Next Article in Journal
Expression Patterns of TGF-β1, TβR-I, TβR-II, and Smad2 Reveal Insights into Heterosis for Growth of Hybrid Offspring between Acanthopagrus schlegelii and Pagrus major
Previous Article in Journal
A Review of Experimental Studies on Natural Chalcone-Based Therapeutic Targeting of Genes and Signaling Pathways in Type 2 Diabetes Complications
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 15
Issue 7
10.3390/genes15070944
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

MicroRNA166: Old Players and New Insights into Crop Agronomic Traits Improvement

by
Zhanhui Zhang
1,*,
Tianxiao Yang
2,
Na Li
1,
Guiliang Tang
3 and
Jihua Tang
4,*
1
National Key Laboratory of Wheat and Maize Crop Science/Collaborative Innovation Center of Henan Grain Crops/College of Agronomy, Henan Agricultural University, Zhengzhou 450002, China
2
Plant Molecular and Cellular Biology Program, University of Florida, Gainesville, FL 32611, USA
3
Department of Biological Sciences, Michigan Technological University, Houghton, MI 49931, USA
4
The Shennong Laboratory, Zhengzhou 450002, China
*
Authors to whom correspondence should be addressed.
Genes 2024, 15(7), 944; https://doi.org/10.3390/genes15070944
Submission received: 21 June 2024 / Revised: 14 July 2024 / Accepted: 17 July 2024 / Published: 18 July 2024
(This article belongs to the Special Issue Plant Small RNAs: Biogenesis and Functions)
Browse Figures
Review Reports Versions Notes

Abstract

:
MicroRNA (miRNA), a type of non-coding RNA, is crucial for controlling gene expression. Among the various miRNA families, miR166 stands out as a highly conserved group found in both model and crop plants. It plays a key role in regulating a wide range of developmental and environmental responses. In this review, we explore the diverse sequences of MIR166s in major crops and discuss the important regulatory functions of miR166 in plant growth and stress responses. Additionally, we summarize how miR166 interacts with other miRNAs and highlight the potential for enhancing agronomic traits by manipulating the expression of miR166 and its targeted HD-ZIP III genes.

1. Introduction

Due to the ongoing impact of climate change, crop production is facing significant challenges from extreme temperatures, drought, and flooding [1,2]. It is crucial to optimize agronomic traits and develop more resistant varieties. Therefore, exploring novel regulatory players and their biological functions is required for crop enhancement [3,4,5]. Despite engineering protein-encoding genes, manipulating miRNAs and their targets also provides a promising method for crop improvement. miRNAs are small, single-stranded, non-coding RNA molecules that play a critical role in post-transcriptional gene regulation in plants. MIRNA genes are transcribed and cleaved into a miRNA duplex by Dicer-like 1 (DCL1) and other D-body-related proteins. miRNA duplexes are then recruited by the Argonaute1 (AGO1) protein and incorporated into RNA-induced silencing complexes (RISCs) [6]. The miRNA-RISCs negatively regulate target gene expression via mRNA cleavage within the miRNA complementary site [7,8] or by translation inhibition [9,10]. miRNAs are essential for controlling a wide range of developmental and environmental processes by targeting specific transcription factors at the post-transcriptional level [11]. Here, we focus on miR166, a miRNA known to modulate complex agronomic traits and responses to abiotic stress in major crop species [12,13]. In this study, we discuss the sequence diversity of MIR166 in different plant species and highlight the regulatory role of miR166 in both model and crop plants, as well as its interactions with other miRNAs. Moreover, we highlight the agronomic trait improvement by manipulating the expression of miR166 and its targets, Class III HD-ZIP transcription factor genes (HD-ZIP IIIs).

2. Conservation and Diversification of MIR165/166 in Model Plants and Main Crops

The miR165/166 family is both highly conserved and abundant in land plants [14,15]. miR166 genes have been identified in land plants, while miR165 genes have only been identified in the Brassicaceae family [16,17,18]. To explore the sequence diversity of miR165/166 in land plants, mature miRNA sequences from six dicots and four monocots were obtained and aligned manually using Clustal omega software (Release 22.1) [18]. Among the dicots, Arabidopsis (Arabidopsis thaliana), rapeseed (Brassica napus), soybean (Glycine max), cotton (Gossypium hirsutum), alfalfa (Medicago truncatula), and tomato (Solanum lycopersicum) contain 9, 6, 21, 2, 7, and 3 miR165/166 members, respectively (Figure 1). In the monocots, stiff brome (Brachypodium distachyon), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays) have 10, 14, 13, 11, and 14 miR166s, respectively (Figure 1). Mature miR165/166 sequences are highly conserved, reflecting their similar functions within these species (Table 1). The Arabidopsis genome has two miR165s (miR165a and miR165b) and seven miR166s (miR166a-miR166g). miR165 and miR166 have almost identical nucleotide sequences except for a C-U substitution at the 17th base, which has been confirmed with their distinct action mechanisms [14]. Similarly, there are minimal nucleotide variations in members of the miR165/166 family from rapeseed, soybean, cotton, alfalfa, and tomato. Monocots exhibit a larger number of members and diverse nucleotides in the miR166 family as compared to dicots. Notably, the maize miR166 family displays 4 different nucleotides, while miR166g in stiff brome shares only 11 conserved nucleotides with other family members. Overall, monocots likely have more target genes regulated by the miR165/166 family than dicots.
To analyze the evolution of MIR165/166s, a phylogenic tree was constructed using the hairpin sequences of miR165/166 from various species, including Arabidopsis, rapeseed, soybean, cotton, alfalfa, tomato, stiff brome, rice, sorghum, and maize (miRbase release 22.1) [19]. A total of 96 MIR165/166s were obtained and further classified into 7 clades, with 2 dicot-specific clades (consisting of 19 and 14 MIR165/166s, respectively), 2 monocot-specific clades (including 7 and 10 MIR166s, respectively), and 3 mixed clades (11, 23, and 12 MIR166s, respectively). All MIR165/166s in Arabidopsis, rapeseed, and soybean can be grouped to dicot- specific clades, and most MIR166s are not specific to monocot species. MIR166s in each monocot species were grouped into five clades (two monocot-specific clades and three mixed clades), indicating a greater diversity of MIR166s in monocots as compared to dicots.
In eukaryotes, MIRs primarily originate from inverted duplications, random hairpin sequences, and small transposable elements [7,20,21]. Tandem and segmental duplications in plant genomes contribute to the diversification of MIRs [22]. Several miRNA clusters have been found in plants. For instance, miR166s can be transcribed from a single polycistronic transcript [23]. In the six dicots and four monocots mentioned above, polycistronic MIRs exist in rapeseed, soybean, cotton, alfalfa, rice, maize, stiff brome, and sorghum (Table 2), and represented by bna-MIR166b-c, gma-MIR166e-q, osa-MIR166i-j, osa-MIR166h-k, zma-MIR166k-m, bdi-MIR166h-j, and sbi-MIR166f-g. Additionally, bna-MIR166a-e have two copies in the soybean genome.

