c.1517_1518dup (p.F507Pfs*26) a | Exon 15 | - | - | - |
| Frameshift | c.1888_1891del (p.K630Qfs*22) | Exon 15 | 58 | - | - |
| Frameshift | c.1907_1908del (p.E636Gfs*51) | Exon 15 | 16 | 6.19 × 10−7 | - |
| Frameshift | c.2332del (p.Q778Rfs*29) a | Exon 18 | - | - | - |
| Frameshift | c.2746del (p.L916Wfs*15) a | Exon 21 | - | - | - |
| Nonsense | c.936C>G (p.Y312*) a | Exon 10 | - | - | 34 |
| Nonsense | c.1498C>T (p.R500*) d | Exon 15 | 44 | - | 39 |
| Nonsense | c.1525C>T (p.R509*) d | Exon 15 | 73 | - | 38 |
| Nonsense | c.1579C>T (p.Q527*) | Exon 16 | 7 | - | 36 |
| Nonsense | c.2356C>T (p.R786*) | Exon 18 | 48 | - | 41 |
| Nonsense | c.2626G>T (p.E876*) a | Exon 21 | - | 1.57 × 10−6 | 47 |
| Large deletion | c.(737+_738-)_(*1+_?)del b,c | Exons 9–23 | - | - | - |
a First description of this mutation. b NGS and MLPA performed for both genes, in addition to Sanger sequencing. c Deletion confirmed by qPCR. d Same mutation in two unrelated patients. e Total reported cases according to LOVD-TSC1 (June/2024). f Frequency according to gnomAD data bank (June/2024). g CADD (Combined Annotation Dependent Depletion) v1.6.
Table 2.
TSC2 pathogenic DNA variants in a cohort of 116 TSC patients.
| DNA Variant Type | DNA Variant | Functional Testing * | Location | Reported g | Frequency n | CADD o | ||
|---|---|---|---|---|---|---|---|---|
| 1. | Frameshift | c.352del (p.V118Sfs*64) a | NR | Exon 05 | - | - | - | |
| 2. | Frameshift | c.894dup (p.V299Cfs*39) | No | Exon 10 | 5 | - | - | |
| 3. | Frameshift | c.1507del (p.Q503Rfs*32) a | NR | Exon 15 | - | - | - | |
| 4. | Frameshift | c.1842del (p.F615Lfs*83) | NR | Exon 18 | - | - | - | |
| 5. | Frameshift | c.1959_1960del (p.G654Lfs*2) | No | Exon 19 | 5 | - | - | |
| 6. | Frameshift | c.2046dup (p.S683Vfs*20) | No | Exon 19 | 2 | - | - | |
| 7. | Frameshift | c.2073dup (p.V692Rfs*11) a | NR | Exon 19 | - | - | - | |
| 8. | Frameshift | c.2467_2476delinsGTGGATGA (p.L823Vfs*59) a | NR | Exon 21 | - | - | - | |
| 9. | Frameshift | c.2563dup (p.H855Pfs*28) a | NR | Exon 23 | - | - | - | |
| 10. | Frameshift | c.2737_2739delinsC (p.T913Qfs*12) a | NR | Exon 24 | - | - | - | |
| 11. | Frameshift | c.2784del (p.E929Rfs*19) | No | Exon 25 | 2 | - | - | |
| 12. | Frameshift | c.3370del (p.A1124Pfs*67) a | NR | Exon 29 | - | - | - | |
| 13. | Frameshift | c.3541dup (p.T1181Nfs*53) a | NR | Exon 30 | - | - | - | |
| 14. | Frameshift | c.4187del (p.D1396Afs*15) a | NR | Exon 34 | - | - | - | |
| 15. | Frameshift | c.4324_4327delinsCTTCT (p.E1442Lfs*82) a | NR | Exon 34 | - | - | - | |
| 16. | Frameshift | c.4544_4547del (p.N1515Sfs*60) | No | Exon 35 | 31 | - | - | |
