Next Article in Journal
Application of Same-Day Enterococcus qPCR-Based Analyses for Quality Assessment of Shorelines (Water and Sand) at Recreational Beaches
Previous Article in Journal
Heterogeneous Fenton-like Photocatalytic Process towards the Eradication of Tetracycline under UV Irradiation: Mechanism Elucidation and Environmental Risk Analysis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Water
Volume 15
Issue 13
10.3390/w15132337
water-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Novel Mn- and Fe-Oxides-Reducing Bacterium with High Activity to Drive Mobilization and Release of Arsenic from Soils

by
Jianyu Xiong
†,
Yifan Xu
†,
Yang Li
and
Xian-Chun Zeng
*
State Key Laboratory of Biogeology and Environmental Geology & School of Environmental Studies, China University of Geosciences, Wuhan 430074, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Water 2023, 15(13), 2337; https://doi.org/10.3390/w15132337
Submission received: 31 May 2023 / Revised: 20 June 2023 / Accepted: 22 June 2023 / Published: 23 June 2023
(This article belongs to the Special Issue Biogeochemical Cycling of Arsenic in Groundwater and Soils)
Browse Figures
Versions Notes

Abstract

:
Since Mn, Fe and As contaminants often coexist in the environment, we hypothesize that the presence of multifunctional bacteria is capable of reducing Mn and Fe oxides and promoting the mobilization and release of arsenic. However, such bacteria have not been reported yet; moreover, the impact of bacteria with the ability to simultaneously reduce Mn and Fe oxides on the formation of high-arsenic groundwater remains unclear. This study aims to address this question. Here, we found that the microbial community in the soils was able to efficiently reduce Mn oxides into Mn(II). An analysis of the microbial community structures of the soil shows that it contained Proteobacteria (41.1%), Acidobacteria (10.9%), Actinobacteria (9.5%) and other less abundant bacteria. Based on this observation, we successfully isolated a novel bacterium Cellulomonas sp. CM1, which possesses both Mn- and Fe-oxide-reducing activities. Under anaerobic conditions, strain CM1 can reduce Mn oxides, resulting in the production of 13 mg/L of Mn(II) within a span of 10 days. Simultaneously, it can reduce Fe oxides, leading to the generation of 9 mg/L of Fe(II) within 9 days when a yeast extract is used as an electron donor. During these reduction reactions, the cells were grown into a density of OD600 0.16 and 0.09, respectively, suggesting that Mn(IV) is more beneficial for the bacterial growth than Fe(III). Arsenic release assays indicate that after 108 days of anoxic incubation, approximately 126.2, 103.2 and 81.5 μg/L As(V) were mobilized and released from three soil samples, respectively, suggesting that CM1 plays significant roles in driving mobilization of arsenic from soils. These findings shed new light on the microbial processes that lead to the generation of arsenic-contaminated groundwater.