3. Functions of miR166 in Crop Development and Stress Response

3.1. miR166 as a Determinant in Plant Morphogenesis

In land plants, miR165/166 is a crucial regulator in leaf polarity establishment, shoot meristem formation, and ovule and floral development (Figure 2) [18,24,25,26,27,28,29,30,31,32,33]. In Arabidopsis, mutants involving miR165/166 and its targets exhibit aberrant leaf polarity [34,35]. Specifically, miR165a, miR166a, and miR166b are expressed on the abaxial surface, while PHABULOSA (PHB) and REVOLUTA (PHV) are expressed on the adaxial surface, contributing to the establishment and maintenance of leaf polarity. The role of miR165/166 in leaf polarity regulation has been demonstrated in other dicot crops, such as cotton, tomato, and tobacco [12,27,36,37]. In monocot crops like rice, maize, and wheat, miR166 performs similar functions [13,38,39,40,41]. The knockdown of rice miR166 mediates leaf rolling by releasing its targeted homeodomain containing protein4 (OsHB4) mRNA [38]. In maize, the miR166-rolled leaf 1/2 (Rld1/2) regulatory module interacts with the miR390-leafbladeless1 (lbl1) regulatory module to define the expression of ta-siRNA, establishing concentration gradients and maintaining leaf polarity [42,43,44]. In wheat, the loss control of HB2 from miR165/166 also mediates rolled leaf [41].
The shoot apical meristem is responsible for generating aboveground aerial organs throughout the lifespan of higher plants, involving complex molecular mechanisms [45,46]. miR165/166 has been shown to modulate shoot apical meristem formations [30,47,48,49]. In Arabidopsis, AGO10 competes with AGO1 to bind miR165/166, which is essential for shoot apical meristem development and maintenance [30,50]. Sequestration miR165/166 by AGO10 has also been shown to fine-tune the axillary meristem initiation [49]. In rice, several HD-ZIP III genes regulate leaf initiation via an auxin-dependent manner [43]. The miR166-HD-ZIP III module controls maize inflorescence development and defines tassel architecture through interacting with ZmAGO18b [13,51]. In both model plants and major crops, the regulation of the shoot apical and axillary meristem development by miR166 subsequently affects flowering time, plant height, and fruit size [11,12,13,38,41]. For instance, the overexpression of RDD1, a target gene of rice miR166 in vascular tissue, enhances nutrient absorption, transportation, assimilation, and photosynthesis, thus resulting in higher grain yield [52,53].
In addition to the impacts on leaf polarity establishment and shoot meristem formation, miR166 has also been found to regulate plant reproductive development in several plant species. In Arabidopsis, miR165/166 is highly expressed in ovule primordia, which restricts the PHB expression and promotes integument formation, thereby influencing ovule morphogenesis [18]. In tomato, miR166 has been indicated to regulate ovule and flower morphogenesis, as well as pollen viability under adverse temperatures [27,54]. In rice, the anther adaxial/abaxial polarity is fine-tuned by the miR166-SPOROCYTELESS/NOZZLE (SPL) module so as to build the internal boundary and establish the internal structure for the anthers [55]. Point mutations in the binding site between miR166 and the HB2 gene cause abnormal spikes in wheat [41].

3.2. miR166 Regulates Root and Vascular Development

Roots, the underground organs of plants, provide essential functions such as water and nutrient uptake, as well as anchorage for plant survival. Root development is intricately regulated by transcription factors, miRNAs, phytohormones, and environmental cues [56,57]. An increasing number of studies have shed light on the roles of miR166 in root development (Figure 3A–C). In Arabidopsis, MIR165a and MIR166b are activated by transcription factors SHORT ROOT (SHR) and SCARECROW (SCR) [58]. miR165a, miR166a, and miR166b are specifically expressed in the endodermal layer, and their movements from the inner to the outer regions are crucial for vascular patterning and root architecture [58,59]. The opposing activity between miR165/166 and the HD-ZIP III genes coordinates root growth and development [60]. The knockdown of miR166 and the overexpression of HD-ZIP III gene HB15 lead to inhibition of vascular development and secondary cell wall formation, whereas the HB15 mutant displayed the opposite phenotype in response to high temperature [61]. In Medicago, the overexpression of miR166 leads to the reduced formation of bundles, which leads to a reduction in the symbiotic nodules and lateral roots [62]. Despite the significant differences in root systems between monocots and dicots, miR166 also influences maize root development. In maize, the interactions of miR166-Rld1/2 and miR390-lbl1 are involved in root development in an auxin-dependent manner [63]. Maize mutants with the inactivation of miR166 also exhibit decreased formation of lateral roots [13].
In addition to its role in regulating root vascular patterning, miR166 also plays a crucial role in stem vascular development (Figure 3D–E). The overexpression of Arabidopsis miR165/166 leads to defects in vascular tissues and interfascicular fibers [64]. In rice, miR166 is involved in xylem development, as evidenced by the aberrant vascular anatomy observed in miR166 knockdown mutants [12,38]. Furthermore, the OsmiR166b-OsHox32 module regulates the expression of cell-wall-related genes, influencing the mechanical strength of the plants [65]. Similarly, a maize miR166 knockdown mutant shows abnormalities in stem vascular patterning [13].

3.3. The Regulatory Role of miR165/166 in Phytohormones Signaling

Phytohormones are signaling molecules that are involved in many developmental and environmental processes [31]. miRNAs, including miR166, serve as crucial regulators in phytohormone response pathways (Figure 4) [66]. In Arabidopsis, the spatiotemporal expression of miR165/166 is fine-tuned by phytohormone crosstalk [31]. Six phytohormones, including indole-3-acetic acid (IAA), gibberellic acid (GA), cytokinin (CK), abscisic acid (ABA), jasmonic acid (JA), and salicylic acid (SA) have been suggested to modulate the expression of miR165/166s, implicating their involvement in phytohormone responses. miR165/166-HD-ZIP IIIs modules play critical roles in Arabidopsis ABA homeostasis through regulating BG1 expression [28]. In maize, the inactivation of miR166 mediates increased ABA levels and decreased IAA levels [13]. However, the ABA contents in rice miR166 knockdown mutants by short tandem target-mimic (STTM) technology are nearly unaffected [38], indicating potential differences in the miR165/166-dependent ABA regulatory pathways between maize and rice. In soybean, miR166 is essential for plant height modulation by regulating the GA level [67]. In Arabidopsis, a miR165/166 target gene, PHABULOSA (PHB) has been identified to activate the expression of the cytokinin biosynthesis gene [59].

3.4. miR166 in Response to Abiotic Stress and Pathogenic Infection

Plants are usually exposed to abiotic and biotic stresses that inhibit their growth and development. The post-transcriptional regulation mediated by miRNAs play critical roles in responding to abiotic and biotic stresses [3,4,68,69]. An increasing number of studies have highlighted the involvement of miR166 in various abiotic and biotic stress responses (Figure 5). In Arabidopsis, the downregulation of miR165/166 leads to the upregulation of its target gene PHABULOSA (PHB), potentially enhancing drought and cold resistance through ABA homeostasis [28], but making it sensitive to heat stress [70]. The high temperature mediates the reduced expression of MIR166 and the elevated expression of the HD-ZIP III gene HB-15 [61]. In maize, STTM166, the miR166 inactivation mutant, exhibits improved tolerance to drought, salinity, and high temperatures [13]. Similarly, the knockdown of rice miR166 results in enhanced drought resistance, characterized by rolled leaves and altered stem xylem architecture [38]. The miR166-HD-ZIP III gene module has been proven to be a crucial regulator in alfalfa (Medicago sativa L.) and tea plant (Camellia sinensis) [71,72]. Therefore, the lower expression of miR165/166 is crucial for resistance to abiotic stresses, although the underlying mechanisms may vary among plant species. In contrast, miR166 has distinct effects on pathogen infection and heavy metal stress. In rice, miR166k-166h enhances immunity by the post-transcriptional regulation of ethylene-insensitive 2 (EIN2) [73]. The overexpression of miR166 or knockout of OsHB4 leads to enhanced cadmium tolerance [15]. In tomato, the overexpression of miR166 enhances late blight resistance [74]. A recent study indicated that the sly-miR166-SlyHB module is a susceptibility factor to Tomato leaf curl New Delhi virus (ToLCNDV) [75]. The overexpression of sly-miR166 or the gene silencing of SlyHB enhances the resistance to ToLCNDV.
Moreover, extensive small RNA profiling studies have revealed the involvement of miR165/166 in various stress responses, including drought resistance in tomato [76]; cold tolerance in Brassica napus [77]; heat stress responses in rice, maize, and wheat [78,79,80,81]; chromium tolerance in rice [82]; and virus infection in tobacco [83].

3.5. Other Functions of miR166 in Crops

Small RNA sequencing studies have revealed that miR166 may play roles in phloem fiber development in flax [84]; seed development in barley, narrow-leafed lupin, and maize [85,86,87]; seed germination in barley and maize [85,88]; seed dormancy in barley [89]; and heterosis formation in Brassica napus [77]. Collectively, a wealth of literature has highlighted the crucial involvement of miR166 in diverse aspects of plant development and stress responses. However, the interactions of miR166 with other miRNAs and its functions in modulating complex agronomic traits remain largely unresolved.

