A Mobile Laboratory Enables Fecal Pollution Source Tracking in Catchments Using Onsite qPCR Assays
Abstract
:1. Introduction
2. Materials and Methods
2.1. Equipment
2.2. Comparison of Portable and Conventional qPCR Workflows
2.3. Comparison of Soil and Water DNA Extraction Kits
2.4. Proof-of-Concept: Onsite Quantification of Human Sewage Marker Genes in River Water
2.5. Fecal Pollution Source Tracking with a Mobile Laboratory
2.6. Statistical Methods
3. Results
3.1. Comparing Portable with Conventional Workflows for the DNA Extraction and Marker Gene Quantification by qPCR
3.2. DNA Extraction Kit Comparison
3.3. Pilot Trial at the Catchment Outlet
3.4. Fieldwork to Investigate the Impact of Storm Drains on River Water Quality
4. Discussion
4.1. Validation of a Portable qPCR Method
4.2. Method Suitability for the Analysis of Stormwater with High Total Suspended Solids Content
4.3. Method Suitability for Rapid onsite Water Testing
4.4. Method Suitability for Fecal Pollution Source Tracking
4.5. Future Work and Potential for Applications in Low Resource Settings
5. Conclusions
- ▪
- We validated a methodology for qPCR assays with portable equipment items that produces results in close agreement with those obtained with conventional laboratory equipment items.
- ▪
- Our method can analyze turbid water samples without prefiltration, and we found no advantage in using the DNeasy PowerSoilProTM Kit instead of the DNeasy PowerWaterTM for the analysis of a stormwater sample with a high amount of total suspended solids.
- ▪
- We demonstrated rapid water quality testing with an onsite qPCR assay in a mobile laboratory (‘lab in a van’) by quantifying HF183 marker genes for human host associated Bacteroides in river water within 3 h of taking the sample.
- ▪
- We then deployed the mobile laboratory for fecal pollution source tracking in an urban catchment. Within 8 h of sampling, we collected onsite comprehensive microbial and physicochemical water quality data that indicated human sewage pollution of the river via an old storm drain. The data also showed the benefits of storm drain discharge retention in a pond, with pond effluent water having characteristics more like the receiving river compared to the discharge from the two storm drains.
- ▪
- The portable equipment items enabled 87% reduction in weight and 53% reduction in costs in comparison to the conventional laboratory equivalents. All the equipment items used for the onsite qPCR assays readily fit into a suitcase, making the method deployable for fieldwork overseas.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Method | Filter (#) | DNA Yield (ng/100 mL) | Log10 16S rRNA (Genes/100 mL) | Log10 rodA (Genes/100 mL) |
---|---|---|---|---|
Vortex and conventional qPCR | 1 | 143 | 7.70 ± 0.02 | 5.39 ± 0.21 |
2 | 157 | 7.76 ± 0.10 | 4.68 ± 0.16 | |
3 | 102 | 7.44 ± 0.06 | 4.55 ± 0.14 | |
Vortex with enzyme and conventional qPCR | 4 | 151 | 7.52 ± 0.00 | 4.69 ± 0.18 |
5 | 184 | 7.84 ± 0.11 | 4.54 ± 0.04 | |
6 | 190 | 7.77 ± 0.00 | 5.38 ± 1.35 | |
Ribolyzer and conventional qPCR | 7 | 280 | 7.92 ± 0.10 | 4.68 ± 0.03 |
8 | 235 | 7.68 ± 0.04 | 4.68 ± 0.02 | |
9 | 132 | 7.72 ± 0.20 | 4.54 ± 0.03 | |
Vortex and portable qPCR | 1 | See above | 7.85 ± 0.00 | 5.29 ± 0.01 |
2 | See above | 7.96 ± 0.01 | 4.61 ± 0.06 | |
3 | See above | 7.75 ± 0.01 | 4.38 ± 0.04 | |
Vortex with enzyme and portable qPCR | 4 | See above | 7.74 ± 0.03 | 4.62 ± 0.04 |
5 | See above | 7.85 ± 0.01 | 4.48 ± 0.12 | |
6 | See above | 7.78 ± 0.04 | 4.38 ± 0.04 | |
Ribolyzer and portable qPCR | 7 | See above | 8.14 ± 0.00 | 4.54 ± 0.27 |
8 | See above | 7.80 ± 0.51 | 4.52 ± 0.11 | |
9 | See above | 7.85 ± 0.01 | 4.28 ± 0.07 | |
Method comparison ANOVA with post hoc pairwise comparisons using Tukey’s honest significant difference criterion | One-way Extraction method p = 0.199 Pairwise comparison all p > 0.177 | Two-way crossed Extraction method p = 0.358 qPCR instrument p = 0.042 * Interaction p = 0.692 Pairwise comparison all p > 0.179 | Two-way crossed Extraction method p = 0.386 qPCR instrument p = 0.181 Interaction p = 0.792 Pairwise comparison all p > 0.634 |
PCR Instrument | Gene | LOD 1 (Genes/μL Template) | Slope (Cq/log(Genes/μL)) | Efficiency (%) | R2 |
---|---|---|---|---|---|
Conventional | 16S | 10 | −3.376 | 98 | 0.993 |
rodA | 10 | −3.440 | 95 | 1.000 | |
Portable | 16S | 10 | −3.383 | 98 | 0.996 |
rodA | 10 | −3.595 | 90 | 0.992 |
Location | Filter (#) | DNA Yield (ng/100 mL) | Log10 HF183 (Genes/100 mL) |
---|---|---|---|
Catchment outlet at Foundry Ln | 1 | 560 | 4.26 ± 0.02 |
2 | 523 | 4.23 ± 0.06 | |
Filtration replicate comparison, ttest | p = 0.44 |
Location | Filter (#) | DNA Yield (ng/100 mL) | Log10 16S rRNA (Genes/100 mL) | Log10 HF183 (Genes/100 mL) | Log10 FC (Genes/100 mL) |
---|---|---|---|---|---|
RiverUp | 1&2 | 112 | 7.01 ± 0.01 | 4.23 ± 0.03 | 3.72 ± 0.07 |
KPStDrain | 2&3 | 247 | 9.83 ± 0.72 | 6.03 ± 0.04 | 4.17 ± 0.09 |
GPStDrain | 3&4 | 61 | 8.03 ± 0.04 | 4.02 ± 0.08 | 4.12 ± 0.14 |
PondEff | 5&6 | 15 | 6.64 ± 0.03 | 4.44 ± 0.10 | 3.49 ± 0.02 |
Blank 1 | 7&8 | n.d. | n.d. | n.d. | n.d. |
Location comparison ANOVA with post hoc pairwise comparisons using Tukey’s honest significant difference criterion | One-way location p < 0.001 *** Pairwise comparison all p < 0.05 * except RiverUp vs. PondEff p = 0.61 | One-way location p < 0.001 *** Pairwise comparison all p < 0.05 * | One-way location p < 0.001 *** Pairwise comparison all p < 0.05 * except KPStDrain vs. GPStDrain p = 0.86 |
References
- Aarestrup, F.M.; Woolhouse, M.E. Using sewage for surveillance of antimicrobial resistance. Science 2020, 367, 630–632. [Google Scholar] [CrossRef] [PubMed]
- Anonymous. Science after the pandemic: Bright side of the moonshots. Economist 2021. Available online: https://www.economist.com/leaders/2021/03/27/bright-side-of-the-moonshots (accessed on 27 March 2021).
- Mao, K.; Zhang, H.; Yang, Z. Can a Paper-Based Device Trace COVID-19 Sources with Wastewater-Based Epidemiology? Environ. Sci. Technol. 2020, 54, 3733–3735. [Google Scholar] [CrossRef] [PubMed]
- Fu, J.; Chiang, E.L.C.; Medriano, C.A.D.; Li, L.; Bae, S. Rapid quantification of fecal indicator bacteria in water using the most probable number-loop-mediated isothermal amplification (MPN-LAMP) approach on a polymethyl methacrylate (PMMA) microchip. Water Res. 2021, 199, 117172. [Google Scholar] [CrossRef] [PubMed]
- Gowda, H.N.; Kido, H.; Wu, X.; Shoval, O.; Lee, A.; Lorenzana, A.; Madou, M.; Hoffmann, M.; Jiang, S.C. Development of a proof-of-concept microfluidic portable pathogen analysis system for water quality monitoring. Sci. Total Environ. 2022, 813, 152556. [Google Scholar] [CrossRef] [PubMed]
- Acharya, K.; Khanal, S.; Pantha, K.; Amatya, N.; Davenport, R.J.; Werner, D. A comparative assessment of conventional and molecular methods, including MinION nanopore sequencing, for surveying water quality. Sci. Rep. 2019, 9, 1–11. [Google Scholar]
- Hui, Q.; Pan, Y.; Yang, Z. Paper-based devices for rapid diagnostics and testing sewage for early warning of COVID-19 outbreak. Case Stud. Chem. Environ. Eng. 2020, 2, 100064. [Google Scholar] [CrossRef]
- Pantha, K.; Acharya, K.; Mohapatra, S.; Khanal, S.; Amatya, N.; Ospina-Betancourth, C.; Butte, G.; Shrestha, S.D.; Rajbhandari, P.; Werner, D. Faecal pollution source tracking in the holy Bagmati River by portable 16S rRNA gene sequencing. NPJ Clean Water 2021, 4, 12. [Google Scholar] [CrossRef]
- Bridle, H.; Miller, B.; Desmulliez, M.P.Y. Application of microfluidics in waterborne pathogen monitoring: A review. Water Res. 2014, 55, 256–271. [Google Scholar] [CrossRef]
- Reddington, K.; Eccles, D.; O’Grady, J.; Drown, D.M.; Hansen, L.H.; Nielsen, T.K.; Ducluzeau, A.-L.; Leggett, R.M.; Heavens, D.; Peel, N.; et al. Metagenomic analysis of planktonic riverine microbial consortia using nanopore sequencing reveals insight into river microbe taxonomy and function. GigaScience 2020, 9, giaa053. [Google Scholar] [CrossRef]
- WHO. Fact Sheets: Diarrhoeal Disease. Available online: https://www.who.int/news-room/fact-sheets/detail/diarrhoeal-disease (accessed on 21 March 2022).
- Tran, N.H.; Gin, K.Y.-H.; Ngo, H.H. Fecal pollution source tracking toolbox for identification, evaluation and characterization of fecal contamination in receiving urban surface waters and groundwater. Sci. Total Environ. 2015, 538, 38–57. [Google Scholar] [CrossRef]
- Teunis, P.; van der Heijden, O.; van der Giessen, J.; Havelaar, A. The Dose-Response Relation in Human Volunteers for Gastrointestinal Pathogens; RIVM Rapport 284550002; RIVM: Bilthoven, The Netherlands, 1996; p. 97.
- Martzy, R.; Kolm, C.; Brunner, K.; Mach, R.L.; Krska, R.; Šinkovec, H.; Sommer, R.; Farnleitner, A.H.; Reischer, G.H. A loop-mediated isothermal amplification (LAMP) assay for the rapid detection of Enterococcus spp. in water. Water Res. 2017, 122, 62–69. [Google Scholar] [CrossRef] [PubMed]
- Acharya, K.; Blackburn, A.; Mohammed, J.; Haile, A.T.; Hiruy, A.M.; Werner, D. Metagenomic water quality monitoring with a portable laboratory. Water Res. 2020, 184, 116112. [Google Scholar] [CrossRef] [PubMed]
- Martzy, R.; Kolm, C.; Krska, R.; Mach, R.L.; Farnleitner, A.H.; Reischer, G.H. Challenges and perspectives in the application of isothermal DNA amplification methods for food and water analysis. Anal. Bioanal. Chem. 2019, 411, 1695–1702. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Uprety, S.; Dangol, B.; Nakarmi, P.; Dhakal, I.; Sherchan, S.P.; Shisler, J.L.; Jutla, A.; Amarasiri, M.; Sano, D.; Nguyen, T.H. Assessment of microbial risks by characterization of Escherichia coli presence to analyze the public health risks from poor water quality in Nepal. Int. J. Hyg. Environ. Health 2020, 226, 113484. [Google Scholar] [CrossRef]
- Thongsamer, T.; Neamchan, R.; Blackburn, A.; Acharya, K.; Sutheeworapong, S.; Tirachulee, B.; Pattanachan, P.; Vinitnantharat, S.; Zhou, X.-Y.; Su, J.-Q.; et al. Environmental antimicrobial resistance is associated with faecal pollution in Central Thailand’s coastal aquaculture region. J. Hazard. Mater. 2021, 416, 125718. [Google Scholar] [CrossRef]
- Ho, J.Y.; Jong, M.-C.; Acharya, K.; Liew, S.S.X.; Smith, D.R.; Noor, Z.Z.; Goodson, M.L.; Werner, D.; Graham, D.W.; Eswaran, J. Multidrug-resistant bacteria and microbial communities in a river estuary with fragmented suburban waste management. J. Hazard. Mater. 2021, 405, 124687. [Google Scholar] [CrossRef]
- Hiruy, A.M.; Mohammed, J.; Haileselassie, M.M.; Acharya, K.; Butte, G.; Haile, A.T.; Walsh, C.; Werner, D. Spatiotemporal variation in urban wastewater pollution impacts on river microbiomes and associated hazards in the Akaki catchment, Addis Ababa, Ethiopia. Sci. Total Environ. 2022, 826, 153912. [Google Scholar] [CrossRef]
- O’Dea, C.; Zhang, Q.; Staley, C.; Masters, N.; Kuballa, A.; Fisher, P.; Veal, C.; Stratton, H.; Sadowsky, M.J.; Ahmed, W.; et al. Compositional and temporal stability of fecal taxon libraries for use with SourceTracker in sub-tropical catchments. Water Res. 2019, 165, 114967. [Google Scholar] [CrossRef]
- Ahmed, W.; Hughes, B.; Harwood, V.J. Current Status of Marker Genes of Bacteroides and Related Taxa for Identifying Sewage Pollution in Environmental Waters. Water 2016, 8, 231. [Google Scholar] [CrossRef] [Green Version]
- Capone, D.; Berendes, D.; Cumming, O.; Knee, J.; Nalá, R.; Risk, B.B.; Stauber, C.; Zhu, K.; Brown, J. Analysis of Fecal Sludges Reveals Common Enteric Pathogens in Urban Maputo, Mozambique. Environ. Sci. Technol. Lett. 2020, 7, 889–895. [Google Scholar] [CrossRef]
- Muyzer, G.; de Waal, E.C.; Uitterlinden, A.G. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 1993, 59, 695–700. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chern, E.C.; Siefring, S.; Paar, J.; Doolittle, M.; Haugland, R.A. Comparison of quantitative PCR assays for Escherichia coli targeting ribosomal RNA and single copy genes. Lett. Appl. Microbiol. 2011, 52, 298–306. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, W.; Payyappat, S.; Cassidy, M.; Besley, C. A duplex PCR assay for the simultaneous quantification of Bacteroides HF183 and crAssphage CPQ_056 marker genes in untreated sewage and stormwater. Environ. Int. 2019, 126, 252–259. [Google Scholar] [CrossRef] [PubMed]
- Rügner, H.; Schwientek, M.; Beckingham, B.; Kuch, B.; Grathwohl, P. Turbidity as a proxy for total suspended solids (TSS) and particle facilitated pollutant transport in catchments. Environ. Earth Sci. 2013, 69, 373–380. [Google Scholar] [CrossRef]
- Johnson, G.; Nolan, T.; Bustin, S.A. Real-Time Quantitative PCR, Pathogen Detection and MIQE. In PCR Detection of Microbial Pathogens; Wilks, M., Ed.; Humana Press: Totowa, NJ, USA, 2013; pp. 1–16. [Google Scholar]
- Carvalho, J.; Diéguez, L.; Ipatov, A.; Guerreiro, J.R.; Garrido-Maestu, A.; Azinheiro, S.; Prado, M. Single-use microfluidic device for purification and concentration of environmental DNA from river water. Talanta 2021, 226, 122109. [Google Scholar] [CrossRef]
- Unicef. Rapid Water Quality Testing. Available online: https://www.unicef.org/innovation/rapid-water-quality-testing (accessed on 17 February 2022).
- Rennie, M.J. A Water Quality Survey of the River Ouseburn. Master Thesis, School of Civil Engineering & Geosciences, Newcastle University, Newcastle upon Tyne, UK, 2012; p. 13. [Google Scholar]
- Baker, A.; Inverarity, R.; Charlton, M.; Richmond, S. Detecting river pollution using fluorescence spectrophotometry: Case studies from the Ouseburn, NE England. Environ. Pollut. 2003, 124, 57–70. [Google Scholar] [CrossRef]
- Birkinshaw, S.J.; Kilsby, C.; O’Donnell, G.; Quinn, P.; Adams, R.; Wilkinson, M.E. Stormwater Detention Ponds in Urban Catchments—Analysis and Validation of Performance of Ponds in the Ouseburn Catchment, Newcastle upon Tyne, UK. Water 2021, 13, 2521. [Google Scholar] [CrossRef]
Methodology | Equipment | Weight kg | Dimensions (W × L × H in cm) | Costs £ incl. VAT |
---|---|---|---|---|
Conventional | FastPrep-24™ 5G ribolyzer | 23.6 | 47.2 × 38.5 × 49 | 7344 |
Bio-Rad CFX Connect qPCR instrument with software | 21.0 | 33 × 46 × 36 | 14,887 | |
Portable | Vortex-Genie 2 with adaptor | 4 | 12.2 × 16.5 × 16.5 | 518 |
Q qPCR instrument | 2 | 15 × 15 × 13 | 9980 |
Marker Gene | Primers and Probe | Program | Slope (Cq/log(Genes/µL)) | R2 | Efficiency (%) |
---|---|---|---|---|---|
16S rRNA (total bacteria) [24] | F: ATGGCTGTCGTCAGCT R: ACGGGCGGTGTGTAC | 3 min at 98 °C, 40 cycles of 15 s at 98 °C, 30 s at 60 °C, melt curve from 72 °C to 95 °C | −3.30 ± 0.13 | 0.990 ± 0.019 | 101 ± 6 |
rodA (E. coli) [25] | F: GCAAACCACCTTTGGTCG R: CTGTGGGTGTGGATTGACAT P: FAM-AACCCCTACAACCGGCAGAATACC | 3 min at 95 °C, 40 cycles of 15 s at 95 °C, 30 s at 60 °C | −3.63 ± 0.09 | 0.992 ± 0.002 | 89 ± 3 |
HF183 (human host associated Bacteroides) [26] | F: ATCATGAGTTCACATGTCCG R: CTTCCTCTCAGAACCCCTATCC P: HEX-CTAATGGAACGCATCCC | 3 min at 95 °C, 40 cycles of 15 s at 95 °C, 30 s at 60 °C | −3.32 ± 0.17 | 0.992 ± 0.005 | 100 ± 7 |
Kit | Filter (#) | DNA Yield (ng/100 mL) | Log10 16S rRNA (Genes/100 mL) | Log10 rodA (Genes/100 mL) |
---|---|---|---|---|
DNeasy PowerWater TM | 1 | 52,750 | 10.56 ± 0.02 | 5.26 ± 0.20 |
2 | 32,200 | 10.31 ± 0.00 | 5.22 ± 0.26 | |
DNeasy PowerSoil Pro TM | 3 | 25,600 | 10.30 ± 0.01 | 6.00 ± 0.19 |
4 | 22,800 | 10.23 ± 0.01 | 5.61 ± 0.43 | |
Kit comparison, t-test | p = 0.220 | p = 0.316 | p = 0.101 |
Parameter | RiverUp | KPStDrain | GPStDrain | PondEff |
---|---|---|---|---|
Temperature (°C) | 10.3 | 12.8 | 13.3 | 10.4 |
Conductivity (μS/cm) | 610 | 746 | 769 | 358 |
pH | 7.31 | 7.75 | 7.69 | 7.45 |
Dissolved oxygen (mg/L) | 9.15 | 9.55 | 9.54 | 7.52 |
Alkalinity (mg/L CaCO3) | 96 ± 16 | 145 ± 24 | 113 ± 13 | 64 ± 1 |
Turbidity (NTU) | 69.3 ± 1.2 | 8.1 ± 0.1 | 3.9 ± 0.0 | 94.7 ± 1.0 |
Ammonium-N (mg/L) | 0.120 ± 0.003 | 0.135 ± 0.010 | 0.033 ± 0.008 | 0.121 ± 0.003 |
Nitrate-N (mg/L) | 5.74 ± 0.01 | 4.29 ± 0.02 | 5.72 ± 0.03 | 2.74 ± 0.02 |
Nitrite-N (mg/L) | 0.098 ± 0.013 | 0.012 ± 0.017 | 0.029 ± 0.003 | 0.079 ± 0.002 |
Phosphate-P (mg/L) | 0.255 ± 0.001 | 0.212 ± 0.001 | 0.163 ± 0.004 | 0.432 ± 0.011 |
Fluoride (mg/L) | <0.1 | <0.1 | <0.1 | <0.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zan, R.; Acharya, K.; Blackburn, A.; Kilsby, C.G.; Werner, D. A Mobile Laboratory Enables Fecal Pollution Source Tracking in Catchments Using Onsite qPCR Assays. Water 2022, 14, 1224. https://doi.org/10.3390/w14081224
Zan R, Acharya K, Blackburn A, Kilsby CG, Werner D. A Mobile Laboratory Enables Fecal Pollution Source Tracking in Catchments Using Onsite qPCR Assays. Water. 2022; 14(8):1224. https://doi.org/10.3390/w14081224
Chicago/Turabian StyleZan, Rixia, Kishor Acharya, Adrian Blackburn, Chris G. Kilsby, and David Werner. 2022. "A Mobile Laboratory Enables Fecal Pollution Source Tracking in Catchments Using Onsite qPCR Assays" Water 14, no. 8: 1224. https://doi.org/10.3390/w14081224