1. Introduction

Arsenic contamination of groundwater is a problem that affects millions of people across the world [1]. Arsenic is highly toxic in its inorganic form and can cause various health problems when ingested through drinking water, food preparation or irrigation of food crops [2]. Some of the health effects include skin lesions, skin cancer, lung cancer, bladder cancer, cardiovascular disease, diabetes, neurological disorders and developmental impairments [3,4,5]. The main source of arsenic contamination of groundwater is the presence of arsenic-bearing minerals in aquifers, especially in alluvial and deltaic regions such as the Ganges-Brahmaputra delta in India and Bangladesh, the Red River delta in Vietnam, the Mekong delta in Cambodia and the Chao Phraya delta in Thailand [1,6]. The factors responsible for the release of arsenic from a solid phase into groundwater are the pH, presence of organic matter in sediments (like peat, lignite and plant debris), water table fluctuation, water saturation of sediments, limited supply of sulfur and microbial activities [5,7,8,9].
Among all these factors, microbes play key roles in the transformation and mobilization of arsenic in groundwater by mediating various biogeochemical reactions that affect the speciation, solubility and availability of arsenic [10,11]. Microbes can use arsenic as an electron donor or acceptor for their metabolic activities, depending on the environmental conditions and the availability of other electron donors or acceptors [12,13]. One of the main microbial processes that promote arsenic mobilization is the dissimilatory reduction of arsenate (As(V)) to arsenite (As(III)), which is more toxic and mobile than As(V) [14,15,16]. This process can be coupled with the oxidation of organic matter or methane as electron donors [17,18]. This process can increase the arsenic concentration in groundwater by several orders of magnitude [19,20]. Another microbial process that can influence arsenic mobilization is the oxidation of As(III) to As(V), immobilizing it on the surface of Fe or Mn oxides [21,22,23]. This process can decrease the arsenic concentration in groundwater.
In addition, manganese- and iron-metabolizing prokaryotes can also affect arsenic mobilization in groundwater by altering the redox state and the adsorption capacity of Mn and Fe minerals that are associated with arsenic [24]. Mn-oxidizing prokaryotes (MOPs) are a phylogenetically diverse group of microorganisms that have the ability to catalyze the oxidation of divalent, soluble Mn(II) to insoluble manganese oxides of the general formula MnOx (where X is some number between 1 and 2). This results in the accumulation of conspicuous and easily detectable extracellular deposits of insoluble brown or black manganese oxides. MOPs are quite widespread and include members of many phylogenetic and physiological groups such as cyanobacteria, a diversity of heterotrophic rods and cocci and sheathed (Leptothrix-like) and budding (Hyphomicrobium-like) bacteria. Fe(III)-oxidizing prokaryotes (FOPs) are diverse species of the prokaryotic domains Bacteria and Archaea that have the ability to oxidize Fe(II), ferrous iron, to Fe(III), ferric iron. The electrons obtained from the oxidation of Fe(II) are utilized for energy generation in aerobic or anaerobic respiration and/or for assimilative reduction reactions [25,26,27,28,29]. MOPs and FOPs form Mn and Fe oxide deposits through the oxidation of Mn(II) and Fe(II), allowing them to adsorb arsenic ions and immobilize them within sediment, reducing the dissolved concentration of arsenic. Through physical and chemical interactions with arsenic ions, the manganese and iron oxide precipitates produced by these prokaryotes provide effective adsorption surfaces, leading to the formation of As-Mn and As-Fe complexes in groundwater. These complexes have a lower solubility, reducing the dissolved concentration of arsenic and decreasing the risk of arsenic contamination in groundwater [30,31].
Differently, Fe-reducing prokaryotes (FRPs) are a group of bacteria that can use Fe(III) as a terminal electron acceptor for their growth under anaerobic conditions. These bacteria react directly with rocks in a reservoir to transform Fe(III) into Fe(II). The electron donors for Fe(III) reduction derive mainly from the metabolic oxidation of organic compounds or hydrogen. The ability to use Fe(III) as a terminal electron acceptor is widespread across the domains Bacteria and Archaea. There are many bacterial phyla/classes associated with Fe(III) reduction, including Alphaproteobacteria, Betaproteobacteria, Deltaproteobacteria, Epsilonproteobacteria, Gammaproteobacteria, Acidobacteria, Firmicutes, Chloroflexi, Nitrospirae, Bacteriodetes, Spirochaetes, Verrucomicrobia and Sphingobacteria. Fe(III)-reducing archaea include Euryarchaeota and Crenarchaeota. Mn-oxide-reducing bacteria are microorganisms that can reduce a Mn oxide to Mn(II). The Mn oxide has been demonstrated to oxidize diverse compounds, including organic matters, methane, ammonium and sulfide, mediated by Mn-reducing bacteria. Microbial manganese redox reactions are critical for the environment, such as the evolution of photosynthesis, geochemical transformation, degradation of organic matter and mobilization or immobilization of various contaminants. A wide phylogenetic diversity of microorganisms, including archaea as well as bacteria, are capable of this process. Most microorganisms that reduce Fe(III) can also transfer electrons to Mn(IV) [24,32,33]. Fe- and Mn-oxide-reducing prokaryotes play one of the most important roles in driving the formation of arsenic-contaminated groundwater. The bio-reduction of As-bearing Fe/Mn oxides decreases the surface area of minerals and causes the release of adsorbed arsenic on the minerals into the aqueous phase under anaerobic conditions. This can drive the formation of arsenic-contaminated groundwater. Additionally, the organic acids produced by these bacteria lower the pH of groundwater, promoting arsenic dissolution and release [34]. Moreover, the activity of Fe-oxide-reducing bacteria leads to the reduction of solid iron oxides into soluble divalent iron ions. These Fe(II) compete with arsenic for adsorption onto solid phases, reducing the capacity to retain arsenic and further increasing its concentration in groundwater. Therefore, the activity of Mn- and Fe-oxide-reducing bacteria plays a multifaceted role in influencing arsenic concentrations in groundwater. The activities of Mn- and Fe-oxide-reducing prokaryotes are influenced by various factors such as the pH, temperature, oxygen availability, nutrient concentrations, hydrological conditions and human interventions [35,36,37,38].
Therefore, investigating the roles of Fe- or Mn-oxide-reducing prokaryotes in arsenic mobilization is important for deeply understanding the microbial mechanisms by which arsenic-contaminated groundwater is produced, and is helpful for developing effective strategies for arsenic remediation and prevention. Despite many investigations aimed at clarifying the roles of As-, Fe- and Mn-metabolizing prokaryotes in the formation of arsenic-contaminated groundwater, there is still limited understanding regarding the roles of microorganisms that can simultaneously metabolize Mn and Fe. This study aimed to isolate multifunctional bacteria capable of reducing Mn and Fe oxides, and investigate their role in promoting the mobilization and release of arsenic from soils to the soluble phase. We discovered a new bacterium that can reduce Mn and Fe oxides without oxygen. This strain greatly enhanced the release of arsenic from soils into water. This work provides new insights into the mechanisms and factors that lead to arsenic contamination in groundwater sources.

2. Materials and Methods

2.1. Description of the Sampling Site

The sampling site is located at the Xiangtan manganese mine, located in Hunan Province, China (27°59′04.9″ N, 112°51′30.6″ E). Soil sample MS, taken from the Mn-contaminated soil of Xiangtan using a shovel, exhibited a coarse texture and granular structure. The color ranged from a dark brown to black, indicating the presence of Mn (Figure 1). Small patches of reddish–brown were also observed, possibly due to the presence of Fe oxides or other minerals. The sample was dry to the touch, consistent with the semi-arid conditions of the area. The collected samples were carefully transferred into anaerobic bags and stored at 0–4 °C. They were then transported to the laboratory within 12 h to maintain the sample integrity.

2.2. Analysis of the Chemical Parameters of Mn-Contaminated Soil

Total arsenic concentrations in solid samples were determined using Atomic Fluorescence Spectrometry (AFS) [19]. The samples were first ground into a fine powder and then digested with aqua regia solution, followed by water-bath heating for a duration of 2 h. The total manganese (Mn) concentration in the samples was measured using Inductively Coupled Plasma–Mass Spectrometry (ICP-MS) after they were ground into a fine powder, following the method described before [19]. The concentrations of dissolved As(III) and As(V) were examined using High-Performance Liquid Chromatography (HPLC) coupled with AFS. The soluble Fe(II) and Mn(II) concentration was determined using ferrozine or potassium permanganate oxidation spectrophotometry, respectively [23,39].

2.3. Analysis of the Microbial Community Structure of Mn-Contaminated Soil

Genomic DNA was extracted from the fine powders of Mn-contaminated soil, utilizing the Soil DNA Extraction Kit (Omega, GA, USA) according to the protocol described previously [40]. PCR amplification was performed using primers designed to target the V4 region of microbial 16S rRNA genes. The PCR products were separated with gel electrophoresis. The DNA bands on the gel were cut off, minced and purified using the FastPure Gel DNA Extraction Mini Kit (Vazyme, Wuhan, China). The barcoded V4 amplicons were then sequenced using the Illumina MiSeq platform (Illumina, San Diego, CA, USA) with the paired-end method. Subsequently, the obtained DNA sequences were processed and analyzed according to the method described elsewhere [41].