4. The Interactions between miR166 and Other miRNAs in Model and Crop Plants

In the intricate landscape of developmental and environmental processes, miR166 interacts with other miRNAs or components of the miRNA biogenesis pathway to carry out its biological functions (Figure 6). For example, in Arabidopsis, shoot regeneration inhibition and leaf polarity determination are regulated by AGO10-suppressing miR165/166 [30,50,90]. The maintenance of stem cells mediated by miR165/166 is dependent on the repression of AGO1 through miR168 targeting and cleavage [91]. The establishment and maintenance of leaf polarity involve the crosstalk between the miR390-AGO7-TAS3 and miR165/166-HD-ZIP IIIs modules in Arabidopsis and maize [92]. The interplay between miR160 and miR165/166 fine-tunes the expression of ABA and IAA-related genes, impacting leaf development, drought tolerance, and somatic embryogenesis induction in Arabidopsis [93,94]. In salt-stressed potato, the opposing activities of miR166 and miR159 establish an asymmetric expression pattern for basal growth [95]. In Arabidopsis, the miR166-HD-ZIP IIIs module is essential for silencing seed dormancy and maturation genes during the vegetative phase, potentially interacting with the miR156-SPLs module [96]. Furthermore, miR172 and miR165/166, potentially connected through the WUS transcription factor, participate in modulating the temporal program of floral stem cells in Arabidopsis [97]. These studies collectively highlight the intricate regulatory networks in which miR165/166 is embedded.

5. Exploring the miR166-HD-ZIP IIIs Module to Improve Complex Agronomic Traits

In crops, the miR166-HD-ZIP IIIs module has been demonstrated to regulate various crucial processes such as plant mechanical strength, lateral meristem formation, nodulation, nutrition uptake, abiotic stress tolerance, and pathogenic immunity [12,13,15,38,48,52,53,62,65,73,74]. Hence, the miR166-HD-ZIP IIIs module holds great potential as a versatile toolbox for improving agronomic traits in crops. Given that miR166 has multiple family members and target genes with distinct temporal–spatial expression patterns, it becomes essential to finely regulate the expression of specific MIR166 or HD-ZIPIII genes responsible for specific agronomic traits. For instance, editing the promoter sequence of OsHox32 can lead to the downregulation of target genes, enhancing culm mechanical strength. Similarly, editing the promoter sequence of the polycistronic miRNA gene for OsmiR166k and OsmiR166h can result in the upregulation of miRNAs, thereby boosting rice pathogenic immunity. Interestingly, a recent study revealed that exogenous miRNAs can mediate post-transcription gene silencing in plants, offering an alternative method to modulate the expression of miR166 and its target genes [98]. For instance, feeding double-strand artificial miRNA (ds-amiRNA) for MIR166s enhances the abiotic stress tolerance; likewise, feeding ds-miR166 improves pathogenic immunity. Furthermore, studies have revealed that plant primary miRNAs (pri-miRNAs) encode regulatory peptides, termed miRNA-encoded peptides (miPEPs), which can specifically increase the expression of their corresponding miRNAs [99,100]. The exogenous application of miPEPs specifically increases their cognate miRNA expressions. Consequently, peptides like miPEP172c and miPEP171d have been utilized for improving agronomic traits in soybean and grapevine [101,102]. In Arabidopsis, pri-miR165a, pri-miR166a, and pri-miR166g encode miPEPs that are used to enhance the expression of miR166a and miR166g [100]. Similarly, certain pri-miR166 in major crops may encode miPEPs that could be beneficial for crop enhancement through external application.
However, it is crucial to note that gene editing and miRNA decoy strategies often result in mutations with severe phenotypic consequences, such as dwarf stature, seed abortion, or even plant lethality, making them unsuitable for crop breeding. [12,103,104]. For example, the knockdown of miR166 in Arabidopsis, rice, and maize yields positive effects on abiotic stress tolerance but also causes negative effects on developmental transition, fruit size, male fertility, and plant height [11,13,38]. In crop breeding, breeders typically opt to screen for ideal genotypes or haplotypes of MIR166s and their target genes and further optimize agronomic traits through marker-assisted selection (MAS). The interactions of miR166 with other miRNAs or genes, e.g., miR160, provides an alternative way to mitigate the negative effects by genetic crossing [93,94].

6. Concluding Remarks

miR166 is a well-conserved miRNA family in both dicots and monocots. Given the diverse functions of miR166 and its target genes in model plants and main crops, it is promising to exploit the miR166-HD-ZIP IIIs module for agronomic traits improvements. However, several hurdles should be considered. First, our knowledge of the miR166-HD-ZIP IIIs module is limited, particularly in crops. It is necessary to explore their diversified functions in crops. Second, the temporal–spatial expressions, the developmental–environmental responses, and the miR166 and HD-ZIP IIIs interactions are far from uncovered. The RNA profiling allows us to analyze the expression of miR166 and HD-ZIP IIIs at different cellular/tissular levels, developmental stages, and environmental stimulus. Third, the interplay of miR166-HD-ZIP IIIs with other miRNAs and miRNA biogenesis pathway components is still largely unknown. miRNA decay technologies and miRNA inducible CRISPR systems are optimal tools for us to investigate the interactive roles of miR166 [105,106].

Author Contributions

G.T., Z.Z. and J.T. conceived the project. Z.Z., N.L. and T.Y. wrote the manuscript. Z.Z., J.T. and T.Y. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (NO.32171985, 31571679).