| 17. | Frameshift | c.4738del (p.R1580Gfs*5) a | NR | Exon 37 | - | - | - | |
| 18. | Frameshift | c.4947_4948insCCATTGT (p.Y1650Pfs*5) a | NR | Exon 38 | - | - | - | |
| 19. | Frameshift | c.5075_5078del (p.E1692Afs*133) a | No | Exon 40 | 3 | - | - | |
| 20. | Frameshift | c.5159dup (p.N1720Kfs*9) a | NR | Exon 40 | - | - | - | |
| 21. | Nonsense | c.195T>A (p.C65*) a | NR | Exon 03 | - | - | 34 | |
| 22. | Nonsense | c.268C>T (p.Q90*) h | No | Exon 04 | 32 | - | 36 | |
| 23. | Nonsense | c.496C>T (p.Q166*) i | No | Exon 05 | 7 | - | 41 | |
| 24. | Nonsense | c.973C>T (p.Q325*) | No | Exon 10 | 4 | - | 36 | |
| 25. | Nonsense | c.1008T>G (p.Y336*) | No | Exon 11 | 3 | - | 32 | |
| 26. | Nonsense | c.1195G>T (p.E399*) | No | Exon 12 | 2 | - | 38 | |
| 27. | Nonsense | c.1294C>T (p.Q432*) | No | Exon 13 | 3 | - | 37 | |
| 28. | Nonsense | c.1372C>T (p.R458*) | No | Exon 14 | 50 | - | 38 | |
| 29. | Nonsense | c.2251C>T (p.R751*) | No | Exon 21 | 46 | - | 38 | |
| 30. | Nonsense | c.3099C>G (p.Y1033*) | No | Exon 27 | 10 | - | 33 | |
| 31. | Nonsense | c.3412C>T (p.R1138*) | No | Exon 30 | 62 | - | 46 | |
| 32. | Nonsense | c.4255C>T (p.Q1419*) | No | Exon 34 | 15 | - | 47 | |
| 33. | Nonsense | c.4298C>A (p.S1433*) | No | Exon 34 | 2 | - | 36 | |
| 34. | Nonsense | c.4375C>T (p.R1459*) | No | Exon 34 | 49 | 6.23 × 10−8 | 40 | |
| 35. | Nonsense | c.4693G>T (p.E1565*) | No | Exon 37 | 1 | - | 49 | |
| 36. | Nonsense | c.4716_4717delGGinTT (p.E1573*) a | NR | Exon 37 | - | - | - | |
| 37. | Nonsense | c.5034C>A (p.Y1678*) | No | Exon 39 | 2 | - | 27.4 | |
| 38. | Nonsense | c.5208C>G (p.Y1736*) a | NR | Exon 41 | - | - | 37 | |
| 39. | Nonsense | c.5220G>A (p.W1740*) | No | Exon 41 | 4 | - | 54 | |
| 40. | Missense | c.1525A>C (p.T509P) k | Yes | Exon 15 | 3 | 25.9 | ||
| 41. | Missense | c.1663G>C (p.A555P) j,k | Yes | Exon 16 | 3 | 3.09 × 10−6 | 22.7 | |
| 42. | Missense | c.1790A>G (p.H597R)k | Yes | Exon 17 | 9 | - | 23.6 | |
| 43. | Missense | c.1793A>G (p.Y598C) k | Yes | Exon 17 | 7 | - | 24.6 | |
| 44. | Missense | c.1831C>T (p.R611W) k | Yes | Exon 17 | 54 | - | 27.9 | |
| 45. | Missense | c.1832G>A (p.R611Q) d,k | Yes | Exon 17 | 101 | - | 28.8 | |
| 46. | Missense | c.2540T>C (p.L847P) k | Yes | Exon 22 | 8 | - | 29.4 | |
| 47. | Missense | c.4493G>T (p.S1498I) d | Yes | Exon 34 | 2 | - | 34 | |
| 48. | Missense | c.4909_4911delinsGAC (p.K1637D) l | Yes | Exon 38 | 2 | - | - | |
| 49. | Missense | c.4919A>G (p.H1640R) l | Yes | Exon 38 | 4 | - | 25.6 | |
| 50. | Missense | c.5024C>T (p.P1675L) h,l | Yes | Exon 39 | 63 | - | 28.4 | |
| 51. | Missense | c.5227C>G (p.R1743G) d,l | Yes | Exon 41 | 4 | - | 23.3 | |
| 52. | Missense | c.5227C>T (p.R1743W) l | Yes | Exon 41 | 57 | - | 25.2 | |
| 53. | Missense | c.5228G>C (p.R1743P) l | Yes | Exon 41 | 10 | - | 29.9 | |
| 54. | Missense | c.5228G>A (p.R1743Q) l | Yes | Exon 41 | 62 | - | 32 | |
| 55. | In-frame deletion | c.824_826del (p.N275del) k | Yes | Exon 09 | 6 | - | - | |
| 56. | In-frame deletion | c.4823_4825del (p.Y1608del) j,l | Yes | Exon 37 | 15 | - | - | |
| 57. | In-frame deletion | c.4842_4844del (p.I1614del) j,l | Yes | Exon 37 | 22 | - | - | |
| 58. | In-frame deletion | c.5238_5255del (p.H1746_R1751del) l | Yes | Exon 41 | 125 | 6.02 × 10−6 | - | |
| 59. | Large Deletion | c.(774+1_775-1)_(848+1_849-1)del a | No | Exon 09 | - | - | - | |
| 60. | Large Deletion | c.(975+628)_(1716+41)del a,b,c | No | Exon 11–16 | - | - | - | |
| 61. | Large Deletion | c.(1599+1_1600-1)_(2545+1_2546-1)del a | No | Exon 16–22 | - | - | - | |
| 62. | Large Deletion | c.(1716+1_1717-1)_(2545+1_2546-1)del a | No | Exon 17–22 | - | - | - | |
| 63. | Large Deletion | c.(5068+1_5069-1)_(*102_?)del | No | Exon 39-PKD1 | 1 | - | - | |
| 64. | Large Deletion | c.(?_-30)_(*102_?)del a | No | TSC2 | 2 | - | - | |
| 65. | Large Duplication | c.(2355+1_2356-1)_(*102_?)dup | No | Exon 22–42 | 1 | - | - | |
| 66. | Complex | c.5423G>C (p.*1808Sext*19) c | No | Exon 42 | 2 | - | 11.8 | |
| DNA variant type | DNA Variant | Predicted effects: [r.spl?] e or [r.(spl?)] f | ||||||
| 67. | Splicing | c.337-1G>A | [r.spl?]: exon 4 skipping, p.G113Lfs*20 | No | Intron 04 | 2 | - | 35 |
| 68. | Splicing | c.481+2T>C a | [r.spl?]: exon 4 skipping, p.G113Lfs*20 | NR | Intron 05 | - | - | 31 |
| 69. | Splicing | c.482-1G>A a | [r.spl?]: exon 6 skipping, p.A161Vfs*22 | NR | Intron 05 | - | - | 33 |
| 70. | Splicing | c.600-2A>G | [r.spl?] exon 7 skipping, p.Q200fs*3 | No | Intron 06 | 11 | - | 26.2 |
| 71. | Splicing | c.775-2A>G a | [r.spl?]: exon 9 skipping, p.L259* | NR | Intron 08 | - | - | 33 |
| 72. | Splicing | c.848+4_848+9del a | [r.(spl?)]: exon 8 skipping, p.L259Sfs*52 | NR | Intron 09 | - | - | - |
| 73. | Splicing | c.1119G>A (p.=) | [r.spl?]: exon 11 skipping, p.Ala326_Gln373del | Yes | Exon 11 | 4 | - | 19.54 |
| 74. | Splicing | c.1717-1G>A | [r.spl?]: exon 17 skipping, p.T573Sfs*5 | No | Intron 16 | 2 | - | 34 |
| 75. | Splicing | c.1947-2_ 1947-1delinsCC a | [r.spl?]: exon 19 skipping, p.M649fs*7 | NR | Intron 18 | - | - | - |
| 76. | Splicing | c.2355+2_2355+5del | r.[=,2166_2583ins2355+5_2355+7, 2166_2583ins(2355+1_2356-1)58] | Yes | Intron 21 | 17 | - | - |
| 77. | Splicing | c.2545+1G>A | [r.spl?] exon 21 skipping, p.L741_Q785del | No | Intron 22 | 5 | - | 35 |
| 78. | Splicing | c.2639+1G>A | [r.spl?] exon 22 skipping, p.R786Lfs45* | No | Intron 23 | 3 | - | 34 |
| 79. | Splicing | c.2838-122G>A h | [r.(2837_2838ins2838-120_2838-1)], p.S946Rfs*6 | Yes | Intron 25 | 11 | - | 36 |
| 80. | Splicing | c.3132-3T>G a,j | [r.(spl?)]: in-frame exon 28 skipping, p.1044del50 | Yes m | Intron 27 | - | - | 15.64 |
| 81. | Splicing | c.4493+1G>C a | [r.spl?]: exon 33 skipping, p.D1295Vfs*77 | NR | Intron 34 | - | - | 33 |
| 82. | Splicing | c.5160+1G>C | [r.spl?]: exon 39 skipping, p.D1690Dfs*6 | No | Intron 40 | 3 | - | 33 |
| 83. | Splicing | c.5160+1G>A | [r.spl?]: exon 39 skipping, p.D1690Dfs*6 | No | Intron 40 | 10 | - | 32 |
* Some variants have been functionally tested in this study or before according to LOVD TSC2 database. NR: Not reported. a First description of this mutation. b NGS and MLPA performed for both genes, in addition to Sanger sequencing. c Deletion confirmed by qPCR. d MLPA performed for both genes, in addition to Sanger sequencing. e [r.spl?]: RNA was not analyzed but the change is expected to affect splicing. f [r.(spl?)]: RNA was not analyzed but the change might affect splicing. g Number of references according to LOVD-TSC2 (April/2024). h Same mutation in two unrelated patients. i Same mutation in three unrelated patients. j Functional assay reported in the present study. k Amino acid effect on harmatin-binding domain. l Amino acid effect on GAP domain. m First description of variant and functional analysis on this study. n Frequency according to gnomAD data bank (June/2024). o CADD (Combined Annotation Dependent Depletion) v1.6.
Table 3.
MLPA and qPCR results for TSC2 segmental deletions and duplication.
| MLPA | qPCR | ||||
|---|---|---|---|---|---|
| Segmental Deletion or Duplication | Exon | PS (p-Value) | Exon | RQ (SEM) | p-Value |
| c.(774+1_775-1)_(848+1_849-1)del | 09 | 0.58 (<0.01) | 9 | 0.45 (0.03) | <0.01 |
| c.(975+628)_(1716+41)del * | 11–16 | 0.74 (<0.01) | 12 | 0.62 (0.07) | 0.03 |
| c.(1599+1_1600-1)_(2545+1_2546-1)del | 16–22 | 0.56 (<0.01) | 19 | 0.54 (0.01) | <0.01 |
| c.(1716+1_1717-1)_(2545+1_2546-1)del | 17–22 | 0.56 (<0.01) | 19 | 0.63 (0.02) | <0.01 |
| c.(5068+1_5069-1)_(*102_?)del * | 39-PKD1 | 0.68 (<0.01) | 41 | 0.75 (0.02) | <0.01 |
| c.(?_-30)_(*102_?)del | 01–42 | 0.54 (<0.01) | 12 | 0.5 (0.03) | <0.01 |
| c.(2355+1_2356-1)_(*102_?)dup | 22–42 | 1.47 (<0.01) | 41 | 2.43 (0.07) | <0.01 |
MLPA exon refers to the extension of the detected deletion or duplication, while qPCR exon refers to the TSC2 exon tested to validate MLPA. PS: mean probe signal; p-Value: Student’s t-test p-value; RQ: ratio coefficient; SEM: standard error of mean. * Indicative of somatic mosaicism.
Table 4.
TSC1 and TSC2 pathogenic DNA alterations according to mutation type.
| Variant Type | TSC1/TSC2 | Total |
|---|---|---|
| Nonsense | 8/22 | 30 |
| Frameshift | 9/20 | 29 |
| Splicing | 0/18 | 18 |
| Missense | 0/16 | 16 |
| Large deletion | 1/6 | 7 |
| In-frame deletion | 0/4 | 4 |
| Large duplication | 0/1 | 1 |
| Complex | 0/1 | 1 |
| Total | 18/88 | 106 (91.4%) |
| TSC1:TSC2 ratio | 1:4.9 | |
| No mutation identified (NMI) | 10 (8.6%) | |
| Total | 116 | |
Table 5.
Variants with no significant effect on TSC1/2 activity identified in individual with pathogenic variants.
Table 5.
Variants with no significant effect on TSC1/2 activity identified in individual with pathogenic variants.
| Benign Variant | Pathogenic Variant |
|---|---|
| c.52C>G (p.L18V) | c.4493G>T (p.Ser1498Ile) |
| c.499T>C (p.W167R) | c.4375C>T (p.Arg1459*) |
| c.2167A>G (p.I723V) | c.1195G>T (p.E399*) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Dufner-Almeida, L.G.; Cardozo, L.F.M.; Schwind, M.R.; Carvalho, D.; Almeida, J.P.G.; Cappellano, A.M.; Alegria, T.G.P.; Nanhoe, S.; Nellist, M.; Passos-Bueno, M.R.; et al. Molecular and Functional Assessment of TSC1 and TSC2 in Individuals with Tuberous Sclerosis Complex. Genes 2024, 15, 1432. https://doi.org/10.3390/genes15111432
AMA Style
Dufner-Almeida LG, Cardozo LFM, Schwind MR, Carvalho D, Almeida JPG, Cappellano AM, Alegria TGP, Nanhoe S, Nellist M, Passos-Bueno MR, et al. Molecular and Functional Assessment of TSC1 and TSC2 in Individuals with Tuberous Sclerosis Complex. Genes. 2024; 15(11):1432. https://doi.org/10.3390/genes15111432
Chicago/Turabian StyleDufner-Almeida, Luiz Gustavo, Laís F. M. Cardozo, Mariana R. Schwind, Danielly Carvalho, Juliana Paula G. Almeida, Andrea Maria Cappellano, Thiago G. P. Alegria, Santoesha Nanhoe, Mark Nellist, Maria Rita Passos-Bueno, and et al. 2024. "Molecular and Functional Assessment of TSC1 and TSC2 in Individuals with Tuberous Sclerosis Complex" Genes 15, no. 11: 1432. https://doi.org/10.3390/genes15111432
APA StyleDufner-Almeida, L. G., Cardozo, L. F. M., Schwind, M. R., Carvalho, D., Almeida, J. P. G., Cappellano, A. M., Alegria, T. G. P., Nanhoe, S., Nellist, M., Passos-Bueno, M. R., Chiavegatto, S., Silva, N. S., Rosemberg, S., Pereira, A. P. A., Antoniuk, S. A., & Haddad, L. A. (2024). Molecular and Functional Assessment of TSC1 and TSC2 in Individuals with Tuberous Sclerosis Complex. Genes, 15(11), 1432. https://doi.org/10.3390/genes15111432
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