2.4. Obtaining of a Novel Arsenic-Resistant Bacterium with Mn-Oxide-Reducing Activity from the Mn-Contaminated Soil

The Mn-oxide-reducing activity of the microbial community in the active soils was assessed using the microcosm technique [42]. In this approach, approximately 2.0 g of Mn-contaminated sediments was mixed with 18 mL of a minimal mineral (MM) medium supplemented with 2.0 mM of Mn(IV) and 0.5 g/L of a yeast extract. The mixtures were incubated under anaerobic conditions at 30 °C. At intervals of 1.0 day, approximately 0.4 mL of the culture was sampled to measure the concentration of dissolved Mn(II) until a plateau in the Mn(II) concentration was observed. Following four rounds of enrichment, bacterial strains were isolated from the cultures using the Hungate Rolling Tube Technique under anaerobic conditions [14]. To promote the isolation of arsenic-resistant strains, 75 mg/L of arsenic was added to the culture medium [43,44].

2.5. Analysis of the 16S rRNA Gene of the Isolated ARB Strain

To determine the taxonomic classification of the isolate, bacterial cells were used for extracting genomic DNA. The MiniBEST Bacterial Genomic DNA Extraction Kit version 2.0 from TaKaRa Biotechnology (Shiga, Japan) was employed for this purpose. Subsequently, the primers 27F (AGAGTTTGATCCTGGCTCAG) and 1541R (TACGGCTACCTTGTTACGACTT) were utilized to amplify an almost complete microbial 16S rRNA gene, which was then directly sequenced. The obtained 16S rRNA gene sequence of the isolate was used as a query for a BLAST search against the EZBioCloud database, and closely related sequences were collected. Finally, a phylogenetic tree was constructed using these sequences, as described previously [17].

2.6. Analysis of Bacterial Tolerance to Arsenic and Their Ability to Reduce Mn and Fe Oxides

Firstly, we determined the minimum inhibitory concentration (MIC) of a bacterial strain against As(V), which is defined as the lowest concentration of arsenic required to completely inhibit bacterial growth as described previously [45]. Briefly, the bacteria were cultivated in the MM medium at a temperature of 30 °C until the OD600 value of the culture reached the logarithmic growth phase. The bacterial suspension was then diluted with the same medium to achieve a final OD600 of 0.04. Next, a 20 μL arsenite solution, prepared through serial dilution, was added to each well of a 96-well plate, which already contained 180 μL of the diluted bacterial culture. The plate was subsequently incubated at 30 °C for a duration of 24 h. To determine the inhibition of bacterial growth, the optical density (OD) was measured at a wavelength of 600 nm using an ELISA plate reader.
Secondly, we determined the Mn- and Fe-oxide-reducing activities of the bacterial strain. The bacteria were cultivated in the MM medium at a temperature of 30 °C until the OD600 value of the culture reached the logarithmic growth phase. The bacterial suspension was then diluted with the same medium to a final OD600 of 0.04. The solution was transferred into two anaerobic tubes containing the MM medium supplemented with 1 g/L of a yeast extract. One tube was amended with 5.0 mM of Mn(IV), while the other tube was amended with 2.0 mM of Fe(III). Parallel control mixtures without bacterial inoculation were also prepared. All experiments were performed in triplicate under strict anaerobic conditions. The mixtures were incubated at 30 °C with continuous shaking at 150 rpm. At intervals of 1.0 or 3.0 days, approximately 0.2 mL of the culture was extracted to measure the concentration of dissolved Mn(II) or Fe(II) and bacterial cell numbers.

2.7. Effects of Arsenic-Resistant Bacterium on the Mobilization of As from Vegetable Field Soils

To investigate the mobilization of arsenic mediated by an arsenic-resistant bacterium in common vegetable field soils, an arsenic release assay was conducted. In the assay, ARB cells in the logarithmic growth phase were inoculated into microcosms created by combining 2.0 g of autoclaved S1, S2 or S3 sediments with 20.0 mL of the MM medium. Additionally, the microcosms were supplemented with 5 g/L of a yeast extract. Triplicate controls without ARB cells were also prepared. All mixtures were incubated under strict anaerobic conditions at 30 °C. At intervals of 10.0 days, approximately 0.5 mL of the culture was sampled to measure the concentrations of dissolved As(III) and As(V).

3. Results

3.1. Chemical Analysis of the Mn-Contaminated Soils

A manganese-contaminated soil sample was collected from the MS sampling site in the Xiangtan manganese mine. We collected shallow soil samples from a depth of 0.35 m by digging a hole. Geochemical analyses indicated that the soil samples contain high concentrations of total Mn (1349.31 mg/kg), suggesting that manganese is a significant environmental contaminant in this region. The sample also contained relatively high concentrations of As (48.29 mg/kg) (Table 1).

3.2. Functional Characterization and Diversity Analysis of Microbial Communities in Mn-Contaminated Soil

As depicted in Figure 2a, the concentration of dissolved Mn(II) exhibited a progressive increase over time. Specifically, at time points of 0, 1.0, 2.0, 3.0, 4.0, 4.5 and 5.0 days, the concentrations of dissolved Mn(II) reached 3.9, 19.9, 36.3, 48.0, 46.9, 48.8 and 42.2 mg/L, respectively. Conversely, in the sterile sediments, no discernible reduction in Mn oxides was observed even after 5 days of anaerobic incubation. These findings clearly demonstrate the significant Mn-oxide-reducing capabilities of the microbial community present in these soils under anaerobic conditions.
The analysis of the 16S rRNA gene in the microbial community (Figure 2b) indicated that Proteobacteria (41.1%), Acidobacteria (10.9%), Actinobacteria (9.5%) and Chloroflexi (6.2%) were the predominant phyla in the Mn-contaminated soil. There were relatively fewer other microbial taxa, including Gemmatimonadetes (1.9%), Candidatus Rokubacteria (0.58%), Actinomycetota (0.58%) and Nitrospirae (0.49%).

3.3. Isolation of a Novel Arsenic-Resistant Bacterium from the Sediments

To investigate the potential role of an arsenic-resistant bacterium with Mn(IV)-reducing activity in the dissolution and release of arsenic from sediments, a novel ARB was isolated and named CM1 from Mn-contaminated soils. The 16S rRNA gene sequencing of CM1 revealed a 99.09% identity to Cellulomonas hominis, and strain CM1 was thus referred to as Cellulomonas sp. CM1 (Figure 3). Strain CM1 is affiliated to the phylum Actinomycetota and is the first Mn-oxide-reducing bacterium of the genus Cellulomonas.

3.4. The Minimum Inhibitory Concentration (MIC) and the Mn- and Fe-Oxide-Reducing Activities of a Novel Bacterium with Arsenic Resistance

Cellulomonas sp. CM1 exhibited a minimum inhibitory concentration (MIC) of 17.0 mM against As(V).
As shown in Figure 4a, the concentration of dissolved Mn(II) in the presence of strain CM1 increased significantly over time. Specifically, it reached 7.2, 11.9 and 12.5 mg/L at the time points of 3.0, 6.0 and 10.0 days, respectively. These data indicate that strain CM1 rapidly reduced Mn oxides under anaerobic conditions, entering the stationary phase of its growth cycle within 3.0 days when Mn oxides and a yeast extract were present. These results highlight the effectiveness of Cellulomonas sp. CM1 in reducing Mn oxides when provided with a yeast extract as the sole electron donor under anaerobic conditions.
In a separate experiment, as depicted in Figure 4b, the concentration of dissolved Fe(II) under the influence of strain CM1 also showed a significant increase over time. The dissolved Fe(II) concentrations reached 4.9, 6.8 and 8.7 mg/L at the time points of 3.0, 6.0 and 9.0 days, respectively. This suggests that strain CM1 is equally efficient at reducing Fe(III) under anaerobic conditions. Like the Mn(IV) reduction, the process of Fe-oxide reduction was initiated concurrently with the growth of the CM1 strain, which reached the stationary phase of its growth cycle within 4.0 days in the presence of Fe oxides and a yeast extract. These findings establish that Cellulomonas sp. CM1 is capable of reducing not only Mn oxides but also Fe oxides when a yeast extract serves as the sole electron donor under anaerobic conditions.
Therefore, our results indicate that CM1 was unable to reduce As(V) using a yeast extract as the sole electron donor under anaerobic conditions.

3.5. Microbial Arsenic Mobilization and Release Assay

To elucidate the involvement of the arsenic-resistant bacterium Cellulomonas sp. CM1 in the mobilization and release of solid-phase arsenic, an arsenic release assay was performed. As shown in Figure 5, without the presence of CM1 cells in the sediment slurry, there was no discernible arsenic released into the aqueous phase even after an extended incubation period of 108 days. However, upon the inoculation of CM1 cells to microcosms containing vegetable field soils S1, S2 and S3, a time-dependent increase in microbial arsenic release was observed. In the microcosm with sediment S1 under anaerobic conditions, the microbial release of arsenic reached 0, 66.3, 120.1, 137.1 and 150.3 μg/L at time points of 0, 17, 42, 78 and 108 days, respectively (Figure 5a). For the microcosm with sediment S2, the concentration of arsenic showed a similar trend under anaerobic conditions, with values of 0, 48.1, 87.8, 96.8 and 112.7 μg/L at time points of 0, 17, 42, 78 and 108 days, respectively (Figure 5b). Likewise, in the microcosm with sediment S3, the arsenic concentration reached 0, 18.2, 42.1, 90.9 and 93.6 μg/L at corresponding time points (Figure 5c).
Interestingly, the majority of the released arsenic, accounting for over 88%, was in the form of As(V); approximately 126.2, 103.2 and 81.5 μg/L of As(V) were mobilized and released from the soils, suggesting that Cellulomonas sp. CM1 was incapable of reducing As(V) and plays significant roles in driving the mobilization of arsenic from soils. This hints at the possibility that the dissolved arsenic may have been adsorbed onto the surfaces of bacterial cells. Collectively, these results underscore the significant role of CM1 in augmenting the mobilization and release of arsenic from common vegetable field soils into the aqueous phase.

4. Discussion

Although some investigations suggest that bacteria that reduce Mn or Fe oxides play important roles in mobilizing arsenic adsorbed on the surfaces of Mn or Fe oxides [24,46], no bacteria with both Mn- and Fe-oxide-reducing activities have been identified so far. We, for the first time, isolated a novel bacterium Cellulomonas sp. CM1 that has significant activities to reduce both Mn and Fe oxides under anaerobic conditions. Cellulomonas sp. CM1 is affiliated to the family Cellulomonadaceae and is the first Mn-oxide-reducing bacterium of the genus Cellulomonas. To the best of our knowledge, this is the first report of this type of bacteria with both Mn- and Fe-oxide-reduction activities.
A number of investigations indicated that Mn and Fe oxides can affect the As concentrations in groundwater in different ways, depending on the geochemical and hydrological conditions [47,48,49,50]. In aerobic environments, Mn and Fe oxides can act as oxidants and sorbents for As [51]. Oxidation of As(III) to As(V) by Mn and Fe oxides can increase the As removal efficiency, as As(V) is more strongly adsorbed to the oxides than As(III) [47]. Sorption of As to Mn and Fe oxides can reduce the As mobility and bioavailability in groundwater [52]. However, in anoxic environments, Mn- and Fe-oxide-reducing bacteria convert Fe and Mn oxides into soluble forms of Fe(II) and Mn(II), respectively, which have a lower affinity for arsenic than their oxidized counterparts [35,53]. This means that arsenic can be desorbed from the mineral surface and dissolved into the water. So far, at least three strains of iron-reducing bacteria have been isolated and shown to facilitate the release of arsenic, but no studies have reported the promotion of arsenic release by Mn-reducing bacteria. For example, in an arsenic release experiment, the strain Shewanella sp. ANA-3 promoted the release of 30 μM of arsenic from As(V)-bearing Fe(III) mineral assemblages after 11 days of cultivation [35]. Similarly, after 5 days of cultivation, the strain Shewanella oneidensis MR-1 facilitated the release of 6.9 mg/L of arsenic from solid waste residue [36]. Additionally, on the 20th day of cultivation, the strain Shewanella putrefaciens 200 promoted the release of 2.5 mM of arsenic from As-bearing ferrihydrite [37]. However, since the arsenic-containing solids in these studies differ from ours, a direct comparison between the arsenic release promoted by different Fe(III)-reducing bacteria cannot be conducted. The discovery of Cellulomonas sp. CM1 with both Mn- and Fe-oxide-reducing activities, which can significantly mobilize arsenic from soils, improves our understanding of the formation mechanism of high-arsenic groundwater.
Arsenate-reducing bacteria and Mn- and Fe-oxide-reducing bacteria are two types of microorganisms that can influence the speciation and mobility of arsenic in groundwater [16,24]. According to some studies, arsenate-reducing bacteria can mediate the transformation of arsenate-associated Fe minerals and soils, and release arsenite into a solution [16,19,54]. On the other hand, Mn- and Fe-reducing bacteria can also mobilize arsenic by reducing Mn and Fe oxides into a soluble form [55]. The relative importance of these two types of bacteria may depend on various factors, such as the pH, bacterial species, mineral composition and arsenic concentration. Therefore, it is difficult to say which bacteria play the major role in general, but it may vary depending on the specific conditions of each groundwater system. In this study, we used general vegetable field soils to conduct the arsenic release assays with CM1. The results indicate that a large part of arsenic in soil exists in the form of adsorption on the surface of manganese and iron oxides, and iron- and manganese-reducing bacteria can easily dissolve and release it. Because the dissolved arsenic is easily absorbed by crops, agricultural production activities should avoid inputting organic matter that can act as an electron donor for manganese- and iron-reducing bacteria into the soil, thereby avoiding activating the Mn- and Fe-oxide-reducing respiratory bacteria existing in the soil.
One limitation of this study is that we only analyzed one soil sample from one location, which may not represent the existence and distribution of this type of bacteria in other contaminated sites. Another limitation is that we did not conduct an in situ test to determine how Cellulomonas sp. CM1 actually affects the arsenic mobilization in the contaminated soils after addition with this bacterium. Future studies should explore the actual abundances of this type of bacteria with both Mn- and Fe-oxide-reducing activities, and quantify the role of this type of bacteria in the microbial processes that lead to arsenic-contaminated groundwater formation.

5. Conclusions

In this study, a novel bacterium, Cellulomonas sp. CM1, was successfully isolated, which demonstrated the ability to simultaneously reduce Mn and Fe oxides. Under anaerobic conditions, the CM1 strain exhibited remarkable reduction activity towards both Mn and Fe oxides. When a yeast extract was utilized as an electron donor, the reduction of Mn oxides resulted in the generation of 13 mg/L of Mn(II) within a span of 10 days, whereas the reduction of Fe oxides produced 9 mg/L of Fe(II) within 9 days. Moreover, during a 108-day anaerobic incubation for arsenic release, the presence of the CM1 strain led to the respective release of 126.2 μg/L, 103.2 μg/L and 81.5 μg/L of As from soil samples at sites S1, S2 and S3, indicating the crucial role of CM1 in facilitating arsenic migration and release from the soils. These research findings provide novel insights into the microbial processes contributing to the formation of As-contaminated groundwater.

Author Contributions

X.-C.Z. was responsible for the research design, provided all the materials, equipment and tools and wrote the manuscript. J.X.: Investigation, Methodology and Data Curation; Y.X. and Y.L.: Visualization and Writing—Original Draft, Review and Editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the General Programs (No. 41472219) and the Foundations for Innovative Research Groups (No. 41521001) from the National Natural Science Foundation of China.

Data Availability Statement

The data presented in this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Podgorski, J.; Berg, M. Global threat of arsenic in groundwater. Science 2020, 368, 845–850. [Google Scholar] [CrossRef]
  2. Khanna, K.; Kohli, S.K.; Kumar, P.; Ohri, P.; Bhardwaj, R.; Alam, P.; Ahmad, P. Arsenic as hazardous pollutant: Perspectives on engineering remediation tool. Sci. Total Environ. 2022, 838 Pt 2, 155870. [Google Scholar] [CrossRef] [PubMed]
  3. Abdul, K.S.; Jayasinghe, S.S.; Chandana, E.P.; Jayasumana, C.; De Silva, P.M. Arsenic and human health effects: A review. Environ. Toxicol. Pharmacol. 2015, 40, 828–846. [Google Scholar] [CrossRef] [PubMed]
  4. Shen, L.; Liang, C.; Li, D.; Zhang, Z.; Wang, X.; Jiang, T.; Su, X.; Yin, T.; Zou, W.; Wang, X.; et al. The association between exposure to multiple toxic metals and the risk of endometriosis: Evidence from the results of blood and follicular fluid. Sci. Total Environ. 2023, 855, 158882. [Google Scholar] [CrossRef] [PubMed]
  5. Raju, N.J. Arsenic in the geo-environment: A review of sources, geochemical processes, toxicity and removal technologies. Environ. Res. 2022, 203, 111782. [Google Scholar] [CrossRef] [PubMed]
  6. Shaji, E.; Santosh, M.; Sarath, K.V.; Prakash, P.; Deepchand, V.; Divya, B.V. Arsenic contamination of groundwater: A global synopsis with focus on the Indian Peninsula. Geosci. Front. 2021, 12, 101079. [Google Scholar] [CrossRef]
  7. Wallis, I.; Prommer, H.; Berg, M.; Siade, A.J.; Sun, J.; Kipfer, R. The river-groundwater interface as a hotspot for arsenic release. Nat. Geosci. 2020, 13, 288–295. [Google Scholar] [CrossRef]
  8. Mazumder, P.; Sharma, S.K.; Taki, K.; Kalamdhad, A.S.; Kumar, M. Microbes involved in arsenic mobilization and respiration: A review on isolation, identification, isolates and implications. Environ. Geochem. Health 2020, 42, 3443–3469. [Google Scholar] [CrossRef]
  9. Lievremont, D.; Bertin, P.N.; Lett, M.C. Arsenic in contaminated waters: Biogeochemical, microbial metabolism and biotreatment processes. Biochimie 2009, 91, 1229–1237. [Google Scholar] [CrossRef]
  10. Asta, M.P.; Wang, Y.H.; Frutschi, M.; Viacava, K.; Loreggian, L.; Pape, P.L.; Vo, P.L.; Fernández, A.M.; Morin, G.; Bernier-Latmani, R. Microbially mediated release of As from Mekong delta peat Sediments. Environ. Sci. Technol. 2019, 53, 10208–10217. [Google Scholar] [CrossRef]
  11. Huq, E.; Fahad, S.; Shao, Z.F.; Sarven, M.S.; Khan, I.A.; Alam, M.; Saeed, M.; Ullah, H.; Adnan, M.; Saud, S.; et al. Arsenic in a groundwater environment in Bangladesh: Occurrence and mobilization. J. Environ. Manag. 2020, 262, 110318. [Google Scholar] [CrossRef]
  12. Masuda, H. Arsenic cycling in the Earth’s crust and hydrosphere: Interaction between naturally occurring arsenic and human activities. Prog. Earth Planet. Sci. 2018, 5, 68. [Google Scholar] [CrossRef]
  13. Kruger, M.C.; Bertin, P.N.; Heipieper, H.J.; Arsène-Ploetze, F. Bacterial metabolism of environmental arsenic—Mechanisms and biotechnological applications. Appl. Microbiol. Biotechnol. 2013, 97, 3827–3841. [Google Scholar] [CrossRef] [PubMed]
  14. Zeng, X.C.; Xu, Y.; Liu, Z.; Chen, X.; Wu, Y. Comparisons of four As(V)-respiring bacteria from contaminated aquifers: Activities to respire soluble As(V) and to reductively mobilize solid As(V). Water Res. 2022, 224, 119097. [Google Scholar] [CrossRef]
  15. Ohtsuka, T.; Yamaguchi, N.; Makino, T.; Sakurai, K. Arsenic dissolution from Japanese paddy soil by a dissimilatory arsenate-reducing bacterium Geobacter sp. OR-1. Environ. Sci. Technol. 2013, 47, 6263–6271. [Google Scholar] [CrossRef]
  16. Cai, X.; Wang, P.; Li, Z.; Li, Y.; Yin, N.; Du, H.; Cui, Y. Mobilization and transformation of arsenic from ternary complex OM-Fe(III)-As(V) in the presence of As(V)-reducing bacteria. J. Hazard. Mater. 2020, 381, 120975. [Google Scholar] [CrossRef] [PubMed]
  17. Shi, W.; Xu, Y.; Wu, W.; Zeng, X.C. Biological effect of phosphate on the dissimilatory arsenate-respiring bacteria-catalyzed reductive mobilization of arsenic from contaminated soils. Environ. Pollut. 2022, 308, 119698. [Google Scholar] [CrossRef] [PubMed]
  18. Shi, L.D.; Guo, T.; Lv, P.L.; Niu, Z.F.; Zhou, Y.J.; Tang, X.J.; Zheng, P.; Zhu, L.Z.; Zhu, Y.G.; Kappler, A.; et al. Coupled anaerobic methane oxidation and reductive arsenic mobilization in wetland soils. Nat. Geosci. 2020, 13, 799–805. [Google Scholar] [CrossRef]
  19. Wang, J.; Zeng, X.C.; Zhu, X.; Chen, X.; Zeng, X.; Mu, Y.; Yang, Y.; Wang, Y. Sulfate enhances the dissimilatory arsenate-respiring prokaryotes-mediated mobilization, reduction and release of insoluble arsenic and iron from the arsenic-rich sediments into groundwater. J. Hazard. Mater. 2017, 339, 409–417. [Google Scholar] [CrossRef]
  20. Wu, Y.; Wu, W.; Xu, Y.; Zuo, Y.; Zeng, X.C. Environmental Mn(II) enhances the activity of dissimilatory arsenate-respiring prokaryotes from arsenic-contaminated soils. J. Environ. Sci. 2023, 125, 582–592. [Google Scholar] [CrossRef]
  21. Darma, A.; Yang, J.; Bloem, E.; Mozdzen, K.; Zandi, P. Arsenic biotransformation and mobilization: The role of bacterial strains and other environmental variables. Environ. Sci. Pollut. Res. 2022, 29, 1763–1787. [Google Scholar] [CrossRef] [PubMed]
  22. Cai, X.; Zhang, Z.; Yin, N.; Lu, W.; Du, H.; Yang, M.; Cui, L.; Chen, S.; Cui, Y. Controlling microbial arsenite oxidation and mobilization in arsenite-adsorbed iron minerals: The Influence of pH conditions and mineralogical composition. J. Hazard. Mater. 2022, 433, 128778. [Google Scholar] [CrossRef]
  23. Xu, Y.; Shi, W.; Wu, W.; Zuo, Y.X.; Chen, X.M.; Zeng, X.C. Excessive bivalent manganese promotes the arsenate-respiring bacteria-mediated reduction and mobilization of arsenic from contaminated vegetable field soils. J. Soils Sediments 2022, 22, 3166–3175. [Google Scholar] [CrossRef]
  24. Horvath, A.S.; Garrick, L.V.; Moreau, J.W. Manganese-reducing Pseudomonas fluorescens-group bacteria control arsenic mobility in gold mining-contaminated groundwater. Environ. Earth Sci. 2014, 71, 4187–4198. [Google Scholar] [CrossRef]
  25. Zeiner, C.A.; Purvine, S.O.; Zink, E.; Wu, S.; Paša-Tolić, L.; Chaput, D.L.; Santelli, C.M.; Hansel, C.M. Mechanisms of Manganese(II) Oxidation by Filamentous Ascomycete Fungi Vary with Species and Time as a Function of Secretome Composition. Front. Microbiol. 2021, 12, 610497. [Google Scholar] [CrossRef] [PubMed]
  26. Kappler, A.; Bryce, C.; Mansor, M.; Lueder, U.; Byrne, J.M.; Swanner, E.D. An evolving view on biogeochemical cycling of iron. Nat. Rev. Microbiol. 2021, 19, 360–374. [Google Scholar] [CrossRef]
  27. Piazza, A.; Ciancio, L.; Pacini, V.A.; Sanguinetti, G.; Ottado, J.; Gottig, N. Environmental Bacteria Involved in Manganese(II) Oxidation and Removal From Groundwater. Front. Microbiol. 2019, 10, 119. [Google Scholar] [CrossRef] [Green Version]
  28. Sujith, P.P.; Bharathi, P.A. Manganese oxidation by bacteria: Biogeochemical aspects. Prog. Mol. Subcell. Biol. 2011, 52, 49–76. [Google Scholar]
  29. Sujith, P.P.; Mourya, B.S.; Krishnamurthi, S.; Meena, R.M.; Loka Bharathi, P.A. Mobilization of manganese by basalt associated Mn(II)-oxidizing bacteria from the Indian Ridge System. Chemosphere 2014, 95, 486–495. [Google Scholar] [CrossRef]
  30. Nitzsche, K.S.; Weigold, P.; Lösekann-Behrens, T.; Kappler, A.; Behrens, S. Microbial community composition of a household sand filter used for arsenic, iron, and manganese removal from groundwater in Vietnam. Chemosphere 2015, 138, 47–59. [Google Scholar] [CrossRef]
  31. Tani, Y.; Miyata, N.; Ohashi, M.; Ohnuki, T.; Seyama, H.; Iwahori, K.; Soma, M. Interaction of inorganic arsenic with biogenic manganese oxide produced by a Mn-oxidizing fungus, strain KR21-2. Environ. Sci. Technol. 2004, 38, 6618–6624. [Google Scholar] [CrossRef] [PubMed]
  32. Min, D.; Cheng, L.; Liu, J.Q.; Liu, D.F.; Li, W.W.; Yu, H.Q. Ligand-Assisted Formation of Soluble Mn(III) and Bixbyite-like Mn2O3 by Shewanella putrefaciens CN32. Environ. Sci. Technol. 2022, 56, 3812–3820. [Google Scholar] [CrossRef] [PubMed]
  33. Ng, I.S.; Chen, T.; Lin, R.; Zhang, X.; Ni, C.; Sun, D. Decolorization of textile azo dye and Congo red by an isolated strain of the dissimilatory manganese-reducing bacterium Shewanella xiamenensis BC01. Appl. Microbiol. Biotechnol. 2014, 98, 2297–2308. [Google Scholar] [CrossRef] [PubMed]
  34. Zhang, Z.; Xiao, C.; Adeyeye, O.; Yang, W.; Liang, X. Source and Mobilization Mechanism of Iron, Manganese and Arsenic in Groundwater of Shuangliao City, Northeast China. Water 2020, 12, 534. [Google Scholar] [CrossRef] [Green Version]
  35. Lopez-Adams, R.; Newsome, L.; Moore, K.L.; Lyon, I.C.; Lloyd, J.R. Dissimilatory Fe(III) Reduction Controls on Arsenic Mobilization: A Combined Biogeochemical and NanoSIMS Imaging Approach. Front. Microbiol. 2022, 12, 640734. [Google Scholar] [CrossRef]
  36. Tian, H.; Shi, Q.; Jing, C. Arsenic biotransformation in solid waste residue: Comparison of contributions from bacteria with arsenate and iron reducing pathways. Environ. Sci. Technol. 2015, 49, 2140–2146. [Google Scholar] [CrossRef]
  37. Jiang, S.; Lee, J.H.; Kim, D.; Kanaly, R.A.; Kim, M.G.; Hur, H.G. Differential arsenic mobilization from As-bearing ferrihydrite by iron-respiring Shewanella strains with different arsenic-reducing activities. Environ. Sci. Technol. 2013, 47, 8616–8623. [Google Scholar] [CrossRef]
  38. Zuo, R.; Pan, M.H.; Li, J.; Meng, L.; Yang, J.; Zhai, Y.Z.; Xue, Z.K.; Liu, J.W.; Shi, J.; Teng, Y.G. Biogeochemical transformation processes of iron, manganese, ammonium under coexisting conditions in groundwater based on experimental data. J. Hydrol. 2021, 603, 127120. [Google Scholar] [CrossRef]
  39. Zeng, X.C.; He, Z.; Chen, X.; Cao, Q.A.D.; Li, H.; Wang, Y. Effects of arsenic on the biofilm formations of arsenite-oxidizing bacteria. Ecotoxicol. Environ. Saf. 2018, 165, 1–10. [Google Scholar] [CrossRef]
  40. Li, H.; Zeng, X.C.; He, Z.; Chen, X.; Guoji, E.; Han, Y.; Wang, Y. Long-term performance of rapid oxidation of arsenite in simulated groundwater using a population of arsenite-oxidizing microorganisms in a bioreactor. Water Res. 2016, 101, 393–401. [Google Scholar] [CrossRef]
  41. Yang, Y.; Mu, Y.; Zeng, X.C.; Wu, W.; Yuan, J.; Liu, Y.; Guoji, E.; Luo, F.; Chen, X.; Li, H.; et al. Functional genes and thermophilic microorganisms responsible for arsenite oxidation from the shallow sediment of an untraversed hot spring outlet. Ecotoxicology 2017, 26, 490–501. [Google Scholar] [CrossRef] [PubMed]
  42. Chen, X.M.; Zeng, X.C.; Kawa, Y.K.; Wu, W.; Zhu, X.; Ullah, Z.; Wang, Y. Microbial reactions and environmental factors affecting the dissolution and release of arsenic in the severely contaminated soils under anaerobic or aerobic conditions. Ecotoxicol. Environ. Saf. 2020, 189, 109946. [Google Scholar] [CrossRef] [PubMed]
  43. Mu, Y.; Zhou, X.; Liu, L.; Zhou, X.K.; Zeng, X.C.; Li, W.J. Pseudaminobacter arsenicus sp. nov., an arsenic-resistant bacterium isolated from arsenic-rich aquifers. Int. J. Syst. Evol. Microbiol. 2019, 69, 791–797. [Google Scholar] [CrossRef] [PubMed]
  44. Kepel, B.; Bodhi, W.; Fatimawali; Tallei, T.E. Isolation and Identification of Arsenic-resistant Bacteria for Possible Application in Arsenic Bioremediation. Pak. J. Biol. Sci. 2020, 23, 63–67. [Google Scholar] [CrossRef] [Green Version]
  45. Andrews, J.M. Determination of minimum inhibitory concentrations. J. Antimicrob. Chemother. 2001, 48 (Suppl. S1), 5–16. [Google Scholar] [CrossRef] [Green Version]
  46. Zeng, X.C.; Xu, Y.; He, Z.; Wang, Y.; Chen, X. A powerful arsenite-oxidizing biofilm bioreactor derived from a single chemoautotrophic bacterial strain: Bioreactor construction, long-term operations and kinetic analysis. Chemosphere 2021, 273, 129672. [Google Scholar] [CrossRef]
  47. Zhao, X.X.; Xie, Z.M.; Li, P.; Chen, M.N.; Zhong, Z.Q. A newly isolated indigenous metal-reducing bacterium induced Fe and Mn oxides synergy for enhanced in situ As(III/V) immobilization in groundwater. J. Hydrol. 2022, 608, 127635. [Google Scholar] [CrossRef]
  48. Jain, N.; Maiti, A. Fe-Mn-Al metal oxides/oxyhydroxides as As(III) oxidant under visible light and adsorption of total arsenic in the groundwater environment. Sep. Purif. Technol. 2022, 302, 122170. [Google Scholar] [CrossRef]
  49. Ma, L.; Cai, D.M.; Tu, S.X. Arsenite simultaneous sorption and oxidation by natural ferruginous manganese ores with various ratios of Mn/Fe. Chem. Eng. J. 2020, 382, 123040. [Google Scholar] [CrossRef]
  50. Fendorf, S.; Michael, H.A.; Geen, A.V. Spatial and temporal variations of groundwater arsenic in South and Southeast Asia. Science 2010, 328, 1123–1127. [Google Scholar] [CrossRef] [Green Version]
  51. DeVore, C.L.; Rodriguez-Freire, L.; Villa, N.; Soleimanifar, M.; Gonzalez-Estrella, J.; Ali, A.M.S.; Lezama-Pacheco, J.; Ducheneaux, C.; Cerrato, J.M. Mobilization of As, Fe, and Mn from Contaminated Sediment in Aerobic and Anaerobic Conditions: Chemical or Microbiological Triggers? ACS Earth Space Chem. 2022, 6, 1644–1654. [Google Scholar] [CrossRef] [PubMed]
  52. Zhang, G.S.; Liu, F.D.; Liu, H.J.; Qu, J.H.; Liu, R.P. Respective Role of Fe and Mn Oxide Contents for Arsenic Sorption in Iron and Manganese Binary Oxide: An X-ray Absorption Spectroscopy Investigation. Environ. Sci. Technol. 2014, 48, 10316–10322. [Google Scholar] [CrossRef]
  53. Wang, X.; Xie, G.J.; Tian, N.; Dang, C.C.; Cai, C.; Ding, J.; Liu, B.F.; Xing, D.F.; Ren, N.Q.; Wang, Q. Anaerobic microbial manganese oxidation and reduction: A critical review. Sci. Total Environ. 2022, 822, 153513. [Google Scholar] [CrossRef]
  54. Duffy, B.K.; Défago, G. Controlling instability in gacS-gacA regulatory genes during inoculant production of Pseudomonas fluorescens biocontrol strains. Appl. Environ. Microbiol. 2000, 66, 3142–3150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Kawa, Y.K.; Wang, J.; Chen, X.; Zhu, X.; Zeng, X.C.; Wang, Y. Reductive dissolution and release of arsenic from arsenopyrite by a novel arsenate-respiring bacterium from the arsenic-contaminated soils. Int. Biodeter. Biodegr. 2019, 143, 104712. [Google Scholar] [CrossRef]
Water 15 02337 g001 550
Figure 1. Photograph of the sampling site.
Figure 1. Photograph of the sampling site.
Water 15 02337 g001
Water 15 02337 g002 550
Figure 2. Mn(IV)-reducing activities (a) and structures (b) of microbial communities from Mn-contaminated soil amended with 0.5 g/L of yeast extract as electron donor under anaerobic conditions.
Figure 2. Mn(IV)-reducing activities (a) and structures (b) of microbial communities from Mn-contaminated soil amended with 0.5 g/L of yeast extract as electron donor under anaerobic conditions.
Water 15 02337 g002
Water 15 02337 g003 550
Figure 3. Phylogenetic tree of the 16S rRNA gene of a novel arsenic-resistant bacterium CM1.
Figure 3. Phylogenetic tree of the 16S rRNA gene of a novel arsenic-resistant bacterium CM1.
Water 15 02337 g003
Water 15 02337 g004 550
Figure 4. Mn(IV)-(a) and Fe(III)-(b) reducing activities and its growth curves of a novel cultivable ARB strain Cellulomonas sp. CM1 with the supplement of 1 g/L of yeast extract as electron donor under anaerobic conditions.
Figure 4. Mn(IV)-(a) and Fe(III)-(b) reducing activities and its growth curves of a novel cultivable ARB strain Cellulomonas sp. CM1 with the supplement of 1 g/L of yeast extract as electron donor under anaerobic conditions.
Water 15 02337 g004
Water 15 02337 g005 550
Figure 5. Arsenic mobilization and release mediated by Cellulomonas sp. CM1 from general vegetable field soils S1 (a), S2 (b) and S3 (c) under anaerobic conditions.
Figure 5. Arsenic mobilization and release mediated by Cellulomonas sp. CM1 from general vegetable field soils S1 (a), S2 (b) and S3 (c) under anaerobic conditions.
Water 15 02337 g005
Table
Table 1. The content of Mn and arsenic of the Mn-contaminated soil from Xiangtan.
Table 1. The content of Mn and arsenic of the Mn-contaminated soil from Xiangtan.
ParametersSampling Site MS
Mn (mg/kg)1349.31
As (mg/kg)48.29
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xiong, J.; Xu, Y.; Li, Y.; Zeng, X.-C. A Novel Mn- and Fe-Oxides-Reducing Bacterium with High Activity to Drive Mobilization and Release of Arsenic from Soils. Water 2023, 15, 2337. https://doi.org/10.3390/w15132337

AMA Style

Xiong J, Xu Y, Li Y, Zeng X-C. A Novel Mn- and Fe-Oxides-Reducing Bacterium with High Activity to Drive Mobilization and Release of Arsenic from Soils. Water. 2023; 15(13):2337. https://doi.org/10.3390/w15132337

Chicago/Turabian Style

Xiong, Jianyu, Yifan Xu, Yang Li, and Xian-Chun Zeng. 2023. "A Novel Mn- and Fe-Oxides-Reducing Bacterium with High Activity to Drive Mobilization and Release of Arsenic from Soils" Water 15, no. 13: 2337. https://doi.org/10.3390/w15132337

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop