Characterization of a Moderately Halotolerant Antimony-Removing Desulfovibrio sp. Strain Isolated from Landfill Leachate

Abstract

Antimony (Sb) is a harmful contaminant posing a risk to the environment and human health. Antimony-containing industrial wastewater often contains sulfate; therefore, it is suitable to apply sulfate-reducing bacteria (SRB) to remove Sb from such water. SRB anaerobically reduce sulfate to sulfide. Sb(V) is then reduced to Sb(III) by sulfide to produce an antimony trisulfide (Sb₂S₃) precipitate. This wastewater often exhibits a high salinity, which inhibits biological reactions. This study aimed to isolate and characterize a halotolerant bacterium capable of removing Sb from wastewater. A Desulfovibrio sp. strain was isolated from a mixed bacterial culture derived from a leachate sample from the Nam Son landfill in Vietnam. The isolated strain, NSLLH1b, removed 86% of the 50 mg/L of Sb(V) in 3 days at 180 mg/L of sulfate and 360 mg-C/L of lactate, at a pH of 7.0 and at 28 °C. It anaerobically removed >80% of the Sb(V) at 12.5–100 mg/L in 14 days at initial concentrations of >100 mg/L of sulfate, >250 mg-CL of lactate, and 0.2–15 g/L of NaCl, and a pH of 5–8, resulting in orange precipitation. An analysis using scanning electron microscopy–energy-dispersive X-ray spectroscopy confirmed that the precipitation consisted mainly of Sb and sulfur, supposedly as Sb₂S₃. This moderately halotolerant bacterium can be used for simultaneously removing Sb and sulfate from wastewater.

1. Introduction

Antimony (Sb) is a serious problem in the world [1,2]. Antimony is a toxic metalloid with a similar toxicity and similar chemical properties to arsenic [3]. It can also interfere with enzymatic functions to break the ion balance in cells, leading to rashes, myalgia, and cancer risks [3]. The United States Environmental Protection Agency (USEPA), European Union (EU), and World Health Organization (WHO) recommend that the maximum allowable Sb concentration in drinking water should be lower than 6 μg/L [4], 5 μg/L [5], and 5 μg/L [6], respectively. Vietnam also set a standard for natural mineral water and bottled drinking water, stating that the elevated Sb level should be kept at less than 5 μg/L [7].

Antimony is widely used in industries that manufacture textiles, flame retardants, therapeutic agents, glue, tires, and batteries. Landfills where these industrial products are disposed sometimes generate leachates with high Sb concentrations [8,9]. In addition, mine waste releases Sb into the soil and rivers [10,11,12]. These industries discharge wastewater containing high concentrations of Sb, posing a risk to the environment and human health [1,2]. Antimonates (Sb(V)) and antimonites (Sb(III)) are the most common soluble forms of Sb in wastewater.

For preventing the contamination of water sources, several methods are used to remove Sb from wastewater, including coagulation, flocculation, electrodeposition, adsorption, membrane separation, and ion exchange [2]. However, these physicochemical methods entail high costs. Biological treatment is a low-cost and ecofriendly alternative for Sb removal. Sulfate-reducing bacteria (SRB) have received attention for their potential use in biological Sb removal [10,11,12,13,14,15,16,17,18,19,20]. SRB oxidize organic compounds by reducing sulfate to sulfide under anaerobic conditions. Subsequently, Sb(V) can be chemically reduced to Sb(III) by the sulfide formed, producing an antimony trisulfide (Sb₂S₃) precipitate. Under aerobic conditions, Sb₂S₃ is oxidized to antimony trioxide (Sb₂O₃) as a subproduct [17]. Cupidesulfovibrio sp. SRB49 was unable to enzymatically reduce Sb(V) to Sb(III), but was able to remove 95% of the Sb(V) at a concentration of 100 mg/L at an initial sulfate concentration of 400 mg/L over 2 days [18]. Desulfovibrio vulgaris Hildenborough reduced >82% of the Sb(V) to Sb(III) at a concentration of 24–365 mg/L at an initial sulfate concentration of 4900 mg/L over five days [19]. The extracellular proteins of D. vulgaris enable the fixing of Sb(V) to the cell surface via electrostatic absorption and chelation, generating amorphous Sb₂S₃ or Sb₂O₃ [19].