Acknowledgments

We extend our appreciation to the anonymous reviewers for their valuable suggestions to help improve this article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ray, D.K.; Gerber, J.S.; MacDonald, G.K.; West, P.C. Climate variation explains a third of global crop yield variability. Nat. Commun. 2015, 6, 5989. [Google Scholar] [CrossRef]
  2. Lesk, C.; Rowhani, P.; Ramankutty, N. Influence of extreme weather disasters on global crop production. Nature 2016, 529, 84–87. [Google Scholar] [CrossRef]
  3. Song, X.; Li, Y.; Cao, X.; Qi, Y. MicroRNAs and their regulatory roles in plant-environment interactions. Annu. Rev. Plant Biol. 2019, 70, 489–525. [Google Scholar] [CrossRef]
  4. Tang, J.; Chu, C. MicroRNAs in crop improvement: Fine-tuners for complex traits. Nature Plants 2017, 3, 17077. [Google Scholar] [CrossRef]
  5. Zhang, Z.; Teotia, S.; Tang, J.; Tang, G. Perspectives on microRNAs and phased small interfering RNAs in maize (Zea mays L.): Functions and big Impact on agronomic traits enhancement. Plants 2019, 8, 170. [Google Scholar] [CrossRef] [PubMed]
  6. Chen, X. Small RNAs in development—Insights from plants. Curr. Opin. Genet. Dev. 2012, 22, 361–367. [Google Scholar] [CrossRef] [PubMed]
  7. Voinnet, O. Origin, Biogenesis, and Activity of Plant MicroRNAs. Cell 2009, 136, 669–687. [Google Scholar] [CrossRef]
  8. Zhang, Y.; Tang, C.; Yu, T.; Zhang, R.; Zheng, H.; Yan, W. MicroRNAs control mRNA fate by compartmentalization based on 3′ UTR length in male germ cells. Genome Biol. 2017, 18, 105. [Google Scholar] [CrossRef] [PubMed]
  9. Chen, X. A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 2004, 303, 2022–2025. [Google Scholar] [CrossRef]
  10. Gandikota, M.; Birkenbihl, R.P.; Höhmann, S.; Cardon, G.H.; Saedler, H.; Huijser, P. The miRNA156/157 recognition element in the 3′ UTR of the Arabidopsis SBP box gene SPL3 prevents early flowering by translational inhibition in seedlings. Plant J. Cell Mol. Biol. 2007, 49, 683–693. [Google Scholar] [CrossRef]
  11. Yan, J.; Gu, Y.; Jia, X.; Kang, W.; Pan, S.; Tang, X.; Chen, X.; Tang, G. Effective small RNA destruction by the expression of a short tandem target mimic in Arabidopsis. Plant Cell 2012, 24, 415–427. [Google Scholar] [CrossRef]
  12. Peng, T.; Qiao, M.; Liu, H.; Teotia, S.; Zhang, Z.; Zhao, Y.; Wang, B.; Zhao, D.; Shi, L.; Zhang, C.; et al. A resource for inactivation of microRNAs using short tandem target mimic technology in model and crop plants. Mol. Plant 2018, 11, 1400–1417. [Google Scholar] [CrossRef]
  13. Li, N.; Yang, T.; Guo, Z.; Wang, Q.; Chai, M.; Wu, M.; Li, X.; Li, W.; Li, G.; Tang, J.; et al. Maize microRNA166 Inactivation Confers Plant Development and Abiotic Stress Resistance. Int. J. Mol. Sci. 2020, 21, 9506. [Google Scholar] [CrossRef]
  14. Sakaguchi, J.; Watanabe, Y. miR165/166 and the development of land plants. Dev. Growth Differ. 2012, 54, 93–99. [Google Scholar] [CrossRef] [PubMed]
  15. Ding, Y.; Gong, S.; Wang, Y.; Wang, F.; Bao, H.; Sun, J.; Cai, C.; Yi, K.; Chen, Z.; Zhu, C. MicroRNA166 modulates Cadmium tolerance and accumulation in rice. Plant Physiol. 2018, 177, 1691–1703. [Google Scholar] [CrossRef]
  16. Maher, C.G.; Stein, L.; Ware, D. Evolution of Arabidopsis microRNA families through duplication events. Genome Res. 2006, 16, 510–519. [Google Scholar] [CrossRef] [PubMed]
  17. Taylor, R.S.; Tarver, J.E.; Hiscock, S.J.; Donoghue, P.C.J. Evolutionary history of plant microRNAs. Trends Plant Sci. 2014, 19, 175–182. [Google Scholar] [CrossRef]
  18. Hashimoto, K.; Miyashima, S.; Sato-Nara, K.; Yamada, T.; Nakajima, K. Functionally diversified members of the MIR165/6 gene family regulate ovule morphogenesis in Arabidopsis thaliana. Plant Cell Physiol. 2018, 59, 1017–1026. [Google Scholar] [CrossRef] [PubMed]
  19. Kozomara, A.; Birgaoanu, M.; Griffiths-Jones, S. miRBase: From microRNA sequences to function. Nucleic Acids Res. 2018, 47, D155–D162. [Google Scholar] [CrossRef]
  20. Cui, J.; You, C.; Chen, X. The evolution of microRNAs in plants. Curr. Opin. Plant Biol. 2017, 35, 61–67. [Google Scholar] [CrossRef]
  21. Bartel, D.P. Metazoan MicroRNAs. Cell 2018, 173, 20–51. [Google Scholar] [CrossRef]
  22. Baldrich, P.; Hsing, Y.-I.C.; San Segundo, B. Genome-Wide Analysis of Polycistronic MicroRNAs in Cultivated and Wild Rice. Genome Biol. Evol. 2016, 8, 1104–1114. [Google Scholar] [CrossRef] [PubMed]
  23. Barik, S.; SarkarDas, S.; Singh, A.; Gautam, V.; Kumar, P.; Majee, M.; Sarkar, A.K. Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species. Genomics 2014, 103, 114–121. [Google Scholar] [CrossRef] [PubMed]
  24. Todesco, M.; Rubiosomoza, I.; Pazares, J.; Weigel, D. A collection of target mimics for comprehensive analysis of microRNA function in Arabidopsis thaliana. PLoS Genet. 2010, 6, e1001031. [Google Scholar] [CrossRef] [PubMed]
  25. Zhou, Y.; Honda, M.; Zhu, H.; Zhang, Z.; Guo, X.; Li, T.; Li, Z.; Peng, X.; Nakajima, K.; Duan, L. Spatiotemporal sequestration of miR165/166 by Arabidopsis Argonaute10 promotes shoot apical meristem maintenance. Cell Rep. 2015, 10, 1819–1827. [Google Scholar] [CrossRef] [PubMed]
  26. Merelo, P.; Ram, H.; Caggiano, M.P.; Ohno, C.; Ott, F.; Straub, D.; Graeff, M.; Cho, S.K.; Yang, S.W.; Wenkel, S.; et al. Regulation of MIR165/166 by class II and class III homeodomain leucine zipper proteins establishes leaf polarity. Proc. Natl. Acad. Sci. USA 2016, 113, 11973–11978. [Google Scholar] [CrossRef]
  27. Jia, X.; Ding, N.; Fan, W.; Yan, J.; Gu, Y.; Tang, X.; Li, R.; Tang, G. Functional plasticity of miR165/166 in plant development revealed by small tandem target mimic. Plant Sci. Int. J. Exp. Plant Biol. 2015, 233, 11–21. [Google Scholar] [CrossRef] [PubMed]
  28. Yan, J.; Zhao, C.; Zhou, J.; Yang, Y.; Wang, P.; Zhu, X.; Tang, G.; Bressan, R.A.; Zhu, J.K. The miR165/166 mediated regulatory module plays critical roles in ABA homeostasis and response in Arabidopsis thaliana. PLoS Genet. 2016, 12, e1006416. [Google Scholar] [CrossRef]
  29. Kidner, C.A.; Martienssen, R.A. Spatially restricted microRNA directs leaf polarity through ARGONAUTE1. Nature 2004, 428, 81–84. [Google Scholar] [CrossRef]
  30. Zhu, H.; Hu, F.; Wang, R.; Zhou, X.; Sze, S.H.; Liou, L.W.; Barefoot, A.; Dickman, M.; Zhang, X. Arabidopsis Argonaute10 specifically sequesters miR166/165 to regulate shoot apical meristem development. Cell 2011, 145, 242–256. [Google Scholar] [CrossRef]
  31. Singh, A.; Roy, S.; Singh, S.; Das, S.S.; Gautam, V.; Yadav, S.; Kumar, A.; Singh, A.; Samantha, S.; Sarkar, A.K. Phytohormonal crosstalk modulates the expression of miR166/165s, target Class III HD-ZIPs, and KANADI genes during root growth in Arabidopsis thaliana. Sci. Rep. 2017, 7, 3408. [Google Scholar] [CrossRef]
  32. Donner, T.J.; Sherr, I.; Scarpella, E. Regulation of preprocambial cell state acquisition by auxin signaling in Arabidopsis leaves. Development 2009, 136, 3235–3246. [Google Scholar] [CrossRef] [PubMed]
  33. Kim, J.; Jung, J.H.; Reyes, J.L.; Kim, Y.S.; Kim, S.Y.; Chung, K.S.; Kim, J.A.; Lee, M.; Lee, Y.; Narry Kim, V.; et al. microRNA-directed cleavage of ATHB15 mRNA regulates vascular development in Arabidopsis inflorescence stems. Plant J. Cell Mol. Biol. 2005, 42, 84–94. [Google Scholar] [CrossRef]
  34. Tatematsu, K.; Toyokura, K.; Miyashima, S.; Nakajima, K.; Okada, K. A molecular mechanism that confines the activity pattern of miR165 in Arabidopsis leaf primordia. Plant J. Cell Mol. Biol. 2015, 82, 596–608. [Google Scholar] [CrossRef] [PubMed]
  35. Yao, X.; Wang, H.; Li, H.; Yuan, Z.; Li, F.; Yang, L.; Huang, H. Two types of cis-acting elements control the abaxial epidermis-specific transcription of the MIR165a and MIR166a genes. FEBS Lett. 2009, 583, 3711–3717. [Google Scholar] [CrossRef]
  36. Gu, Z.; Huang, C.; Li, F.; Zhou, X. A versatile system for functional analysis of genes and microRNAs in cotton. Plant Biotechnol. J. 2014, 12, 638–649. [Google Scholar] [CrossRef] [PubMed]
  37. Sha, A.; Zhao, J.; Yin, K.; Tang, Y.; Wang, Y.; Wei, X.; Hong, Y.; Liu, Y. Virus-based microRNA silencing in plants. Plant Physiol. 2014, 164, 36–47. [Google Scholar] [CrossRef] [PubMed]
  38. Zhang, J.; Zhang, H.; Srivastava, A.K.; Pan, Y.; Bai, J.; Fang, J.; Shi, H.; Zhu, J.K. Knockdown of rice microRNA166 confers drought resistance by causing leaf rolling and altering stem xylem development. Plant Physiol. 2018, 176, 2082–2094. [Google Scholar] [CrossRef]
  39. Juarez, M.T.; Kui, J.S.; Thomas, J.; Heller, B.A.; Timmermans, M.C. microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity. Nature 2004, 428, 84–88. [Google Scholar] [CrossRef]
  40. Juarez, M.T.; Twigg, R.W.; Timmermans, M.C.P. Specification of adaxial cell fate during maize leaf development. Development 2004, 131, 4533–4544. [Google Scholar] [CrossRef]
  41. Jiang, D.; Hua, L.; Zhang, C.; Li, H.; Wang, Z.; Li, J.; Wang, G.; Song, R.; Shen, T.; Li, H.; et al. Mutations in the miRNA165/166 binding site of the HB2 gene result in pleiotropic effects on morphological traits in wheat. Crop J. 2023, 11, 9–20. [Google Scholar] [CrossRef]
  42. Nogueira, F.T.S.; Chitwood, D.H.; Madi, S.; Ohtsu, K.; Schnable, P.S.; Scanlon, M.J.; Timmermans, M.C.P. Regulation of small RNA accumulation in the maize shoot apex. PLoS Genet. 2009, 5, e1000320. [Google Scholar] [CrossRef] [PubMed]
  43. Itoh, J.; Hibara, K.; Sato, Y.; Nagato, Y. Developmental role and auxin responsiveness of Class III homeodomain leucine zipper gene family members in rice. Plant Physiol. 2008, 147, 1960–1975. [Google Scholar] [CrossRef] [PubMed]
  44. Nogueira, F.T.; Madi, S.; Chitwood, D.H.; Juarez, M.T.; Timmermans, M.C. Two small regulatory RNAs establish opposing fates of a developmental axis. Genes Dev. 2007, 21, 750–755. [Google Scholar] [CrossRef] [PubMed]
  45. Eshed Williams, L. Genetics of Shoot Meristem and Shoot Regeneration. Annu. Rev. Genet. 2021, 55, 661–681. [Google Scholar] [CrossRef] [PubMed]
  46. Li, S.; Meng, S.; Weng, J.; Wu, Q. Fine-tuning shoot meristem size to feed the world. Trends Plant Sci. 2022, 27, 355–363. [Google Scholar] [CrossRef]
  47. Grigg, S.P.; Canales, C.; Hay, A.; Tsiantis, M. SERRATE coordinates shoot meristem function and leaf axial patterning in Arabidopsis. Nature 2005, 437, 1022–1026. [Google Scholar] [CrossRef] [PubMed]
  48. Williams, L.; Grigg, S.P.; Xie, M.; Christensen, S.; Fletcher, J.C. Regulation of Arabidopsis shoot apical meristem and lateral organ formation by microRNA miR166g and its AtHD-ZIP target genes. Development 2005, 132, 3657–3668. [Google Scholar] [CrossRef] [PubMed]
  49. Zhang, C.; Fan, L.; Le, B.H.; Ye, P.; Mo, B.; Chen, X. Regulation of ARGONAUTE10 Expression Enables Temporal and Spatial Precision in Axillary Meristem Initiation in Arabidopsis. Dev. Cell 2020, 55, 603–616.e5. [Google Scholar] [CrossRef]
  50. Zhang, Z.; Zhang, X. Argonautes compete for miR165/166 to regulate shoot apical meristem development. Curr. Opin. Plant Biol. 2012, 15, 652–658. [Google Scholar] [CrossRef]
  51. Sun, W.; Xiang, X.; Zhai, L.; Zhang, D.; Cao, Z.; Liu, L.; Zhang, Z. AGO18b negatively regulates determinacy of spikelet meristems on the tassel central spike in maize. J. Integr. Plant Biol. 2018, 60, 65–78. [Google Scholar] [CrossRef]
  52. Iwamoto, M.; Tagiri, A. MicroRNA-targeted transcription factor gene RDD1 promotes nutrient ion uptake and accumulation in rice. Plant J. Cell Mol. Biol. 2016, 85, 466–477. [Google Scholar] [CrossRef]
  53. Iwamoto, M. The transcription factor gene RDD1 promotes carbon and nitrogen transport and photosynthesis in rice. Plant Physiol. Biochem. 2020, 155, 735–742. [Google Scholar] [CrossRef] [PubMed]
  54. Clepet, C.; Devani, R.S.; Boumlik, R.; Hao, Y.; Morin, H.; Marcel, F.; Verdenaud, M.; Mania, B.; Brisou, G.; Citerne, S.; et al. The miR166- SlHB15A Regulatory Module Controls Ovule Development and Parthenocarpic Fruit Set under Adverse Temperatures in Tomato. Mol. Plant 2021, 14, 1185–1198. [Google Scholar] [CrossRef]
  55. Li, X.; Lian, H.; Zhao, Q.; He, Y. MicroRNA166 Monitors SPOROCYTELESS/NOZZLE for Building of the Anther Internal Boundary. Plant Physiol. 2019, 181, 208–220. [Google Scholar] [CrossRef]
  56. Barrera-Rojas, C.H.; Otoni, W.C.; Nogueira, F.T.S. Shaping the root system: The interplay between miRNA regulatory hubs and phytohormones. J. Exp. Bot. 2021, 72, 6822–6835. [Google Scholar] [CrossRef] [PubMed]
  57. Ramachandran, P.; Wang, G.; Augstein, F.; de Vries, J.; Carlsbecker, A. Continuous root xylem formation and vascular acclimation to water deficit involves endodermal ABA signalling via miR165. Development 2018, 145, dev159202. [Google Scholar] [CrossRef] [PubMed]
  58. Carlsbecker, A.; Lee, J.Y.; Roberts, C.J.; Dettmer, J.; Lehesranta, S.; Zhou, J.; Lindgren, O.; Moreno-Risueno, M.A.; Vaten, A.; Thitamadee, S.; et al. Cell signalling by microRNA165/6 directs gene dose-dependent root cell fate. Nature 2010, 465, 316–321. [Google Scholar] [CrossRef] [PubMed]
  59. Miyashima, S.; Koi, S.; Hashimoto, T.; Nakajima, K. Non-cell-autonomous microRNA165 acts in a dose-dependent manner to regulate multiple differentiation status in the Arabidopsis root. Development 2011, 138, 2303–2313. [Google Scholar] [CrossRef]
  60. Singh, A.; Singh, S.; Panigrahi, K.C.; Reski, R.; Sarkar, A.K. Balanced activity of microRNA166/165 and its target transcripts from the class III homeodomain-leucine zipper family regulates root growth in Arabidopsis thaliana. Plant Cell Rep. 2014, 33, 945–953. [Google Scholar] [CrossRef]
  61. Wei, H.; Song, Z.; Xie, Y.; Cheng, H.; Yan, H.; Sun, F.; Liu, H.; Shen, J.; Li, L.; He, X.; et al. High temperature inhibits vascular development via the PIF4-miR166-HB15 module in Arabidopsis. Curr. Biol. 2023, 33, 3203–3214.e4. [Google Scholar] [CrossRef]
  62. Boualem, A.; Laporte, P.; Jovanovic, M.; Laffont, C.; Plet, J.; Combier, J.P.; Niebel, A.; Crespi, M.; Frugier, F. MicroRNA166 controls root and nodule development in Medicago truncatula. Plant J. Cell Mol. Biol. 2008, 54, 876–887. [Google Scholar] [CrossRef] [PubMed]
  63. Gautam, V.; Singh, A.; Yadav, S.; Singh, S.; Kumar, P.; Sarkar Das, S.; Sarkar, A.K. Conserved LBL1-ta-siRNA and miR165/166-RLD1/2 modules regulate root development in maize. Development 2021, 148, dev190033. [Google Scholar] [CrossRef]
  64. Zhou, G.K.; Kubo, M.; Zhong, R.; Demura, T.; Ye, Z.H. Overexpression of miR165 affects apical meristem formation, organ polarity establishment and vascular development in Arabidopsis. Plant Cell Physiol. 2007, 48, 391–404. [Google Scholar] [CrossRef] [PubMed]
  65. Chen, H.; Fang, R.; Deng, R.; Li, J. The OsmiRNA166b-OsHox32 pair regulates mechanical strength of rice plants by modulating cell wall biosynthesis. Plant Biotechnol. J. 2021, 19, 1468–1480. [Google Scholar] [CrossRef]
  66. Curaba, J.; Singh, M.B.; Bhalla, P.L. miRNAs in the crosstalk between phytohormone signalling pathways. J. Exp. Bot. 2014, 65, 1425–1438. [Google Scholar] [CrossRef] [PubMed]
  67. Zhao, C.; Ma, J.; Zhang, Y.; Yang, S.; Feng, X.; Yan, J. The miR166 mediated regulatory module controls plant height by regulating gibberellic acid biosynthesis and catabolism in soybean. J. Integr. Plant Biol. 2022, 64, 995–1006. [Google Scholar] [CrossRef] [PubMed]
  68. Singh, A.; Jain, D.; Pandey, J.; Yadav, M.; Bansal, K.C.; Singh, I.K. Deciphering the role of miRNA in reprogramming plant responses to drought stress. Crit. Rev. Biotechnol. 2022, 43, 613–627. [Google Scholar] [CrossRef] [PubMed]
  69. Chen, J.; Teotia, S.; Lan, T.; Tang, G. MicroRNA Techniques: Valuable Tools for Agronomic Trait Analyses and Breeding in Rice. Front. Plant Sci. 2021, 12, 744357. [Google Scholar] [CrossRef]
  70. Li, J.; Cao, Y.; Zhang, J.; Zhu, C.; Tang, G.; Yan, J. The miR165/166-PHABULOSA module promotes thermotolerance by transcriptionally and posttranslationally regulating HSFA1. Plant Cell 2023, 35, 2952–2971. [Google Scholar] [CrossRef]
  71. Lei, X.; Chen, M.; Xu, K.; Sun, R.; Zhao, S.; Wu, N.; Zhang, S.; Yang, X.; Xiao, K.; Zhao, Y. The miR166d/TaCPK7-D Signaling Module Is a Critical Mediator of Wheat (Triticum aestivum L.) Tolerance to K+ Deficiency. Int. J. Mol. Sci. 2023, 24, 7926. [Google Scholar] [CrossRef] [PubMed]
  72. Zhou, C.; Yang, N.; Tian, C.; Wen, S.; Zhang, C.; Zheng, A.; Hu, X.; Fang, J.; Zhang, Z.; Lai, Z.; et al. The miR166 targets CsHDZ3 genes to negatively regulate drought tolerance in tea plant (Camellia sinensis). Int. J. Biol. Macromol. 2024, 264, 130735. [Google Scholar] [CrossRef] [PubMed]
  73. Salvador-Guirao, R.; Hsing, Y.I.; San Segundo, B. The Polycistronic miR166k-166h Positively Regulates Rice Immunity via Post-transcriptional Control of EIN2. Front. Plant Sci. 2018, 9, 337. [Google Scholar] [CrossRef]
  74. Wang, K.; Su, X.; Cui, X.; Du, Y.; Zhang, S.; Gao, J. Identification and Characterization of microRNA during Bemisia tabaci Infestations in Solanum lycopersicum and Solanum habrochaites. Hortic. Plant J. 2018, 4, 62–72. [Google Scholar] [CrossRef]
  75. Prasad, A.; Sharma, N.; Chirom, O.; Prasad, M. The sly-miR166-SlyHB module acts as a susceptibility factor during ToLCNDV infection. Theor. Appl. Genet. 2022, 135, 233–242. [Google Scholar] [CrossRef] [PubMed]
  76. Candar-Cakir, B.; Arican, E.; Zhang, B. Small RNA and degradome deep sequencing reveals drought-and tissue-specific micrornas and their important roles in drought-sensitive and drought-tolerant tomato genotypes. Plant Biotechnol. J. 2016, 14, 1727–1746. [Google Scholar] [CrossRef] [PubMed]
  77. Shen, Y.; Sun, S.; Hua, S.; Shen, E.; Ye, C.Y.; Cai, D.; Timko, M.P.; Zhu, Q.H.; Fan, L. Analysis of transcriptional and epigenetic changes in hybrid vigor of allopolyploid Brassica napus uncovers key roles for small RNAs. Plant J. 2017, 91, 874–893. [Google Scholar] [CrossRef] [PubMed]
  78. Ravichandran, S.; Ragupathy, R.; Edwards, T.; Domaratzki, M.; Cloutier, S. MicroRNA-guided regulation of heat stress response in wheat. BMC Genom. 2019, 20, 488. [Google Scholar] [CrossRef] [PubMed]
  79. Mangrauthia, S.K.; Bhogireddy, S.; Agarwal, S.; Prasanth, V.V.; Voleti, S.R.; Neelamraju, S.; Subrahmanyam, D. Genome-wide changes in microRNA expression during short and prolonged heat stress and recovery in contrasting rice cultivars. J. Exp. Bot. 2017, 68, 2399–2412. [Google Scholar] [CrossRef]
  80. Peng, Y.; Zhang, X.; Liu, Y.; Chen, X. Exploring Heat-Response Mechanisms of MicroRNAs Based on Microarray Data of Rice Post-meiosis Panicle. Int. J. Genom. 2020, 2020, 7582612. [Google Scholar] [CrossRef]
  81. He, J.; Jiang, Z.; Gao, L.; You, C.; Ma, X.; Wang, X.; Xu, X.; Mo, B.; Chen, X.; Liu, L. Genome-Wide Transcript and Small RNA Profiling Reveals Transcriptomic Responses to Heat Stress. Plant Physiol. 2019, 181, 609–629. [Google Scholar] [CrossRef] [PubMed]
  82. Dubey, S.; Saxena, S.; Chauhan, A.S.; Mathur, P.; Rani, V.; Chakrabaroty, D. Identification and expression analysis of conserved microRNAs during short and prolonged chromium stress in rice (Oryza sativa). Environ. Sci. Pollut. Res. Int. 2020, 27, 380–390. [Google Scholar] [CrossRef]
  83. Yin, Z.; Murawska, Z.; Xie, F.; Pawełkowicz, M.; Michalak, K.; Zhang, B.; Lebecka, R. microRNA response in potato virus Y infected tobacco shows strain-specificity depending on host and symptom severity. Virus Res. 2019, 260, 20–32. [Google Scholar] [CrossRef]
  84. Gorshkov, O.; Chernova, T.; Mokshina, N.; Gogoleva, N.; Suslov, D.; Tkachenko, A.; Gorshkova, T. Intrusive Growth of Phloem Fibers in Flax Stem: Integrated Analysis of miRNA and mRNA Expression Profiles. Plants 2019, 8, 47. [Google Scholar] [CrossRef]
  85. Bai, B.; Shi, B.; Hou, N.; Cao, Y.; Meng, Y.; Bian, H.; Zhu, M.; Han, N. microRNAs participate in gene expression regulation and phytohormone cross-talk in barley embryo during seed development and germination. BMC Plant Biol. 2017, 17, 150. [Google Scholar] [CrossRef]
