Genetic Diversity and Population Dynamics of Invasive Ascidiella aspersa: Insights from Cytochrome Oxidase Subunit I and 18S rDNA Analyses in Korean and Global Populations
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.1.1. Korean Coast Population
2.1.2. Global Population
2.2. DNA Extraction, PCR Amplification, and Sequence Alignment
2.3. Phylogenetic Analyses and Genetic Diversity
3. Results
3.1. Genetic Diversity and Population Structure of A. aspersa
3.1.1. mt-COI
3.1.2. 18S-rDNA
3.2. Neutrality Tests and Mismatch Distribution Analysis
3.2.1. mt-COI
3.2.2. 18S-rDNA
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Bulleri, F.; Chapman, M.G. The introduction of coastal infrastructure as a driver of change in marine environments. J. Appl. Ecol. 2010, 47, 26–35. [Google Scholar] [CrossRef]
- Dumont, C.P.; Harris, L.G.; Gaymer, C.F. Anthropogenic structures as a spatial refuge from predation for the invasive bryozoan Bugula neritina. Mar. Ecol. Prog. Ser. 2011, 427, 95–103. [Google Scholar] [CrossRef]
- Dufresnes, C.; Déjean, T.; Zumbach, S.; Schmidt, B.R.; Fumagalli, L.; Ramseier, P.; Dubey, S. Early detection and spatial monitoring of an emerging biological invasion by population genetics and environmental DNA metabarcoding. Conserv. Sci. Pract. 2019, 1, e86. [Google Scholar] [CrossRef]
- Sams, M.A.; Keough, M.J. Predation during early post-settlement varies in importance for shaping marine sessile communities. Mar. Ecol. Prog. Ser. 2007, 348, 85–101. [Google Scholar] [CrossRef]
- Gittenberger, A.; van Stelt, R.C. Artificial structures in harbors and their associated ascidian fauna. Aquat. Invasions 2011, 6, 413–420. [Google Scholar] [CrossRef]
- López-Legentil, S.; Legentil, M.L.; Erwin, P.M.; Turon, X. Harbor networks as introduction gateways: Contrasting distribution patterns of native and introduced ascidians. Biol. Invasions 2015, 17, 1623–1638. [Google Scholar] [CrossRef]
- Kim, D.; Kim, M.K.; Park, J.; Kim, D.G.; Yoon, T.J.; Shin, S. Effects of Temperature and Salinity on Egg Development of Ascidiella aspersa (Ascidiacea, Phlebobranchia, Ascidiidae). Korean J. Environ. Biol. 2018, 36, 232–240. [Google Scholar] [CrossRef]
- Lynch, S.A.; Darmody, G.; O’Dwyer, K.; Gallagher, M.C.; Nolan, S.; McAllen, R.; Culloty, S.C. Biology of the invasive ascidian Ascidiella aspersa in its native habitat: Reproductive patterns and parasite load. Estuar. Coast. Shelf Sci. 2016, 181, 249–255. [Google Scholar] [CrossRef]
- Berrill, N.J. The identification and validity of certain species of ascidians. J. Mar. Biol. Assoc. United Kingd. 1928, 15, 159–175. [Google Scholar] [CrossRef]
- Berrill, N.J. The Tunicata: With an Account of the British Species; The University of Virginia, Ray Soc.: Charlottesville, VA, USA, 1950; no. 133; pp. 1–354. [Google Scholar]
- Thompson, H. The Tunicata of Scottish Area (Dictiobranchiata); H.M. Stationery Off.: London, UK, 1933. [Google Scholar]
- Millar, R. Tunicata Ascidiacea (Marine Invertebrates of Scandinavia no. 1); Universitetsforlaget: Oslo, Norway, 1966. [Google Scholar]
- Millar, R.H. British Ascidians, Tunicata: Ascidiacea; Keys and Notes for the Identification of the Species. In Synopses of the British Fauna; New Series; Academic Press for the Linnean Society of London: London, UK, 1970. [Google Scholar]
- Hewitt, C.L.; Campbell, M.L.; Thresher, R.E.; Martin, R.B.; Boyd, S.; Cohen, B.F.; Currie, D.R.; Gomon, M.F.; Keough, M.J.; Lewis, J.A. Introduced and cryptogenic species in port Phillip bay, Victoria, Australia. Mar. Biol. 2004, 144, 183–202. [Google Scholar]
- Tatián, M.; Schwindt, E.; Lagger, C.F.; Varela, M.d.L.M. Colonization of Patagonian harbours (SW Atlantic) by an invasive sea squirt. Spixiana 2010, 333, 111–117. [Google Scholar]
- Lazari, C.; del Socorro Doldan, M.; Carignano, A.; Orrego, M.E.; Morsan, E.M. Association of the Mytilid Musculus viator with the Invasive Tunicate Ascidiella aspersa in San Matías Gulf, Argentine Patagonia. Am. Malacol. Bull. 2018, 36, 286–290. [Google Scholar] [CrossRef]
- Ramos Espla, A.; Micael, J.; Halldórsson, H.P.; Gíslason, S. Iceland: A laboratory for non-indigenous ascidians. Bioinvasions Rec. 2020, 9, 450–460. [Google Scholar] [CrossRef]
- Nagabhushanam, A.; Krishnamoorthy, P. Occurrence and biology of the solitary ascidian Ascidiella aspersa in Tamil Nadu coastal waters. J. Mar. Biol. Assoc. India 1992, 34, 1–9. [Google Scholar]
- Kanamori, M.; Baba, K.; Natsuike, M.; Goshima, S. Life history traits and population dynamics of the invasive ascidian, Ascidiella aspersa, on cultured scallops in Funka Bay, Hokkaido, northern Japan. J. Mar. Biol. Assoc. U. K. 2017, 97, 387–399. [Google Scholar] [CrossRef]
- Goto, T.; Oba, Y. A record of utilization as a spawning bed for the invasive ascidian Ascidiella aspersa (Muller, 1776) newly introduced in the Pacific coast of northeastern Japan. Biogeography 2019, 21, 37–42. [Google Scholar]
- Nishikawa, T.; Yasuda, A.; Murata, Y.; Otani, M. The Earliest Japanese records of the invasive European ascidian Ascidiella aspersa (Müller, 1776) (Urochordata: Ascidiidae) from Mutsu and Ago Bays, with a brief discussion of its invasion processes. Sess. Org. 2019, 36, 1–6. [Google Scholar] [CrossRef]
- Pyo, J.; Lee, T.; Shin, S. Two newly recorded invasive alien ascidians (Chordata, Tunicata, Ascidiacea) based on morphological and molecular phylogenetic analysis in Korea. Zootaxa 2012, 3368, 211–228. [Google Scholar] [CrossRef]
- Brewin, B.I. Ascidians in the vicinity of the Portobello marine biological station, Otago harbour. Trans. Roy. Soc. N. Z. 1946, 76, 87–131. [Google Scholar]
- Brine, O.; Hunt, L.; Costello, M.J. Marine biofouling on recreational boats on swing moorings and berths. Manag. Biol. Invasions 2013, 4, 327. [Google Scholar] [CrossRef]
- Osman, R.W.; Whitlatch, R.B. Ecological interactions of invading ascidians within epifaunal communities of southern New England. In Proceedings of the Marine Bioinvasions: Proceedings of the First National Conference, Cambridge, MA, USA, 24–27 January 1999; pp. 164–174. [Google Scholar]
- Nydam, M.L.; Nichols, C.L.; Lambert, G. First record of the ascidian Ascidiella aspersa (Müller, 1776) in southern California. Bioinvasions Rec. 2022, 11, 416–427. [Google Scholar] [CrossRef]
- Moore, A.M.; Vercaemer, B.; DiBacco, C.; Sephton, D.; Ma, K.C. Invading Nova Scotia: First records of Didemnum vexillum Kott, 2002 and four more non-indigenous invertebrates in 2012 and 2013. Bioinvasions Rec. 2014, 3, 25–234. [Google Scholar] [CrossRef]
- Ma, K.C.; Hawk, H.L.; Goodwin, C.; Simard, N. Morphological identification of two invading ascidians: New records of Ascidiella aspersa (Müller, 1776) from Nova Scotia and Diplosoma listerianum (Milne-Edwards, 1841) from New Brunswick and Quebec. Bioinvasions Rec. 2019, 8, 50–64. [Google Scholar] [CrossRef]
- Rius, M.; Branch, G.M.; Griffiths, C.L.; Turon, X. Larval settlement behaviour in six gregarious ascidians in relation to adult distribution. Mar. Ecol. Prog. Ser. 2010, 418, 151–163. [Google Scholar] [CrossRef]
- Mackenzie, A.B.; Fisheries and Oceans Canada, Centre of Expertise for Aquatic Risk Assessment. Biological Synopsis of the Compound Sea Squirt (Diplosoma listerianum); 0706-6473; DFO: Burlington, ON, Canada, 2011. [Google Scholar]
- Currie, D.R.; Cohen, B.; McArthur, M. Exotic Marine Pests in the Port of Geelong, Victoria; Marine and Freshwater Resources Institute: Hafnarfjörður, Iceland, 1998. [Google Scholar]
- Park, J.; Lee, T.; Kim, D.; Kim, P.; Kim, D.G.; Shin, S. Monitoring and impact of marine ecological disturbance causing organisms on an oyster and sea squirt farm. Korean J. Environ. Biol. 2017, 35, 677–683. [Google Scholar] [CrossRef]
- Stach, T.; Turbeville, J. Phylogeny of Tunicata inferred from molecular and morphological characters. Mol. Phylogenetics Evol. 2002, 25, 408–428. [Google Scholar] [CrossRef]
- Nishikawa, T.; Oohara, I.; Saitoh, K.; Shigenobu, Y.; Hasegawa, N.; Kanamori, M.; Baba, K.; Turon, X.; Bishop, J.D. Molecular and morphological discrimination between an invasive ascidian, Ascidiella aspersa, and its congener A. scabra (Urochordata: Ascidiacea). Zool. Sci. 2014, 31, 180–185. [Google Scholar] [CrossRef] [PubMed]
- Couton, M.; Comtet, T.; Le Cam, S.; Corre, E.; Viard, F. Metabarcoding on planktonic larval stages: An efficient approach for detecting and investigating life cycle dynamics of benthic aliens. Manag. Biol. Invasions 2019, 10, 657–689. [Google Scholar] [CrossRef]
- LeBlanc, F.; Belliveau, V.; Watson, E.; Coomber, C.; Simard, N.; DiBacco, C.; Bernier, R.; Gagné, N. Environmental DNA (eDNA) detection of marine aquatic invasive species (AIS) in Eastern Canada using a targeted species-specific qPCR approach. Manag. Biol. Invasions 2020, 11, 201. [Google Scholar] [CrossRef]
- Nichols, C.L.; Lambert, G.; Nydam, M.L. Continued persistence of non-native ascidians in Southern California harbors and marinas. Aquat. Invasions 2023, 18, 1–22. [Google Scholar] [CrossRef]
- Murugan, R.; Ananthan, G.; Arunkumar, A. DNA bar coding of Aplousobranchiata and Phlebobranchiata Ascidians (Phylum:Chordata) inferred from mitochondrial cytochrome oxidase subunit I (COI) gene sequence approach in Andaman and Nicobar Islands, India: A first report. Mitochondrial DNA Part A 2020, 31, 285–297. [Google Scholar] [CrossRef] [PubMed]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c. oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
- Carreras-Carbonell, J.; Macpherson, E.; Pascual, M. Rapid radiation and cryptic speciation in Mediterranean triplefin blennies (Pisces: Tripterygiidae) combining multiple genes. Mol. Phylogenetics Evol. 2005, 37, 751–761. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
- Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [PubMed]
- Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]
- Excoffier, L.; Lischer, H.E. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Clement, M.; Snell, Q.; Walker, P.; Posada, D.; Crandall, K. TCS: Estimating gene genealogies. Parallel Distrib. Process. Symp. Int. Proc. 2002, 2, 184. [Google Scholar]
- Leigh, J.W.; Bryant, D. POPART: Full-feature software for haplotype network construction. Methods Ecol. Evol. 2015, 6, 1110–1116. [Google Scholar] [CrossRef]
- Sathish Kumar, R.; Ananthan, G.; Selva Prabhu, A.; Jenifer, E. Molecular Identification of Ascidians from Andaman and Nicobar Islands; The Centre of Advanced Study (CAS) in Marine Biology, Annamalai University, Faculty of Marine Sciences: Parangipettai, India, 2014; Unpublished. [Google Scholar]
- Zhan, A.; Briski, E.; Bock, D.G.; Ghabooli, S.; MacIsaac, H.J. Ascidians as models for studying invasion success. Mar. Biol. 2015, 162, 2449–2470. [Google Scholar] [CrossRef]
- Darling, J.A.; Bagley, M.J.; Roman, J.; Tepolt, C.K.; Geller, J.B. Genetic patterns across multiple introductions of the globally invasive crab genus Carcinus. Mol. Ecol. 2008, 17, 4992–5007. [Google Scholar] [CrossRef] [PubMed]
Species | Locality Code | Locality | GPS | No. of Specimens | Haplotype Code | GenBank Accession Number | |
---|---|---|---|---|---|---|---|
COI | COI | COI | 18S | ||||
Ascidiella aspersa | IC | Incheon | 37°46′49.83″ N, 126°62′26.88″ E | H_1, H_3, H_5, H_6, H_8 | 5, 2, 1, 1, 1 | OR131201-OR131210 | OR453015-OR453022 |
BU | Bieung | 35°93′66.81″ N, 126°52′76.53″ E | H_1, H_2, H_3, H_4, H_5 | 3, 1, 3, 1, 1 | OQ722425-OQ722433 | OR453000-OR453007 | |
WD | Wando | 34°31′8761″ N, 126°75′32.31″ E | H_3, H_11, H_12, H_13 | 4, 1, 1, 1 | OR131242-OR131248 | OR453055-OR453062 | |
YS | Yeosu | 34°74′26.76″ N, 127°75′46.28″ E | H_1, H_3, H_8, H_11, H_14 | 2, 3, 1, 1, 1 | OR131257-OR131264 | OR453071-OR453078 | |
TY | Tongyeong | 34°82′80.55″ N, 128°43′64.44″ E | H_3, H_7, H_9, H_10 | 5, 1, 1, 1 | OR131227-OR131234 | OR453039-OR453046 | |
US | Ulsan | 35°51′46.72″ N, 129°37′59.00″ E | H_1, H_3, H_5, H_11 | 1, 4, 1, 1 | OR131235-OR131241 | OR453047-OR453054 | |
YP | Yangpo | 35°87′84.86″ N, 129°52′02.29″ E | H_3, H_5, H_8, H_9 | 2, 1, 3, 2 | OR131249-OR131256 | OR453063-OR453070 | |
JB | Jukbyeon | 37°05′53.00″ N, 129°41′73.98″ E | H_3, H_5, H_7, H_9 | 4, 1, 1, 2 | OR131211-OR131218 | OR453023-OR453030 | |
DH | Donghae | 37°49′06.97″ N, 129°12′498.08″ E | H_1, H_3, H_6, H_7 | 1, 4, 1, 1 | OR131195-OR131200 | OR453008- OR453014 | |
SC | Sokcho | 38°19′79.70″ N, 128°59′30.33″ E | H_1, H_3, H_5, H_9 | 2, 2, 1, 3 | OR131219-OR131226 | OR453031-OR453038 |
Gene | Primer Name | Primer Sequence (5′–3′) | Reference |
---|---|---|---|
COI | LCO1490 | GGTCAACAAATCATAAAGATATTGG | Folmer et al. 1994 [39] |
HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA | ||
18S rDNA | 18S-TF | AAACGGCTACCACATCCAAG | Carreras-Carbonell et al. 2005 [40] |
18S-TR | AACTAAGAACGGCCATGCAC |
Species | Locality Code | Locality/State and Country | Haplotype Code | No. of Specimens | GenBank Accession Number | Reference | |||
---|---|---|---|---|---|---|---|---|---|
COI | 18S-rDNA | COI | 18S-rDNA | COI | 18S-rDNA | ||||
Ascidiella aspersa | KO | Korea | H_1, H_2, H_3, H_4, H_8, H_10, H_11, H_12, H_21 | H_1, H_5 | 23, 36, 1, 2, 6, 9, 1, 1, 3 | 81, 2 | OQ722425-OQ722433, JQ742948-9 | OR453000-OR453078, JN573230- JN573233 | This study Pyo, et al., 2012 [22] |
JA | Japan | H_1, H_2, H_3, H_10 | H_1 | 1, 4, 2, 1 | 8 | AB794912-19 | AB811877-AB811884 | Nishikawa et al., 2014 [34] | |
SP | Spain | H_2, H_ H_3, H_4, H_10, H_13, H_14, H_15, H_16, H_17, H_18, H_19, H_20 | H_1, H_2 | 6, 7, 1, 3, 3, 6, 1, 4, 1, 1, 1, 1 | 21,1 | AB794920-41 KF309529 KF309533 KF309534 KF309555 KF309559 KF309562 KF309568 KF309594 KF309606 KF309617 KF309631 KF309637 KF309653 KF309661 | AB811885-AB811906 | Nishikawa, et al., 2014 [34] López-Legentil, Susanna, et al., 2015 [6] | |
EN | England | H_1, H_2, H_5, H_6 | H_1, H_3, H_4 | 2, 8, 1, 1 | 10,1,1 | AB794942-53 | AB811907-AB811918 | Nishikawa, et al., 2014 [34] | |
SW | Sweden | H_1, H_10 | H_1 | 1, 1 | 2 | AB794954 AB794955 | AB811919-AB811920 | Nishikawa, et al., 2014 [34] | |
US | USA | H_1, H_2 | - | 2, 8 | - | KF886702 MW872258 MW872260 MW872267 MW872271 MW872272 MW872276 MW872277 MW872307 MW872313 | - | Nichols, et al., 2023 [37] | |
IN | India | H_9 | - | 1 | - | KJ725163 | - | Sathish et al., 2014 [48] | |
FR | France | H_2, H_3, H_7 | - | 1, 1, 1 | - | AY116600 MN064594 MN064595 | - | Stach, & Turbeville, 2002 [33]; Couton, et al., 2019 [35] | |
CA | Canada | H_1 | - | 1 | - | MN718193 | - | LeBlanc et al., 2020 [36] |
Location | n | S | h | Hd | π | Pi | SSD | SSD p-Value | Rag | Rag p-Value | Fu’s Fs Statistic | Fu’s Fs p-Value | Tajima’s D | Tajima’s D p-Value |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Incheon (IC) | 10 | 6 | 5 | 0.7556 ± 0.1295 | 0.00325 ± 0.00222 | 3.00000 | 0.06623 | 0.23 | 0.17333 | 0.31 | −0.45535 | 0.32800 | 0.02422 | 0.53700 |
Bieung (BU) | 9 | 7 | 5 | 0.8333 ± 0.0980 | 0.00389 ± 0.00261 | 3.40000 | 0.02991 | 0.37 | 0.08642 | 0.45 | −0.30568 | 0.36000 | −0.03464 | 0.50300 |
Wando (WD) | 7 | 23 | 4 | 0.7143 ± 0.1809 | 0.01029 ± 0.00633 | 11.66667 | 0.05838 | 0.58 | 0.09977 | 0.83 | 2.42842 | 0.87200 | −1.58023 | 0.01900 |
Yeosu (YS) | 8 | 23 | 5 | 0.8571 ± 0.1083 | 0.01017 ± 0.00611 | 9.80000 | 0.06050 | 0.39 | 0.11224 | 0.57 | 1.42961 | 0.75000 | −1.29548 | 0.09600 |
Tongyeong (TY) | 8 | 4 | 4 | 0.6429 ± 0.1841 | 0.00223 ± 0.00171 | 2.16667 | 0.09059 | 0.19 | 0.30867 | 0.25 | −0.46960 | 0.25500 | −0.22175 | 0.44300 |
Ulsan (US) | 7 | 23 | 4 | 0.7143 ± 0.1809 | 0.01116 ± 0.00682 | 11.66667 | 0.12542 | 0.29 | 0.22676 | 0.35 | 2.62696 | 0.88800 | −1.23635 | 0.28000 |
Yangpo (YP) | 8 | 6 | 4 | 0.8214 ± 0.1007 | 0.00343 ± 0.00239 | 3.16667 | 0.00591 | 0.93 | 0.02934 | 0.99 | 0.39513 | 0.57000 | −0.12902 | 0.48200 |
Jukbyeon (JB) | 8 | 5 | 4 | 0.7500 ± 0.1391 | 0.00294 ± 0.00212 | 2.66667 | 0.19217 | 0.03 | 0.72832 | 0.03 | 0.08149 | 0.47000 | 0.00046 | 0.53900 |
Donghae (DH) | 7 | 4 | 4 | 0.7143 ± 0.1809 | 0.00246 ± 0.00189 | 2.16667 | 0.08696 | 0.12 | 0.29478 | 0.25 | −0.53807 | 0.21900 | −0.03984 | 0.47300 |
Sokcho (SC) | 8 | 5 | 4 | 0.8214 ± 0.1007 | 0.00348 ± 0.00242 | 2.83333 | 0.03841 | 0.20 | 0.11607 | 0.50 | 0.42753 | 0.56100 | 0.84031 | 0.82100 |
Location | n | S | h | Hd | π | Pi | SSD | SSD p-Value | Rag | Rag p-Value | Fu’s Fs Statistic | Fu’s Fs p-Value | Tajima’s D | Tajima’s D p-Value |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Incheon (IC) | 10 | 6 | 5 | 0.7556 ± 0.1295 | 0.00325 ± 0.00222 | 3.00000 | 0.06623 | 0.23 | 0.17333 | 0.31 | −0.45535 | 0.32800 | 0.02422 | 0.53700 |
Bieung (BU) | 9 | 7 | 5 | 0.8333 ± 0.0980 | 0.00389 ± 0.00261 | 3.40000 | 0.02991 | 0.37 | 0.08642 | 0.45 | −0.30568 | 0.36000 | −0.03464 | 0.50300 |
Wando (WD) | 7 | 23 | 4 | 0.7143 ± 0.1809 | 0.01029 ± 0.00633 | 11.66667 | 0.05838 | 0.58 | 0.09977 | 0.83 | 2.42842 | 0.87200 | −1.58023 | 0.01900 |
Yeosu (YS) | 8 | 23 | 5 | 0.8571 ± 0.1083 | 0.01017 ± 0.00611 | 9.80000 | 0.06050 | 0.39 | 0.11224 | 0.57 | 1.42961 | 0.75000 | −1.29548 | 0.09600 |
Tongyeong (TY) | 8 | 4 | 4 | 0.6429 ± 0.1841 | 0.00223 ± 0.00171 | 2.16667 | 0.09059 | 0.19 | 0.30867 | 0.25 | −0.46960 | 0.25500 | −0.22175 | 0.44300 |
Ulsan (US) | 7 | 23 | 4 | 0.7143 ± 0.1809 | 0.01116 ± 0.00682 | 11.66667 | 0.12542 | 0.29 | 0.22676 | 0.35 | 2.62696 | 0.88800 | −1.23635 | 0.28000 |
Yangpo (YP) | 8 | 6 | 4 | 0.8214 ± 0.1007 | 0.00343 ± 0.00239 | 3.16667 | 0.00591 | 0.93 | 0.02934 | 0.99 | 0.39513 | 0.57000 | −0.12902 | 0.48200 |
Jukbyeon (JB) | 8 | 5 | 4 | 0.7500 ± 0.1391 | 0.00294 ± 0.00212 | 2.66667 | 0.19217 | 0.03 | 0.72832 | 0.03 | 0.08149 | 0.47000 | 0.00046 | 0.53900 |
Donghae (DH) | 7 | 4 | 4 | 0.7143 ± 0.1809 | 0.00246 ± 0.00189 | 2.16667 | 0.08696 | 0.12 | 0.29478 | 0.25 | −0.53807 | 0.21900 | −0.03984 | 0.47300 |
Sokcho (SC) | 8 | 5 | 4 | 0.8214 ± 0.1007 | 0.00348 ± 0.00242 | 2.83333 | 0.03841 | 0.20 | 0.11607 | 0.50 | 0.42753 | 0.56100 | 0.84031 | 0.82100 |
Location | n | S | h | Hd | π | Pi | SSD | SSD p-Value | Rag | Rag p-Value | Fu’s Fs Statistic | Fu’s Fs p-Value | Tajima’s D | Tajima’s D p-Value |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Korea (KO) | 83 | 0 | 2 | 0.04761 ± 0.0321 | 0.000081 ± 0.000220 | 0.04761 | 0.00001 | 0.083 | 0.82091 | 0.93000 | −1.32483 | 0.06600 | 0.00000 | 1.00000 |
England (EN) | 12 | 2 | 3 | 0.3182 ± 0.1637 | 0.000568 ± 0.000684 | 0.33333 | 0.00283 | 0.132 | 0.22658 | 0.78300 | −1.32484 | 0.02500 | −1.45138 | 0.05800 |
Japan (JA) | 8 | 0 | 1 | 0.000000 ± 0.000000 | 0.000000 ± 0.000000 | 0.00000 | 0.00000 | 0.000 | 0.00000 | 0.00000 | 0.00000 | N.A. | 0.00000 | 1.00000 |
Spain (SP) | 22 | 1 | 2 | 0.0909 ± 0.0809 | 0.000155 ± 0.000320 | 0.00019 | 0.00004 | 0.117 | 0.67769 | 0.92400 | −0.95676 | 0.06500 | −1.16240 | 0.15800 |
Sweden (SW) | 2 | 0 | 1 | 0.000000 ± 0.000000 | 0.000000 ± 0.000000 | 0.00000 | 0.00000 | 0.000 | 0.00000 | 0.00000 | 0.00000 | N.A. | 0.00000 | 1.00000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.; Kwon, S.; Ubagan, M.D.; Lee, T.; Shin, S. Genetic Diversity and Population Dynamics of Invasive Ascidiella aspersa: Insights from Cytochrome Oxidase Subunit I and 18S rDNA Analyses in Korean and Global Populations. Water 2023, 15, 3886. https://doi.org/10.3390/w15223886
Lee J, Kwon S, Ubagan MD, Lee T, Shin S. Genetic Diversity and Population Dynamics of Invasive Ascidiella aspersa: Insights from Cytochrome Oxidase Subunit I and 18S rDNA Analyses in Korean and Global Populations. Water. 2023; 15(22):3886. https://doi.org/10.3390/w15223886
Chicago/Turabian StyleLee, Jeounghee, Soyeon Kwon, Michael Dadole Ubagan, Taekjun Lee, and Sook Shin. 2023. "Genetic Diversity and Population Dynamics of Invasive Ascidiella aspersa: Insights from Cytochrome Oxidase Subunit I and 18S rDNA Analyses in Korean and Global Populations" Water 15, no. 22: 3886. https://doi.org/10.3390/w15223886