Sb-containing wastewater often contains sulfate; therefore, it is suitable to apply SRB to remove the Sb from it. This wastewater often exhibits a high salinity, which can inhibit biological reactions. Textile wastewater contains 0.8 mg/L of Sb, 5200 mg/L of sulfate, and 1.07 g/L of chloride [21]. The sludge leachate generated from printing and dyeing wastewater treatment processes contains 12–26 mg/L of Sb and 1.8–3.7 g/L of total salt [22]. Mining wastewater is characterized by high concentrations of sulfate, chloride, and dissolved metals [10,11]. Sb ore wastewater in China contains up to 86 mg/L of Sb, 1070 mg/L of sulfate, and various other metals [11]. Landfill leachate is characterized by high concentrations of total dissolved solids (TDS), including sulfates and metals. Leachate samples from US landfills contain 0.035–0.090 mg/L of Sb and 21–81 g/L of TDS [9].

However, few studies have described the effects of salinity on the Sb removal by SRB. Therefore, the potential of bacteria to remove Sb at high salt concentrations must be explored. The aim of this study was to isolate and characterize a halotolerant bacterium capable of removing Sb from wastewater. (i) SRB were enriched and isolated from a landfill leachate sample obtained from Hanoi, Vietnam. (ii) The bacterial Sb removal capabilities were characterized at various pH levels, salinities, and sulfate and Sb concentrations.

2. Materials and Methods

2.1. Media

The basal salt medium (BSM) used for this study contained 0.1 g of KH₂PO₄, 0.1 g of K₂HPO₄, 0.48 g of NH₄Cl, 0.2 g of NaCl, 0.48 g of MgSO₄·7H₂O, 1.2 mg of H₃BO₃, 0.34 mg of CoCl₂·6H₂O, 0.18 mg of CuCl₂·2H₂O, 0.2 mg of MnCl₂·4H₂O, 0.44 mg of ZnCl₂, 0.4 mg of CaCl₂·2H₂O, and 1 mmol of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) in 1 L of ultrapure water. All reagents were purchased from Fujifilm Wako Pure Chemical Corp. (Osaka, Japan). BSM containing 50 mg-Sb/L of K[Sb(OH)₆] and 72 mg-C/L (2 mM) or 360 mg-C/L (10 mM) of sodium lactate as the sole carbon source was abbreviated as L-Sb-BSM. The pH of the L-Sb-BSM was adjusted to 7.0 ± 0.1. For agar plate preparation, 15 g/L of agar was added to the L-Sb-BSM. R2A agar medium (Nihon Pharmaceutical Co., Ltd., Tokyo, Japan) was used to enumerate heterotrophic bacteria.

2.2. Enrichment of Sb-Removing Bacteria from Landfill Leachate

A leachate sample was collected from a leachate collection pond in the Nam Son landfill [23,24], Hanoi, Vietnam, in August 2017. The TDS, sulfate concentration, and Sb concentration in the leachate samples were 7520, 74.7, and 2.5 mg/L, respectively. The viable count of heterotrophic bacteria was 10³–10⁴ CFU/mL on the R2A agar plates.

For the enrichment culture, 50 mg of the leachate sludge sample was added to 50 mL of L-Sb-BSM in a 50 mL serum vial. The vial was sealed with butyl rubber septa and aluminum caps. The vial headspace was purged with N₂ for 30 min to create anaerobic conditions. The vial was incubated on a orbital shaker at 100 rpm at 28 °C. After 7 or 14 d, 5 mL of the culture was transferred to 45 mL of fresh medium. This procedure was repeated to enrich the target bacteria. The lactate concentration in the L-Sb-BSM was 2 mM in the first to the eighth enrichment cultures and 10 mM in the ninth through the thirteenth enrichment cultures. During cultivation, 1 mL of each culture was periodically sampled to measure the soluble Sb and sulfate concentrations.

2.3. Isolation of Antimony-Removing Bacteria

To isolate the Sb-removing bacterium, a small amount of the enriched culture was spread onto L-Sb-BSM plates. An amount of 100 µL of enrichment culture after the 7th batch cycle was speared on L-Sb-BSM agar plates and cultivated at 28 °C in anaerobic chambers (Anero Pack Kenki, Mitsubishi Gas Chemical, Tokyo, Japan). After 2 weeks of incubation, a colony with an intense orange color of antimony trisulfide on the agar plate was repeatedly spread on agar plates, isolated, and designated as NSLLH1b.

2.4. Sb Removal Tests

Strain NSLLH1b was routinely grown in L-Sb-BSM. The pH of the medium was adjusted to 7.0 ± 0.1. NSLLH1b was grown at varying initial pH levels, salinities, and Sb(V) and sulfate concentrations. Under basic conditions, the vials were anaerobically sealed with a butyl rubber septa and aluminum caps, and the head space was purged with N₂ gas for 30 min. Cell growth was measured as the optical density at 660 nm (OD₆₆₀), and the concentrations of sulfate and soluble Sb were measured after 7 and 14 days of incubation. All experiments were conducted in triplicate for 14 days.

2.5. Phylogenetic Characterization of Bacteria

An analysis of the composition of the bacterial community in the leachate and enrichment culture was outsourced to Bioengineering Lab. Co., Ltd. (Sagamihara, Japan). A next-generation sequencing (NGS) analysis of the V3–V4 regions of the 16S rRNA gene was performed using the paired-end method. Amplicon libraries were prepared using two-step tailed PCR. The first PCR was performed using the primers 341f (5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCT–NNNNN–CCTACGGGNGGCWGCAG-3′) and 805r (5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT–NNNNN–GACTACHVGGGTATCTAATCC-3′); the second PCR was performed using the first PCR products and the primers 2ndF (5′-AATGATACGGCGACCACCGAGATCTAC AC -Index2- ACACTCTTTCCCTACACGACG C-3′) and 2ndR (5′-CAAGCAGAAGACGGCATACGAGAT -Index1- GTGACTGGAGTTCAGACGTGT G-3′). Amplicon sequencing of the second PCR products was performed using paired-ends (2 × 300 bp) on an Illumina MiSeq platform (San Diego Instruments Inc., San Diego, CA, USA). The sequencing data were analyzed using software (QIIME2, ver. 2019.01) [25]. The primers were trimmed and the data were filtered and truncated using Dada2 to allow a 20 bp overlap between the forward and reverse reads. Possible chimeric sequences were identified and removed before the amplicon sequence variants were assigned (MiDAS database ver. 2.1.3) [26]. Shannon index H′ was calculated as described previously [27].

The sequencing of the 16S rRNA gene of the isolated strain was outsourced to Bioengineering Lab. Co., Ltd. (Sagamihara, Japan). Briefly, genomic DNA was extracted using an MPure Bacterial DNA Extraction Kit (MP Bio Japan K. K., Tokyo, Japan). The V4 region of the 16S rRNA gene was amplified using two-step PCR. The first PCR was performed using the primers 1st-9F (5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTGAGTTTGATCCTGGCTCAG-3′) and 1st-536R (5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTATTACCGCGGCTGCTG-3′) [28]. The second PCR was performed using the primers 2ndF and 2ndR. The 16S rRNA gene sequences were compared to reference sequences obtained through BLAST similarity searches (BLASTN ver. 2.12.0).

2.6. Chemical Analysis

After the landfill leachate sample was centrifuged at 3000 rpm for 10 min, it was filtered through a membrane filter (0.45 µm pore size, Merck Millipore, Darmstadt, Germany). The filtrate was digested, as described previously [23]. The digested samples were filtered using a 0.45 µm filter for an elemental analysis using inductively coupled plasma optical emission spectrometry (ICP-OES 700 series; Agilent Technologies Japan, Ltd., Tokyo, Japan).

The pH value was measured using a portable pH meter (F-21; Horiba Ltd., Kyoto, Japan). The total soluble Sb concentration was measured using ICP-OES. The antimonate and sulfate concentrations were measured using an HIC SP ion chromatography system (liquid pump, LC-20AD sp.; autosampler, SIL-10Ai; conductivity detector, CDD-10A sp.; oven, CTO-20AC sp.; cation column, Shim; anion column, Shim-pack IC-SA2; Shimadzu Corp., Kyoto, Japan). A mixture of 0.9 mM Na₂CO₃ and 1.7 mM NaHCO₃ was used as the mobile phase. The antimonite concentration was determined indirectly by subtracting the antimonate concentration from the total soluble antimony concentration.

For the analysis of the precipitates, washed cells of strain NLLLH1b were inoculated into 50 mL of L-Sb-BSM in a vial at an initial OD₆₆₀ of 0.05 and cultivated anaerobically for 14 days. The culture was centrifuged (3000× g, 24 °C, 10 min); the precipitate was rinsed with ultrapure water, followed by washing with 100% acetone, and then rinsing again with ultrapure water. After removing the supernatant, the precipitate was dried at 105 °C and stored in a desiccator until further use. The precipitated samples were analyzed using scanning electron microscopy–energy-dispersive X-ray spectroscopy (SEM-EDX, Flex SEM 1000II; Hitachi High-Technologies Corp., Tokyo, Japan) at the Industrial Research Center of Shiga, Shiga, Japan.

3. Results

3.1. Enrichment of Sb-Removing Bacteria from Landfill Leachate

The time course of the total soluble Sb and sulfate concentrations and the OD₆₆₀ of the enrichment culture derived from the landfill leachate samples are shown in Figure 1. In the first batch cultivation with 72 mg-C/L of lactate, the concentrations of sulfate and soluble Sb decreased from 260 mg/L to 220 mg/L and 61.7 mg/L to 22.9 mg/L (Sb removal: 63%), respectively, with an increase in the OD₆₆₀ from 0.03 to 0.36, in 7 days. This cultivation was repeated seven times; the enrichment culture removed 33–71% of the soluble Sb. The sulfate concentration decreased slightly in the first–seventh batches of cultivation, with 3–35% removal. The Sb removal was only 36% in the eighth cultivation for 14 days. The color of these cultures gradually changed to orange, indicating the formation of insoluble antimony trisulfide. Therefore, the lactate concentration of the medium was increased to 360 mg-C/L during the 9th–13th cultivations for further bacterial enrichment. From the ninth cultivation, the sulfate concentration reduced from 160–180 mg/L to 26–71 mg/L over 14 days in each cultivation, corresponding to 60–84% removal. The OD₆₆₀ value increased up to 0.52–1.41. The Sb removal markedly increased up to 82–97%. The Sb removal over 14 days was 82–97% by the increased lactate concentration.

3.2. Microbial Community Composition in Enrichment Culture

Figure 2 shows the microbial community composition at the phylum and genus levels in the landfill leachate sample and in the enrichment culture on day 77. At the phylum level, the dominant bacteria in the leachate sample were Proteobacteria (28.3%), Firmicutes (23.1%), Bacteroidetes (18.3%), and Actinobacteria (11.9%), with a high diversity of H′ = 1.96, while those in the enriched culture were Proteobacteria (89.3%) and Firmicutes (9.4%), with a low diversity of H′ = 0.39 (Figure 2A). At the genus level, the dominant bacteria in the leachate sample were an unclassified Gammaproteobacteria (9.8%), Clostridium (8.93%), and an unclassified Bacteroidales (6.9%), with a high diversity of H′ = 3.91, while those in the enriched culture were Pseudomonas (61.5%), an unclassified Desulfovibrionaceae (21.3%), and Desulfovibrio (2.7%), with a low diversity of H′ = 1.25 (Figure 2B).

3.3. Isolation of an Sb-Removing Bacterium from Enrichment Culture

Some colonies formed anaerobically on the L-Sb-BSM plates from the enrichment culture. The colonies and their surrounding areas on the plates turned orange-yellow after 7 days (Supplementary Figure S1). The color of the medium changed from orange to yellow to deep orange as the incubation time was extended to 14 days, suggesting that Sb₂S₃ was formed both inside and outside the cells. Although some colonies were lost in repeated cultivation on the agar plate, a typical orange-yellow colony was isolated and designated as NSLLH1b. The partial 16S rRNA gene sequence of the isolated strain was deposited in the GenBank/EMBL/DDBJ databases under the accession number LC760036. The partial DNA sequence of NSLLH1b showed a high homology (100%) to the sequences from Desulfovibrio spp. (accession Nos. LR738849, FJ823928, and FJ823945).

3.4. Removal of Sb and Sulfate by NSLLH1b and the Resulting Precipitates

The typical time courses of soluble Sb species and sulfate concentrations in a pure culture of NSLLH1b with an initial lactate concentration of 360 mg-C/L are shown in Figure 3. The sulfate concentration decreased from 175 to 10 mg/L over 3 days, indicating the rapid assimilation and dissimilation of sulfate. The sulfide concentration in the culture peaked at 4.5 mg/L at 2 days, then decreased to below 0.5 mg/L in 3 days. The Sb(V) concentration decreased from 48 to 3 mg/L over 3 days. The Sb(III) concentration peaked at 17 mg/L after 2 days and then decreased to 4.4 mg/L after 3 days. For these 3 days, the removed molar ratio of S/Sb was 4.66. The total soluble Sb removal from the pure culture of NSLLH1b was over 98% in 7–14 days.

Orange precipitates were obtained from the cultures of NSLLH1b. SEM images of the precipitates and cells of NSLLH1 after 14 days of cultivation in L-Sb-BSM are shown in Figure 4. The precipitates consisted mainly of small particles of 5.8–10 nm in size and rod-shaped bacterial cells of 1 × 0.5 µm dimensions. The molar ratio of C:O:S:Sb was 55.8:21.0:10.7:7.3 for the cell surface (S/Sb = 1.47) and 43.9:36.1:6.8:4.3 for a particle (S/Sb = 1.58); this corresponds to a S/Sb ratio of 1.50 for Sb₂S₃.

3.5. Factors Affecting Sb(V) Removal by NSLLH1b

The effects of the initial concentrations of lactate, sulfate, and Sb(V) on the removal of soluble Sb and sulfate during the 14-day cultivation of NSLLH1b are summarized in Figure 5. With an increase in the initial lactate concentration from 72 mg-C/L to 252 mg-C/L, the removal of soluble Sb and sulfate increased from 15% to 97% and from 13% to 91%, respectively (Figure 5A). With an initial sulfate concentration of 15–240 mg/L, the sulfate removal by the strain was over 98%. However, it decreased to 74% at an initial sulfate concentration of 410 mg/L (Figure 5B). The Sb removal was 32% at an initial sulfate concentration of 15 mg/L, but it was over 95% at an initial sulfate concentration of 85–410 mg/L. With an initial Sb(V) concentration of 12.5–100 mg/L, the Sb removal was over 92%. However, it decreased to 60% at an initial Sb concentration of 200 mg/L. This strain removed >89% of the sulfate at an Sb(V) concentration of 12.5–200 mg/L, but it removed only 70% of the sulfate in the absence of Sb(V) (Figure 5C).

The Sb removal by strain NSLLH1b was evaluated under various pH values and salinities (Figure 6). Strain NSLLH1b enabled a sulfate removal of over 94% at a pH of 5–8, and the Sb removal was over 98% at a pH of 5–7. However, the removal of both Sb and sulfate decreased to 20–40% at pH values of 4 and 9 (Figure 6A). The sulfate removal by strain NSLLH1b was over 90% at a NaCl concentration of 0.2–15 g/L, but was only 34% at 20 g/L of NaCl and 24% at 30 g/L of NaCl. The Sb(V) removal was stable at 91–98% in the presence of up to 15 g/L of NaCl; however, it declined to 40% at 30 g/L of NaCl (Figure 6B).

4. Discussion

This study aimed to isolate and characterize a halotolerant sulfate-reducing bacterium capable of removing Sb from wastewater. The landfill leachate in Hanoi is characterized by high concentrations of sulfate and metals and an elevated salinity, making it a suitable bacterial source for this study. The mixed bacterial culture in this study removed 82–97% of the Sb(V) at 50–60 mg/L over 14 days (Figure 1). With repeated enrichment procedures, the bacterial community was simplified and was occupied by selected bacteria, including SRB such as Desulfovibrio spp. and an unclassified Desulfovibrionaceae (Figure 2). Although the interactions of antimony and the other dominant species in the enrichment culture are unknown, it is known that some bacteria have antimony-resistant activities, such as inhibiting its entrance into the cell, promoting its active extrusion from the cell if it gains entry, or achieving its sequestration in a nontoxic form within the cell [29].

The isolated strain, Desulfovibrio sp. NSLLH1b, was a member of the enriched culture (Figure 2) and successfully removed 86% of the Sb(V) at 50 mg/L over 3 days under basic conditions (180 mg/L of sulfate, 360 mg-C/L of lactate, a pH of 7.0, and 28 °C) (Figure 3). Desulfovibrio sp. NSLLH1b reduced sulfate, an electron acceptor, to sulfide using lactate as the electron donor and carbon source. Sb(V) was reduced to Sb(III) by the sulfide released from the cells, and then both Sb(V) and Sb(III) reacted with sulfide to precipitate Sb₂S₃ (Figure 3 and Figure 4). If a typical reaction is supposed as in Equations (1)–(3) [16], 180 mg/L (=1.88 mM) of sulfate needs 135 mg-C/L (3.75 mM) of lactate for the complete reaction, and possibly precipitates with 151 mg/L (=1.25 mM) of Sb at most as Sb₂S₃. A typical yield of Desulfovibrio sp. on lactate is 0.11 g-biomass/g-C (3.9 g/mol) [30].

$$2{\mathrm{CH}}_3\mathrm{CH}\left(\mathrm{OH}\right){\mathrm{COO}}^{-}+{{\mathrm{SO}}_4}^{2-}\to 2{\mathrm{CH}}_3{\mathrm{COO}}^{-}+2{{\mathrm{HCO}}_3}^{-}+{\mathrm{HS}}^{-}+{\mathrm{H}}^{+}$$

(1)

$$2\mathrm{Sb}{{\left(\mathrm{OH}\right)}_6}^{-}+6{\mathrm{HS}}^{-}+6{\mathrm{H}}^{+}\to {\mathrm{Sb}}_2{{\mathrm{S}}_4}^{2-}+2\mathrm{S}+12{\mathrm{H}}_2\mathrm{S}$$

(2)

$${\mathrm{Sb}}_2{{\mathrm{S}}_4}^{2-}+{\mathrm{H}}^{+}\to {\mathrm{Sb}}_2{\mathrm{S}}_3+{\mathrm{HS}}^{-}$$

(3)

This hypothetical stoichiometry is supported by the experimental results. Lactate at an initial concentration of 72 mg-C/L and 180 mg-C/L was the rate-limiting factor in the removal of sulfate and Sb by strain NSLLH1b (Figure 5A). Based on the stoichiometry, the sulfate removal at an initial concentration of 410 mg/L would increase to nearly 100% if the cultivation period was extended over 14 days (Figure 5B). On the other hand, the Sb removal at the initial concentration of 200 mg/L should be 75.5% at the maximum because of a lack of sulfide (Figure 5C).

The Sb removal ability of strain NSLLH1b was comparable to that of Cupidesulfovibrio sp. SRB49 [13] and D. vulgaris Hildenborough [14], as described in the Introduction. However, the potential of the previously reported SRB for Sb removal at high salinities has not been explored. In this study, strain NSLLH1b was moderately halotolerant up to 15 g/L of NaCl (Figure 6). Strain NSLLH1b can be used for the anaerobic treatment of Sb-containing wastewater with a moderate salinity and pH if electron donors (carbon sources) and nutrients are supplied for its growth.

Recently, rivers near the Mau Due mine in North Vietnam have shown an elevated level of Sb in the range of 16.6–23.5 mg/L [12]. A discharge standard for Sb from industries has not been established in Vietnam; however, the standard is 0.1 mg/L for the total Sb in dyeing and finishing wastewater from the textile industry in China [31]. If the pollution becomes more severe, Sb discharging standards for Vietnam, on par with those in China, will be required for environmental protection. Such wastewater often contains various chemicals inhibitory to microorganisms. Conventional physicochemical processes [2] can be used to remove such toxic chemicals as a pretreatment and to reduce the discharge concentration of Sb into the aquatic environment as a post-treatment for biological treatments. Sb has become increasingly critical because of the surge in the industrial demand [32]. The precipitate containing Sb₂S₃, formed by strain NSLLH1b, can be recycled and processed into metal antimony and antimony oxide for industrial use. Biological processes that use SRB to remove Sb from water are promising for a sustainable metal industry.

5. Conclusions

Antimony was removed with an efficiency of 82–97% of the Sb(V) at 50–60 mg/L over 14 days in the mixed bacterial culture derived from Nam Son landfill leachate in Vietnam. Desulfovibrio spp. and an unclassified Desulfovibrionaceae as sulfate-reducing genera were detected in the mixed bacterial culture. As a moderately halotolerant strain, Desulfovibrio sp. NSLLH1b was successfully isolated from the bacterial culture, and could efficiently reduce antimonate through sulfide production. Strain NSLLH1b removed >80% of the Sb(V) of 12.5–100 mg/L in 14 days at initial concentrations of >100 mg/L of sulfate, >252 mg-C/L of lactate, and 0.2–15 g/L of NaCl, and a pH of 5–8. The soluble Sb was removed from the aqueous phase as a result of the formation of antimony trisulfide (Sb₂S₃) precipitate. This bacterium is considered to be used properly for the treatment of Sb-containing wastewater with a moderate salinity and pH value if electron donors (carbon sources) and nutrients are supplied for its growth.