  86. DeBoer, K.; Melser, S.; Sperschneider, J.; Kamphuis, L.G.; Garg, G.; Gao, L.L.; Frick, K.; Singh, K.B. Identification and profiling of narrow-leafed lupin (Lupinus angustifolius) microRNAs during seed development. BMC Genom. 2019, 20, 135. [Google Scholar] [CrossRef]
  87. Li, D.; Liu, Z.; Gao, L.; Wang, L.; Gao, M.; Jiao, Z.; Qiao, H.; Yang, J.; Chen, M.; Yao, L.; et al. Genome-Wide Identification and Characterization of microRNAs in Developing Grains of Zea mays L. PLoS ONE 2016, 11, e0153168. [Google Scholar] [CrossRef]
  88. Li, D.; Wang, L.; Liu, X.; Cui, D.; Chen, T.; Zhang, H.; Jiang, C.; Xu, C.; Li, P.; Li, S.; et al. Deep sequencing of maize small RNAs reveals a diverse set of microRNA in dry and imbibed seeds. PLoS ONE 2013, 8, e55107. [Google Scholar] [CrossRef] [PubMed]
  89. Puchta, M.; Groszyk, J.; Małecka, M.; Koter, M.D.; Niedzielski, M.; Rakoczy-Trojanowska, M.; Boczkowska, M. Barley Seeds miRNome Stability during Long-Term Storage and Aging. Int. J. Mol. Sci. 2021, 22, 4315. [Google Scholar] [CrossRef] [PubMed]
  90. Xue, T.; Dai, X.; Wang, R.; Wang, J.; Liu, Z.; Xiang, F. ARGONAUTE10 inhibits in vitro shoot regeneration via repression of miR165/166 in Arabidopsis thaliana. Plant Cell Physiol. 2017, 58, 1789–1800. [Google Scholar] [CrossRef]
  91. Du, F.; Gong, W.; Boscá, S.; Tucker, M.; Vaucheret, H.; Laux, T. Dose-Dependent AGO1-Mediated Inhibition of the miRNA165/166 Pathway Modulates Stem Cell Maintenance in Arabidopsis Shoot Apical Meristem. Plant Commun. 2020, 1, 100002. [Google Scholar] [CrossRef] [PubMed]
  92. D’Ario, M.; Griffiths-Jones, S.; Kim, M. Small RNAs: Big impact on plant development. Trends Plant Sci. 2017, 22, 1056–1068. [Google Scholar] [CrossRef] [PubMed]
  93. Wójcik, A.M.; Nodine, M.D.; Gaj, M.D. miR160 and miR166/165 Contribute to the LEC2-Mediated Auxin Response Involved in the Somatic Embryogenesis Induction in Arabidopsis. Front. Plant Sci. 2017, 8, 2024. [Google Scholar] [CrossRef] [PubMed]
  94. Yang, T.; Wang, Y.; Teotia, S.; Wang, Z.; Shi, C.; Sun, H.; Gu, Y.; Zhang, Z.; Tang, G. The interaction between miR160 and miR165/166 in the control of leaf development and drought tolerance in Arabidopsis. Sci. Rep. 2019, 9, 2832. [Google Scholar] [CrossRef] [PubMed]
  95. Kitazumi, A.; Kawahara, Y.; Onda, T.S.; De Koeyer, D.; de los Reyes, B.G. Implications of miR166 and miR159 induction to the basal response mechanisms of an andigena potato (Solanum tuberosum subsp. andigena) to salinity stress, predicted from network models in Arabidopsis. Genome 2015, 58, 13–24. [Google Scholar] [CrossRef] [PubMed]
  96. Tang, X.; Bian, S.; Tang, M.; Lu, Q.; Li, S.; Liu, X.; Tian, G.; Nguyen, V.; Tsang, E.W.; Wang, A.; et al. MicroRNA-mediated repression of the seed maturation program during vegetative development in Arabidopsis. PLoS Genet. 2012, 8, e1003091. [Google Scholar] [CrossRef] [PubMed]
  97. Ji, L.; Liu, X.; Yan, J.; Wang, W.; Yumul, R.E.; Kim, Y.J.; Dinh, T.T.; Liu, J.; Cui, X.; Zheng, B.; et al. ARGONAUTE10 and ARGONAUTE1 regulate the termination of floral stem cells through two microRNAs in Arabidopsis. PLoS Genet. 2011, 7, e1001358. [Google Scholar] [CrossRef] [PubMed]
  98. Betti, F.; Ladera-Carmona, M.J.; Weits, D.A.; Ferri, G.; Iacopino, S.; Novi, G.; Svezia, B.; Kunkowska, A.B.; Santaniello, A.; Piaggesi, A.; et al. Exogenous miRNAs induce post-transcriptional gene silencing in plants. Nat. Plants 2021, 7, 1379–1388. [Google Scholar] [CrossRef]
  99. Lauressergues, D.; Couzigou, J.-M.; Clemente, H.S.; Martinez, Y.; Dunand, C.; Bécard, G.; Combier, J.-P. Primary transcripts of microRNAs encode regulatory peptides. Nature 2015, 520, 90–93. [Google Scholar] [CrossRef]
  100. Ormancey, M.; Guillotin, B.; San Clemente, H.; Thuleau, P.; Plaza, S.; Combier, J.P. Use of microRNA-encoded peptides to improve agronomic traits. Plant Biotechnol. J. 2021, 19, 1687–1689. [Google Scholar] [CrossRef]
  101. Chen, Q.-J.; Deng, B.-H.; Gao, J.; Zhao, Z.-Y.; Chen, Z.-L.; Song, S.-R.; Wang, L.; Zhao, L.-P.; Xu, W.-P.; Zhang, C.-X.; et al. A miRNA-Encoded Small Peptide, vvi-miPEP171d1, Regulates Adventitious Root Formation. Plant Physiol. 2020, 183, 656–670. [Google Scholar] [CrossRef] [PubMed]
  102. Couzigou, J.M.; André, O.; Guillotin, B.; Alexandre, M.; Combier, J.P. Use of microRNA-encoded peptide miPEP172c to stimulate nodulation in soybean. New Phytol. 2016, 211, 379–381. [Google Scholar] [CrossRef] [PubMed]
  103. Rodríguez-Leal, D.; Lemmon, Z.H.; Man, J.; Bartlett, M.E.; Lippman, Z.B. Engineering Quantitative Trait Variation for Crop Improvement by Genome Editing. Cell 2017, 171, 470–480.e8. [Google Scholar] [CrossRef] [PubMed]
  104. Zhou, J.; Zhang, R.; Jia, X.; Tang, X.; Guo, Y.; Yang, H.; Zheng, X.; Qian, Q.; Qi, Y.; Zhang, Y. CRISPR-Cas9 mediated OsMIR168a knockout reveals its pleiotropy in rice. Plant Biotechnol. J. 2021, 20, 310–322. [Google Scholar] [CrossRef] [PubMed]
  105. Teotia, S.; Singh, D.; Tang, X.; Tang, G. Essential RNA-Based Technologies and Their Applications in Plant Functional Genomics. Trends Biotechnol. 2016, 34, 106–123. [Google Scholar] [CrossRef]
  106. Wang, X.-W.; Hu, L.-F.; Hao, J.; Liao, L.-Q.; Chiu, Y.-T.; Shi, M.; Wang, Y. A microRNA-inducible CRISPR-Cas9 platform serves as a microRNA sensor and cell-type-specific genome regulation tool. Nat. Cell Biol. 2019, 21, 522–530. [Google Scholar] [CrossRef]
Genes 15 00944 g001
Figure 1. Phylogenetic analysis of MIR165/166s in model plants and major crops. The neighbor-joining tree was constructed using Clustal omega (V1.2.2) and iTol online software (V6). The different colors indicated the seven clades. Dicots: arabidopsis thaliana, ath; brassica napus, bna; glycine max (soybean), gma; gossypium hirsutum (cotton), ghr; medicago truncatula (medicago), mtr; solanum lycopersicum (tomato), sly. Monocots: brachypodium distachyon, bdi; oryza sativa (rice), osa; sorghum bicolor (sorghum), sbi; zea mays (maize), zma.
Figure 1. Phylogenetic analysis of MIR165/166s in model plants and major crops. The neighbor-joining tree was constructed using Clustal omega (V1.2.2) and iTol online software (V6). The different colors indicated the seven clades. Dicots: arabidopsis thaliana, ath; brassica napus, bna; glycine max (soybean), gma; gossypium hirsutum (cotton), ghr; medicago truncatula (medicago), mtr; solanum lycopersicum (tomato), sly. Monocots: brachypodium distachyon, bdi; oryza sativa (rice), osa; sorghum bicolor (sorghum), sbi; zea mays (maize), zma.
Genes 15 00944 g001
Genes 15 00944 g002
Figure 2. Experimentally verified functions of miR166-HD-ZIP IIIs in regulating model and crop plant morphology and development. (A). Regulatory roles of miR165/166 in Arabidopsis include leaf polarity, shoot apical meristem formation, and axillary meristem development. (B). The knockdown of miR166 leads to decreased plant height in soybean. (C). Tomato miR166 is involved in the regulating of leaf polarity, plant height, ovule, and flower morphogenesis. (D). In rice, miR166 acts as a determinant in rice leaf rolling, plant height, and yield. (E) The loss function of miR166 results in rolled leaf, short tassel central spike, and reduced plant height. STTM166 represents the knockdown mutant of miR166 by short tandem target-mimic (STTM) technology.
Figure 2. Experimentally verified functions of miR166-HD-ZIP IIIs in regulating model and crop plant morphology and development. (A). Regulatory roles of miR165/166 in Arabidopsis include leaf polarity, shoot apical meristem formation, and axillary meristem development. (B). The knockdown of miR166 leads to decreased plant height in soybean. (C). Tomato miR166 is involved in the regulating of leaf polarity, plant height, ovule, and flower morphogenesis. (D). In rice, miR166 acts as a determinant in rice leaf rolling, plant height, and yield. (E) The loss function of miR166 results in rolled leaf, short tassel central spike, and reduced plant height. STTM166 represents the knockdown mutant of miR166 by short tandem target-mimic (STTM) technology.
Genes 15 00944 g002
Genes 15 00944 g003
Figure 3. Functional identification of miR166 in model and crop plant roots and vascular development. (A–C). The overexpression or knockdown of miR166 induces root architecture alterations in Arabidopsis, maize, and medcago truncatula. (D,E). Vascular patterns determined by the miR166-HD-ZIP IIIs module in rice, maize, and Arabidopsis. STTM166 represents the knockdown mutant of miR166 by short tandem target-mimic (STTM) technology.
Figure 3. Functional identification of miR166 in model and crop plant roots and vascular development. (A–C). The overexpression or knockdown of miR166 induces root architecture alterations in Arabidopsis, maize, and medcago truncatula. (D,E). Vascular patterns determined by the miR166-HD-ZIP IIIs module in rice, maize, and Arabidopsis. STTM166 represents the knockdown mutant of miR166 by short tandem target-mimic (STTM) technology.
Genes 15 00944 g003
Genes 15 00944 g004
Figure 4. miR165/166-HD-ZIP IIIs module involved in phytochromones crosstalk.
Figure 4. miR165/166-HD-ZIP IIIs module involved in phytochromones crosstalk.
Genes 15 00944 g004
Genes 15 00944 g005
Figure 5. miR166 confers plant abiotic stress and pathogenic immunity. (A–D). The inactivation of miR165/166 mediates enhanced abiotic stress tolerance in Arabidopsis, rice, and maize. (E–G). The overexpression of miR166 is essential for improving pathogenic immunity and cadmium tolerance in rice and tomato.
Figure 5. miR166 confers plant abiotic stress and pathogenic immunity. (A–D). The inactivation of miR165/166 mediates enhanced abiotic stress tolerance in Arabidopsis, rice, and maize. (E–G). The overexpression of miR166 is essential for improving pathogenic immunity and cadmium tolerance in rice and tomato.
Genes 15 00944 g005
Genes 15 00944 g006
Figure 6. Interactive roles of miR165/166 with other miRNAs.
Figure 6. Interactive roles of miR165/166 with other miRNAs.
Genes 15 00944 g006
Table 1. Diversification of mature miR165/166 sequences in model and main crop plants.
Table 1. Diversification of mature miR165/166 sequences in model and main crop plants.
Species/MembersSequence Alignment
Arabidopsis thalianaath-miR165a,b UCGGACCAGGCUUCAUCCCCC21
9ath-miR166a-g UCGGACCAGGCUUCAUUCCCC21
Brassica napusbna-miR166a-e UCGGACCAGGCUUCAUUCCCC21
6bna-miR166f UCGGACCAGGCUUCAUCCCCC21
Glycine maxgma-miR166h,k UCUCGGACCAGGCUUCAUUCC 21
21gma-miR166u UCUCGGACCAGGCUUCAUUC 20
gma-miR166a-g,i UCGGACCAGGCUUCAUUCCCC21
gma-miR166m CGGACCAGGCUUCAUUCCCC20
gma-miR166n,o UCGGACCAGGCUUCAUUCCCC21
gma-miR166j UCGGACCAGGCUUCAUUCCCG21
gma-miR166p-t UCGGACCAGGCUUCAUUCCC 20
Gossypium hirsutum 2ghr-miR166a,b UCGGACCAGGCUUCAUUCCCC21
Medicago truncatulamtr-miR166a,b,d,e,g UCGGACCAGGCUUCAUUCCCC21
7mtr-miR166c,f UCGGACCAGGCUUCAUUCCUC21
Solanum lycopersicumsly-miR166a,b UCGGACCAGGCUUCAUUCCCC21
3sly-miR166c UCGGACCAGGCUUCAUUCCUC21
Brachypodium distachyonbdi-miR166g UGUGGUGA
UCUCGGACCAGGC 21
10bdi-miR166h UCGGACCAGGCUUCAAUCCCU21
bdi-miR166f UCUCGGACCAGGCUUCAUUCC 21
bdi-miR166a-d,i UCGGACCAGGCUUCAUUCCCC21
bdi-miR166e CUCGGACCAGGCUUCAUUCCC 21
bdi-miR166j UCGGACCAGGCUUCAUUCCUU21
Oryza sativaosa-miR166g-i UCGGACCAGGCUUCAUUCCUC21
13osa-miR166a-d,f,j UCGGACCAGGCUUCAUUCCCC21
osa-miR166e UCGAACCAGGCUUCAUUCCCC21
osa-miR166k-m UCGGACCAGGCUUCAAUCCCU21
Sorghum bicolorsbi-miR166f UCGGACCAGGCUUCAUUCCUC21
11sbi-miR166k UCGGACCAGGCUUCAUUCCU 20
sbi-miR166a-d,h-j UCGGACCAGGCUUCAUUCCC 20
sbi-miR166e,g UCGGACCAGGCUUCAAUCCCU21
Zea mayszma-miR166l,m UCGGACCAGGCUUCAUUCCUC21
14zma-miR166j,k,n UCGGACCAGGCUUCAAUCCCU21
zma-miR166a UCGGACCAGGCUUCAUUCCCC21
zma-miR166b-i UCGGACCAGGCUUCAUUCCC*20
Table 2. Polycistronic MIR166s in model and main crop plants.
Table 2. Polycistronic MIR166s in model and main crop plants.
ClassSpeciesPolycistronic MIR166Location
DicotsBrassica napusbna-MIR166b,cScaffold2676:6222~6333
Scaffold2676:6215~6341
Glycine maxgma-MIR166e,q4:46797931~46798040
4:46798188~46798339
Gossypium hirsutumghr-MIR166a,bD12:41573882~41574028
D12:41573879~41574032
Medicago truncatulamtr-MIR166c,d3:47901757~47901861
3:47901931~47902021
MonocotsBrachypodium distachyonbdi-MIR166h,j3:57184726~57184865
3:57184616~57184767
Oryza sativaosa-MIR166i,j3:25294953~25295097
3:25294953~25295092
osa-MIR166d,h,k2:32435174~32435292
2:32435003~32435129
Sorghum bicolorsbi-MIR166d,f,g4:64857783~64857921
4:64857514~64857647
Zea mayszma-MIR166k,m5:219021288~219021455
5:219021559~219021714
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Z.; Yang, T.; Li, N.; Tang, G.; Tang, J. MicroRNA166: Old Players and New Insights into Crop Agronomic Traits Improvement. Genes 2024, 15, 944. https://doi.org/10.3390/genes15070944

AMA Style

Zhang Z, Yang T, Li N, Tang G, Tang J. MicroRNA166: Old Players and New Insights into Crop Agronomic Traits Improvement. Genes. 2024; 15(7):944. https://doi.org/10.3390/genes15070944

Chicago/Turabian Style

Zhang, Zhanhui, Tianxiao Yang, Na Li, Guiliang Tang, and Jihua Tang. 2024. "MicroRNA166: Old Players and New Insights into Crop Agronomic Traits Improvement" Genes 15, no. 7: 944. https://doi.org/10.3390/genes15070944

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop