E-Cigarette Exposure Alters Neuroinflammation Gene and Protein Expression in a Murine Model: Insights from Perinatally Exposed Offspring and Post-Birth Mothers
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Mating and Exposures
2.2. E-Cig Exposures
2.3. Tissue Processing
2.4. Western Blotting
2.5. RNA Isolation
2.6. Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR) Analysis
2.7. Statistical Analysis
3. Results
3.1. Offspring: Western Blot Analyses of Select Proteins in Offspring Hypothalamus
3.2. Perinatally Exposed Offspring: RT-qPCR Analysis of Selected Genes in Hypothalamus Tissues following Exposure to E-Cig Aerosols
3.3. Post-Birth Dams: RT-qPCR Analysis of Selected Genes in Hippocampal Tissues following Exposure to E-Cig Aerosols
4. Discussion
4.1. Metabolic Dysregulation, Obesity, and Diabetes in Offspring
4.2. Neuroinflammation in Exposed Offspring
4.3. Systemic Inflammation: Inflammation in Exposed Post-Birth Dams
4.4. Cognitive and Metabolic Dysfunction in Post-Birth Dams
5. Conclusions
6. Limitations and Future Directions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Crotty Alexander, L.; Fuster, M.; Montgrain, P.; Malhotra, A. The need for more e-cigarette data: A call to action. Am. J. Respir. Crit. Care Med. 2015, 192, 275–276. [Google Scholar] [CrossRef] [PubMed]
- DeVito, E.E.; Krishnan-Sarin, S. E-cigarettes: Impact of E-Liquid Components and Device Characteristics on Nicotine Exposure. Curr. Neuropharmacol. 2018, 16, 438–459. [Google Scholar] [CrossRef] [PubMed]
- Hasan, K.M.; Munoz, A.; Tumoyan, H.; Parveen, M.; Espinoza-Derout, J.; Shao, X.M.; Mahata, S.K.; Friedman, T.C.; Sinha-Hikim, A.P. Adverse effects of fetal exposure of electronic-cigarettes and high-fat diet on male neonatal hearts. Exp. Mol. Pathol. 2021, 118, 104573. [Google Scholar] [CrossRef] [PubMed]
- Merecz-Sadowska, A.; Sitarek, P.; Zielinska-Blizniewska, H.; Malinowska, K.; Zajdel, K.; Zakonnik, L.; Zajdel, R. A Summary of In Vitro and In Vivo Studies Evaluating the Impact of E-Cigarette Exposure on Living Organisms and the Environment. Int. J. Mol. Sci. 2020, 21, 652. [Google Scholar] [CrossRef] [PubMed]
- Travis, N.; Knoll, M.; Cook, S.; Oh, H.; Cadham, C.J.; Sánchez-Romero, L.M.; Levy, D.T. Chemical Profiles and Toxicity of Electronic Cigarettes: An Umbrella Review and Methodological Considerations. Int. J. Environ. Res. Public Health 2023, 20, 1908. [Google Scholar] [CrossRef] [PubMed]
- Tehrani, M.W.; Newmeyer, M.N.; Rule, A.M.; Prasse, C. Characterizing the Chemical Landscape in Commercial E-Cigarette Liquids and Aerosols by Liquid Chromatography–High-Resolution Mass Spectrometry. Chem. Res. Toxicol. 2021, 34, 2216–2226. [Google Scholar] [CrossRef] [PubMed]
- Hickman, E.; Payton, A.; Duffney, P.; Wells, H.; Ceppe, A.S.; Brocke, S.; Bailey, A.; Rebuli, M.E.; Robinette, C.; Ring, B.; et al. Biomarkers of Airway Immune Homeostasis Differ Significantly with Generation of E-Cigarettes. Am. J. Respir. Crit. Care Med. 2022, 206, 1248–1258. [Google Scholar] [CrossRef]
- Zelikoff, J.T.; Parmalee, N.L.; Corbett, K.; Gordon, T.; Klein, C.B.; Aschner, M. Microglia Activation and Gene Expression Alteration of Neurotrophins in the Hippocampus Following Early-Life Exposure to E-Cigarette Aerosols in a Murine Model. Toxicol. Sci. 2018, 162, 276–286. [Google Scholar] [CrossRef]
- Lauterstein, D.E.; Tijerina, P.B.; Corbett, K.; Oksuz, B.A.; Shen, S.S.; Gordon, T.; Klein, C.B.; Zelikoff, J.T. Frontal Cortex Transcriptome Analysis of Mice Exposed to Electronic Cigarettes During Early Life Stages. Int. J. Environ. Res. Public Health 2016, 13, 417. [Google Scholar] [CrossRef]
- Albers, L.; Sobotzki, C.; Kuß, O.; Ajslev, T.; Batista, R.F.; Bettiol, H.; Brabin, B.; Buka, S.L.; Cardoso, V.C.; Clifton, V.L.; et al. Maternal smoking during pregnancy and offspring overweight: Is there a dose–response relationship? An individual patient data meta-analysis. Int. J. Obes. 2018, 42, 1249–1264. [Google Scholar] [CrossRef]
- Rayfield, S.; Plugge, E. Systematic review and meta-analysis of the association between maternal smoking in pregnancy and childhood overweight and obesity. J. Epidemiol. Community Health 2017, 71, 162–173. [Google Scholar] [CrossRef]
- Waterson, M.J.; Horvath, T.L. Neuronal Regulation of Energy Homeostasis: Beyond the Hypothalamus and Feeding. Cell Metab. 2015, 22, 962–970. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Iglesias, M.A.; Caruso, V.; Morris, M.J. Maternal cigarette smoke exposure contributes to glucose intolerance and decreased brain insulin action in mice offspring independent of maternal diet. PLoS ONE 2011, 6, e27260. [Google Scholar] [CrossRef] [PubMed]
- Center for Disease Control and Prevention. Prevalence of Childhood Obesity in the United States. 2020. Available online: https://www.cdc.gov/obesity/data/childhood.html (accessed on 22 February 2024).
- Giacobbo, B.L.; Doorduin, J.; Klein, H.C.; Dierckx, R.A.J.O.; Bromberg, E.; de Vries, E.F.J. Brain-Derived Neurotrophic Factor in Brain Disorders: Focus on Neuroinflammation. Mol. Neurobiol. 2019, 56, 3295–3312. [Google Scholar] [CrossRef]
- Gao, L.; Zhang, Y.; Sterling, K.; Song, W. Brain-derived neurotrophic factor in Alzheimer’s disease and its pharmaceutical potential. Transl. Neurodegener. 2022, 11, 4. [Google Scholar] [CrossRef] [PubMed]
- Berk, M.; Kapczinski, F.; Andreazza, A.; Dean, O.; Giorlando, F.; Maes, M.; Yücel, M.; Gama, C.; Dodd, S.; Dean, B.; et al. Pathways underlying neuroprogression in bipolar disorder: Focus on inflammation, oxidative stress and neurotrophic factors. Neurosci. Biobehav. Rev. 2010, 35, 804–817. [Google Scholar] [CrossRef] [PubMed]
- Sandrini, L.; Di Minno, A.; Amadio, P.; Ieraci, A.; Tremoli, E.; Barbieri, S.S. Association between Obesity and Circulating Brain-Derived Neurotrophic Factor (BDNF) Levels: Systematic Review of Literature and Meta-Analysis. Int. J. Mol. Sci. 2018, 19, 2281. [Google Scholar] [CrossRef]
- Becher, B.; Spath, S.; Goverman, J. Cytokine networks in neuroinflammation. Nat. Rev. Immunol. 2017, 17, 49–59. [Google Scholar] [CrossRef]
- Castanon, N.; Lasselin, J.; Capuron, L. Neuropsychiatric Comorbidity in Obesity: Role of Inflammatory Processes. Front. Endocrinol. 2014, 5, 74. [Google Scholar] [CrossRef]
- Salas-Venegas, V.; Flores-Torres, R.P.; Rodríguez-Cortés, Y.M.; Rodríguez-Retana, D.; Ramírez-Carreto, R.J.; Concepción-Carrillo, L.E.; Pérez-Flores, L.J.; Alarcón-Aguilar, A.; López-Díazguerrero, N.E.; Gómez-González, B.; et al. The Obese Brain: Mechanisms of Systemic and Local Inflammation, and Interventions to Reverse the Cognitive Deficit. Front. Integr. Neurosci. 2022, 16, 798995. [Google Scholar] [CrossRef]
- Dinel, A.-L.; André, C.; Aubert, A.; Ferreira, G.; Layé, S.; Castanon, N. Cognitive and Emotional Alterations Are Related to Hippocampal Inflammation in a Mouse Model of Metabolic Syndrome. PLoS ONE 2011, 6, e24325. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Taneja, V.; Vassallo, R. Cigarette smoking and inflammation: Cellular and molecular mechanisms. J. Dent. Res. 2012, 91, 142–149. [Google Scholar] [CrossRef] [PubMed]
- Jamshed, L.; A Perono, G.; Jamshed, S.; Holloway, A.C. Early Life Exposure to Nicotine: Postnatal Metabolic, Neurobehavioral and Respiratory Outcomes and the Development of Childhood Cancers. Toxicol. Sci. 2020, 178, 3–15. [Google Scholar] [CrossRef] [PubMed]
- Bellavite, P.; Conforti, A.; Marzotto, M.; Magnani, P.; Cristofoletti, M.; Olioso, D.; Zanolin, M.E. Testing homeopathy in mouse emotional response models: Pooled data analysis of two series of studies. Evid.-Based Complement. Altern. Med. 2012, 2012, 954374. [Google Scholar] [CrossRef] [PubMed]
- Chomczynski, P.; Mackey, K. Short technical reports. Modification of the TRI reagent procedure for isolation of RNA from polysaccharide- and proteoglycan-rich sources. Biotechniques 1995, 19, 942–945. [Google Scholar] [PubMed]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
- Hwang, S.J.; Kim, J.H.; Shim, J.W.; Kim, D.S.; Jung, H.L.; Park, M.S.; Lee, W.Y.; Kim, S.-Y.; Shim, J.Y. Peroxisome proliferator-activated receptor-gamma expression in the lung tissue of obese rats. Yonsei Med. J. 2011, 52, 495–501, Correction in Yonsei Med. J. 2011, 52, 699. [Google Scholar] [CrossRef]
- Liu, Z.-J.; Bian, J.; Liu, J.; Endoh, A. Obesity reduced the gene expressions of leptin receptors in hypothalamus and liver. Horm. Metab. Res. 2007, 39, 489–494. [Google Scholar] [CrossRef]
- Wankhade, U.D.; Good, D.J. Melanocortin 4 receptor is a transcriptional target of nescient helix-loop-helix-2. Mol. Cell. Endocrinol. 2011, 341, 39–47. [Google Scholar] [CrossRef]
- Fu, X.; Zhao, J.-X.; Zhu, M.-J.; Foretz, M.; Viollet, B.; Dodson, M.V.; Du, M. AMP-activated protein kinase α1 but not α2 catalytic subunit potentiates myogenin expression and myogenesis. Mol. Cell. Biol. 2013, 33, 4517–4525. [Google Scholar] [CrossRef]
- Pillot, B.; Duraffourd, C.; Bégeot, M.; Joly, A.; Luquet, S.; Houberdon, I.; Naville, D.; Vigier, M.; Gautier-Stein, A.; Magnan, C.; et al. Role of hypothalamic melanocortin system in adaptation of food intake to food protein increase in mice. PLoS ONE 2011, 6, e19107. [Google Scholar] [CrossRef]
- Miranda, A.; Pericuesta, E.; Ramírez, M.; Gutierrez-Adan, A. Prion protein expression regulates embryonic stem cell pluripotency and differentiation. PLoS ONE 2011, 6, e18422. [Google Scholar] [CrossRef]
- Blum, J.L.; Edwards, J.R.; Prozialeck, W.C.; Xiong, J.Q.; Zelikoff, J.T. Effects of maternal exposure to cadmium oxide nanoparticles during pregnancy on maternal and offspring kidney injury markers using a murine model. J. Toxicol. Environ. Health Part A 2015, 78, 711–724. [Google Scholar] [CrossRef]
- Gluckman, P.D.; Hanson, M.A.; Cooper, C.; Thornburg, K.L. Effect of in utero and early-life conditions on adult health and disease. N. Engl. J. Med. 2008, 359, 61–73. [Google Scholar] [CrossRef] [PubMed]
- Motawi, T.K.; Shaker, O.G.; Ismail, M.F.; Sayed, N.H. Peroxisome Proliferator-Activated Receptor Gamma in Obesity and Colorectal Cancer: The Role of Epigenetics. Sci. Rep. 2017, 7, 10714. [Google Scholar] [CrossRef] [PubMed]
- Cai, D.; Liu, T. Hypothalamic inflammation: A double-edged sword to nutritional diseases. Ann. N. Y. Acad. Sci. 2011, 1243, E1–E39. [Google Scholar] [CrossRef] [PubMed]
- Kapogiannis, D.; Avgerinos, K.I. Chapter Three—Brain glucose and ketone utilization in brain aging and neurodegenerative diseases. Int. Rev. Neurobiol. 2020, 154, 79–110. [Google Scholar] [CrossRef] [PubMed]
- Mukhara, D.; Oh, U.; Neigh, G.N. Neuroinflammation. Handb. Clin. Neurol. 2020, 175, 235–259. [Google Scholar] [CrossRef] [PubMed]
- Ruszkiewicz, J.A.; Zhang, Z.; Gonçalves, F.M.; Tizabi, Y.; Zelikoff, J.T.; Aschner, M. Neurotoxicity of e-cigarettes. Food Chem. Toxicol. 2020, 138, 111245. [Google Scholar] [CrossRef] [PubMed]
- Muthumalage, T.; Prinz, M.; Ansah, K.O.; Gerloff, J.; Sundar, I.K.; Rahman, I. Inflammatory and Oxidative Responses Induced by Exposure to Commonly Used e-Cigarette Flavoring Chemicals and Flavored e-Liquids without Nicotine. Front. Physiol. 2018, 8, 1130. [Google Scholar] [CrossRef]
- Royo, M.; Escolano, B.A.; Madrigal, M.P.; Jurado, S. AMPA Receptor Function in Hypothalamic Synapses. Front. Synaptic Neurosci. 2022, 14, 833449. [Google Scholar] [CrossRef]
- Wu, Q.-L.; Gao, Y.; Li, J.-T.; Ma, W.-Y.; Chen, N.-H. The Role of AMPARs Composition and Trafficking in Synaptic Plasticity and Diseases. Cell. Mol. Neurobiol. 2022, 42, 2489–2504. [Google Scholar] [CrossRef]
- Raise-Abdullahi, P.; Meamar, M.; Vafaei, A.A.; Alizadeh, M.; Dadkhah, M.; Shafia, S.; Ghalandari-Shamami, M.; Naderian, R.; Samaei, S.A.; Rashidy-Pour, A. Hypothalamus and Post-Traumatic Stress Disorder: A Review. Brain Sci. 2023, 13, 1010. [Google Scholar] [CrossRef]
- Choquet, H.; Meyre, D. Genomic insights into early-onset obesity. Genome Med. 2010, 2, 36. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Lai, F.; Hou, Y.; Zheng, R. Leptin signaling and leptin resistance. Med. Rev. 2022, 2, 363–384. [Google Scholar] [CrossRef]
- Wang, B.; Cheng, K.K.-Y. Hypothalamic AMPK as a Mediator of Hormonal Regulation of Energy Balance. Int. J. Mol. Sci. 2018, 19, 3552. [Google Scholar] [CrossRef]
- Cowley, M.A.; Smith, R.G.; Diano, S.; Tschöp, M.; Pronchuk, N.; Grove, K.L.; Strasburger, C.J.; Bidlingmaier, M.; Esterman, M.; Heiman, M.L.; et al. The distribution and mechanism of action of ghrelin in the CNS demonstrates a novel hypothalamic circuit regulating energy homeostasis. Neuron 2003, 37, 649–661. [Google Scholar] [CrossRef] [PubMed]
- Cui, H.; López, M.; Rahmouni, K. The cellular and molecular bases of leptin and ghrelin resistance in obesity. Nat. Rev. Endocrinol. 2017, 13, 338–351. [Google Scholar] [CrossRef]
- Wu, Y.; Song, P.; Zhang, W.; Liu, J.; Dai, X.; Liu, Z.; Lu, Q.; Ouyang, C.; Xie, Z.; Zhao, Z.; et al. Activation of AMPKα2 in adipocytes is essential for nicotine-induced insulin resistance in vivo. Nat. Med. 2015, 21, 373–382. [Google Scholar] [CrossRef] [PubMed]
- Villapol, S. Roles of Peroxisome Proliferator-Activated Receptor Gamma on Brain and Peripheral Inflammation. Cell. Mol. Neurobiol. 2018, 38, 121–132. [Google Scholar] [CrossRef]
- Yu, Y.; Zhang, Z.-H.; Wei, S.-G.; Weiss, R.M.; Felder, R.B. Peroxisome proliferator-activated receptor-γ regulates inflammation and renin-angiotensin system activity in the hypothalamic paraventricular nucleus and ameliorates peripheral manifestations of heart failure. Hypertension 2012, 59, 477–484. [Google Scholar] [CrossRef]
- Zhang, H.; Bramham, C.R. Bidirectional Dysregulation of AMPA Receptor-Mediated Synaptic Transmission and Plasticity in Brain Disorders. Front. Synaptic Neurosci. 2020, 12, 26. [Google Scholar] [CrossRef]
- Zhang, Y.; Chu, J.-M.; Wong, G.-T. Cerebral Glutamate Regulation and Receptor Changes in Perioperative Neuroinflammation and Cognitive Dysfunction. Biomolecules 2022, 12, 597. [Google Scholar] [CrossRef] [PubMed]
- Bliss, R.M.; Finckbone, V.L.; Trice, J.; Strahlendorf, H.; Strahlendorf, J. Tumor necrosis factor-α (TNF-α) augments AMPA-induced Purkinje neuron toxicity. Brain Res. 2011, 1386, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Fioranelli, M.; Roccia, M.G.; Flavin, D.; Cota, L. Regulation of Inflammatory Reaction in Health and Disease. Int. J. Mol. Sci. 2021, 22, 5277. [Google Scholar] [CrossRef] [PubMed]
- Galic, M.A.; Riazi, K.; Pittman, Q.J. Cytokines and brain excitability. Front. Neuroendocr. 2012, 33, 116–125. [Google Scholar] [CrossRef] [PubMed]
- Schaible, H.-G. Nociceptive neurons detect cytokines in arthritis. Arthritis Res. Ther. 2014, 16, 470. [Google Scholar] [CrossRef] [PubMed]
- Rubio-Perez, J.M.; Morillas-Ruiz, J.M. A review: Inflammatory process in Alzheimer’s disease, role of cytokines. Sci. World J. 2012, 2012, 756357. [Google Scholar] [CrossRef] [PubMed]
- Holm, L.J.; Mønsted, M.; Haupt-Jorgensen, M.; Buschard, K. PPARs and the Development of Type 1 Diabetes. PPAR Res. 2020, 2020, 6198628. [Google Scholar] [CrossRef] [PubMed]
- Henn, R.E.; Elzinga, S.E.; Glass, E.; Parent, R.; Guo, K.; Allouch, A.M.; Mendelson, F.E.; Hayes, J.; Webber-Davis, I.; Murphy, G.G.; et al. Obesity-induced neuroinflammation and cognitive impairment in young adult versus middle-aged mice. Immun. Ageing 2022, 19, 67. [Google Scholar] [CrossRef]
- Skaper, S.D. Neurotrophic Factors: An Overview. Methods Mol. Biol. 2018, 1727, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Begni, V.; Riva, M.A.; Cattaneo, A. Cellular and molecular mechanisms of the brain-derived neurotrophic factor in physiological and pathological conditions. Clin. Sci. 2017, 131, 123–138. [Google Scholar] [CrossRef] [PubMed]
- Pandit, M.; Behl, T.; Sachdeva, M.; Arora, S. Role of brain derived neurotropic factor in obesity. Obes. Med. 2020, 17, 100189. [Google Scholar] [CrossRef]
- Nakagawa, T.; Ogawa, Y.; Ebihara, K.; Yamanaka, M.; Tsuchida, A.; Taiji, M.; Noguchi, H.; Nakao, K. Antiobesity and antidiabetic effects of brain-derived neurotrophic factor in rodent models of leptin resistance. Int. J. Obes. 2003, 27, 557–565. [Google Scholar] [CrossRef] [PubMed]
- Üçeyler, N.; Riediger, N.; Kafke, W.; Sommer, C. Differential gene expression of cytokines and neurotrophic factors in nerve and skin of patients with peripheral neuropathies. J. Neurol. 2015, 262, 203–212. [Google Scholar] [CrossRef]
- Hashimoto, K. Brain-derived neurotrophic factor as a biomarker for mood disorders: An historical overview and future directions. Psychiatry Clin. Neurosci. 2010, 64, 341–357. [Google Scholar] [CrossRef]
- Vinnars, M.-T.; Bixo, M.; Damdimopoulou, P. Pregnancy-related maternal physiological adaptations and fetal chemical exposure. Mol. Cell. Endocrinol. 2023, 578, 112064. [Google Scholar] [CrossRef]
Gene of Interest | Forward Sequence | Reverse Sequence | References |
---|---|---|---|
PPARγ | CGGTTTCAGAAGTGCCTTG | GGTTCAGCTGGTCGATATCAC | [28] |
LepRb | AATGCGAATGTCATGTAGCAG | ACTCCAGTCACTCCAGACTCC | [29] |
MC4R | GGAAGATGAACTCCACCCACC | AATGGGTCGGAAACCATCGTC | [30] |
AMPK | CATGGCTGAGAAGCAGAAGCAC | CTTAACTGCCACTTTATGGCCG | [31] |
POMC | TTCCAGTATGACTCCACTCACG | AGACTCCACGACATACTCAGCA | [32] |
SLC2A1 | CCAGCTGGGAATCGTCGTT | CAAGTCTGCATTGCCCATGAT | [33] |
Gene of Interest | Forward Sequence | Reverse Sequence | Reference |
---|---|---|---|
GAPDH | GTGGCAAAGTGGAGATTGTTG | CGTTGAATTTGCCGTGAGTG | [27] |
TNF-α | CTACCTTGTTGCCTCCTCTTT | GAGCAGAGGTTCAGTGATGTAG | |
IL-6 | GTCTGTAGCTCATTCTGCTCTG | GAAGGCAACTGGATGGAAGT | |
IL-1B | GGTGTGTGACGTTCCCATTA | ATTGAGGTGGAGAGCTTTCAG | |
CRP | GCCTTTCACTTCTCTGCTTTG | GAGTCCTAGTGGGATGCTTATG | |
Ntf3 | CCTGGAAATAGTCACACGGATG | CTTGGATGCCACGGAGATAAG | |
NGF | CAGTGAGGTGCATAGCGTAAT | CTCCTTCTGGGACATTGCTATC | |
BDNF | CTGAGCGTGTGTGACAGTATTA | CTTTGGATACCGGGACTTTCTC |
Genes of Interest in the Hypothalamus of Offspring | Gene Expression (Upregulated or Downregulated) | |
---|---|---|
PG/VG | PG/VG + Nic | |
PPARγ | N/A | Upregulated |
LepRb | Upregulated | Upregulated |
MC4R | Upregulated | Upregulated |
AMPK | N/A | Upregulated |
POMC | N/A | Upregulated |
SLC2A1 | Upregulated | Upregulated |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Awada, C.; Saporito, A.F.; Zelikoff, J.T.; Klein, C.B. E-Cigarette Exposure Alters Neuroinflammation Gene and Protein Expression in a Murine Model: Insights from Perinatally Exposed Offspring and Post-Birth Mothers. Genes 2024, 15, 322. https://doi.org/10.3390/genes15030322
Awada C, Saporito AF, Zelikoff JT, Klein CB. E-Cigarette Exposure Alters Neuroinflammation Gene and Protein Expression in a Murine Model: Insights from Perinatally Exposed Offspring and Post-Birth Mothers. Genes. 2024; 15(3):322. https://doi.org/10.3390/genes15030322
Chicago/Turabian StyleAwada, Christina, Antonio F. Saporito, Judith T. Zelikoff, and Catherine B. Klein. 2024. "E-Cigarette Exposure Alters Neuroinflammation Gene and Protein Expression in a Murine Model: Insights from Perinatally Exposed Offspring and Post-Birth Mothers" Genes 15, no. 3: 322. https://doi.org/10.3390/genes15030322