Appendix A
- ➢
A complete example of the generation of S-Boxe1 employing the 2D Tinkerbell map is shown below:
Initialization phase:
Run the 2D Tinkerbell map using a = 0.9, b = −0.6013, c = 2, d = 0.5, X0 = −0.721, and Y0 = −0.64
When i = 1, X1 = (−0.721)2 − (−0.64)2 + 0.9 × (−0.721) + (−0.6013) × (−0.64) = −0.153827
Y1 = 2 × (−0.153827) × (−0.64) + 2 × (−0.153827) + 0.5 × (−0.64) = −0.43075544
- ❖
The process of generating the first sequence number from Xi: the value of X1 is −0.153827, eliminate from sign, comma and take 14 digits after comma; the result is 153827. Select position randomly and take 3 digits after the selected position mod 256, assume position 2 is selected so, 538 mod 256 = 26, convert to 8-bit binary; the result is 00011010.
- ❖
The process of generating the first sequence number from Yi: the value of Y1 is −0.43075544, eliminate from sign, comma and take 14 digits after comma; the result is 43075544. Select position randomly and take 3 digits after the selected position mod 256, assume position 1 is selected so, 430 mod 256 = 174, convert to 8-bit binary; the result is 10101110.
- ❖
The rest of the results are obtained in the same way, repeating the process for all X
i and Y
i values, as shown in
Table A1,
Table A2 and
Table A3.
Table A1.
Generate Xi and Yi using the 2D Tinkerbell map.
Table A1.
Generate Xi and Yi using the 2D Tinkerbell map.
Number of i | Xi | Yi |
---|
1 | −0.153827 | −0.43075544 |
2 | −0.041318557088593721 | −0.26241844769946288 |
3 | 0.053449292688840327 | −0.052362799308130245 |
4 | 0.0797050787814888 | 0.12488159582076486 |
5 | −0.012599246054863504 | 0.03409547789371576 |
6 | −0.032844692918518312 | −0.050881357892837195 |
… | … | … |
Table A2.
Eliminate from sign, comma and takes 14 digits after comma for Xi and Yi.
Table A2.
Eliminate from sign, comma and takes 14 digits after comma for Xi and Yi.
Number of i | Eliminate from the Sign, Comma and Takes 14 Digits after Comma | Eliminate from the Sign, Comma and Takes 14 Digits after Comma |
---|
1 | 153827 | 43075544 |
2 | 04131855708859 | 26241844769946 |
3 | 05344929268884 | 05236279930813 |
4 | 07970507878148 | 12488159582076 |
5 | 01259924605486 | 03409547789371 |
6 | 03284469291851 | 05088135789283 |
… | … | … |
Table A3.
Generates sequence numbers based on Xi and Yi values.
Table A3.
Generates sequence numbers based on Xi and Yi values.
Number of i | Takes Digits in Positions (2, 3 and 4) Mod 256 | Sequence Numbers 1 | Takes Digits in Positions (1, 2 and 3) Mod 256 | Sequence Numbers 2 |
---|
1 | 538 mod 256 = 26 | 00011010 | 430 mod 256 = 174 | 10101110 |
2 | 413 mod 256 = 157 | 10011101 | 262 mod 256 = 6 | 00000110 |
3 | 534 mod 256 = 22 | 00010110 | 052 mod 256 = 52 | 00110100 |
4 | 797 mod 256 = 29 | 00011101 | 124 mod 256 = 124 | 01111100 |
5 | 125 mod 256 = 125 | 01111101 | 034 mod 256 = 34 | 00100010 |
6 | 328 mod 256 = 72 | 01001000 | 050 mod 256 = 50 | 00110010 |
… | … | … | … | … |
- ❖
Assuming both the sender and recipient agree to randomly choose rounds and position values.
Table A4 illustrates the process of generating the shift values (buffer 1 and buffer 2).
Table A4.
Generates shift values (buffer 1 and buffer 2) using the 2D Tinkerbell map.
Table A4.
Generates shift values (buffer 1 and buffer 2) using the 2D Tinkerbell map.
Round | Value of Round in (Xi) | Selected Position | Value (Buffer 1) | Round | Value of Round in (Yi) | Selected Position | Value (Buffer 2) |
---|
2 | 04131855708859 | 4 | 3 | 9 | 01568453777318 | 6 | 4 |
19 | 00018347337203 | 9 | 3 | 20 | 00019622033453 | 4 | 1 |
123 | 75223450882507 | 2 | 5 | 51 | 63146373964369 | 2 | 3 |
199 | 59499357900227 | 11 | 0 | 99 | 32777311612723 | 7 | 1 |
205 | 08597748105963 | 1 | 0 | 190 | 44559510179214 | 9 | 1 |
218 | 81183553962828 | 7 | 5 | 203 | 04531685949465 | 4 | 3 |
301 | 17178211627398 | 6 | 2 | 230 | 44786377288332 | 2 | 4 |
316 | 14931033209777 | 7 | 3 | 256 | 60070844814028 | 3 | 0 |
326 | 11189268962787 | 6 | 2 | 309 | 67067293115831 | 8 | 3 |
370 | 52787277277676 | 5 | 7 | 380 | 28479188740166 | 12 | 1 |
376 | 90536667489769 | 4 | 3 | 399 | 68019348527224 | 11 | 7 |
400 | 36643941799131 | 1 | 3 | 405 | 43036508653834 | 13 | 3 |
410 | 00739259397935 | 1 | 0 | 485 | 12763746694896 | 2 | 2 |
450 | 08732526297793 | 6 | 5 | 499 | 76687040131334 | 4 | 8 |
503 | 96344266362421 | 5 | 4 | 501 | 65037364263293 | 6 | 3 |
511 | 36736606881193 | 9 | 8 | 520 | 98220759711907 | 9 | 7 |
520 | 34170755924225 | 8 | 5 | 548 | 11941949554439 | 10 | 5 |
535 | 14015253078072 | 3 | 0 | 612 | 60421367553936 | 4 | 2 |
561 | 68493424111307 | 5 | 3 | 677 | 97731066803722 | 12 | 7 |
585 | 62020371657689 | 4 | 2 | 710 | 16644013610951 | 1 | 1 |
598 | 16238900523974 | 10 | 2 | 712 | 51771151090968 | 1 | 5 |
613 | 91604236453256 | 10 | 5 | 750 | 07844990204257 | 4 | 4 |
625 | 35244705821893 | 3 | 2 | 798 | 93234377567065 | 10 | 6 |
650 | 32228600805274 | 11 | 5 | 803 | 32948913215751 | 13 | 5 |
670 | 10410926177084 | 3 | 4 | 820 | 16515109042643 | 4 | 1 |
701 | 55864934042596 | 5 | 4 | 870 | 41410722474031 | 3 | 4 |
742 | 71939806374998 | 7 | 0 | 942 | 47286654332096 | 7 | 5 |
799 | 51070276089034 | 8 | 6 | 950 | 44747327706102 | 3 | 7 |
804 | 52392921118775 | 12 | 7 | 965 | 29190505354133 | 10 | 5 |
865 | 43691118433292 | 6 | 1 | 970 | 63734618050187 | 8 | 8 |
916 | 87231473813097 | 13 | 9 | 994 | 15885221704716 | 6 | 2 |
981 | 73962678859339 | 8 | 8 | 1000 | 51922620430956 | 8 | 0 |
The values of buffer 1 are “33500523273305485032252544067198”; whereas, buffer 2 contains the values “41311340317328375271546514575820”
The construction phase:
- ✓
Assume user input secret key1 “ph.d in computer science”. secret key2 “how_may i assist you now”
- ✓
DNA coding of secret key1:
CTCCAAGTACGAAACTACCCAAGGCCGAGATTCCCGAAAACCGTACTTCTATACCTCCATACTCACCCACTACCCGAAGGCCATAAACCCCGAACG
- ✓
DNA coding of secret key2:
CCTCAAAACTAGATAACCGTAATGCTTTGATTCCTTGATTCCCTACTACTCGAAGGCTCGACCTACCCACGGCCGGACCGACCCAAACCCGGACCA
- ✓
XOR operation between binary of DNA coding of secret key1 and sequence numbers 1, the result is
“010110011100100101010101010111100011110000001001010000111100011101100110011111100101110001010100010100000100011101001011010101010100010100111101010000101111001001110000011110010001101011011000010100101110001101101100100010100001011000011100110011001000000111101100110111001000111111010110010001001010010010010001110100101101001000000001011110000000001100110000011101111010101101011110011011000010001110011000000010010100000110011110001100101111101001110001001011110001101110010101100000110111100011010001111000101101001111101010100101111111010000001010111110001011110111100001010001101100110011001111001010101010100101101110101000010110111010001100100101100110110001011011000000010100010111001111001001111110101100010111111111011111101111101110100001110100011001110101”
- ✓
XOR operation between binary of DNA coding of secret key2 and sequence numbers 2, the result is
“111011010100010101100000001111110110001101110011010110110100111001001100010100000100011001000111010000100101010001000000010000010100001101000011010001110101010011111011101110011101011111101010001111110001000111100110000001110000000111110011101110000010011110011010000000101110001111110010100111100011010100011010110010111001001011011001001001110101011101000110110101101111011111011011010110111000110100110100101100111001001101100110001101111101000011000111001101011000000111110110001010010100110001100110010101100101100000000110001101111100001010111010011010001001000001010010101110100101111101001001110101010010010000000101100010111111011101001110001110111001000000001110100100000000010101010110010100111100111110000000100010010010011010101000110111100100110101010110”
Eliminate duplicate values in
Table A5, and add the values to S-Box1 in the order of their appearance. Proceed similarly with
Table A6, ensuring the values are added to S-Box1 sequentially and only if they are not already present. In exceptional instances, identify any values ranging from 00 to FF that are absent and supplement them accordingly, as shown in
Table A7.
Table A5.
Shift above result from XOR operation depending on buffer 1.
Table A5.
Shift above result from XOR operation depending on buffer 1.
8-Bit Binary | Value of Shift (Buffer 1) | 8-Bit after Shifted | Convert to HEX Format |
---|
01011001 | 3 | 00101011 | 2B |
10110011 | 3 | 01110110 | 76 |
01100111 | 5 | 00111011 | 3B |
11001110 | 0 | 11001110 | CE |
10011100 | 0 | 10011100 | 9C |
00111001 | 5 | 11001001 | C9 |
01110010 | 2 | 10011100 | 9C |
… | … | … | … |
Table A6.
Shift above result from XOR operation depending on buffer 2.
Table A6.
Shift above result from XOR operation depending on buffer 2.
8-Bit Binary | Value of Shift (Buffer 2) | 8-Bit after Shifted | Convert to HEX Format |
---|
11101101 | 4 | 11011110 | DE |
11011010 | 1 | 01101101 | 6D |
10110101 | 3 | 10110110 | B6 |
01101010 | 1 | 00110101 | 35 |
11010100 | 1 | 01101010 | 6A |
10101000 | 3 | 00010101 | 15 |
01010001 | 4 | 00010101 | 15 |
… | … | … | … |
Table A7.
S-Box 1.
2B | 76 | 3B | CE | 9C | C9 | 72 | 25 | A4 | 49 | 95 | 51 | 55 | AA | 5D | D5 |
7D | E5 | CB | 78 | C7 | E3 | 1E | 87 | 0F | E0 | C0 | 0C | 80 | 42 | 24 | 94 |
41 | 05 | A1 | 1A | E1 | C3 | 7C | 1F | E8 | 1D | EC | B3 | CC | 99 | 33 | 67 |
7E | E7 | 9F | F9 | 3F | 5E | 79 | 2E | E2 | B8 | 71 | 54 | 45 | 8A | 0A | 28 |
14 | 82 | 04 | 40 | 44 | 64 | D1 | A3 | 47 | 74 | 4F | 2D | A5 | 5A | 96 | 6D |
53 | 75 | A8 | A2 | A0 | 29 | 3D | D3 | F4 | BE | D4 | 12 | 85 | 61 | C5 | F2 |
2F | 4E | 27 | 38 | 0E | 1C | 83 | 07 | 19 | 91 | 8D | D0 | 35 | B5 | 6B | DA |
AD | 63 | 0B | 4A | B4 | 97 | F8 | B1 | 36 | BD | B6 | D9 | 56 | 32 | 8C | 88 |
2A | 43 | 21 | C2 | B0 | C1 | 6E | DC | 66 | 46 | 84 | 08 | 02 | 18 | 30 | 3C |
9E | F6 | 9D | CD | 37 | 73 | C8 | 7F | D7 | 5F | CA | 59 | 22 | 31 | 90 | 92 |
52 | 48 | 23 | 4B | 69 | 20 | 00 | 17 | BC | F0 | 60 | 98 | 06 | 70 | DD | DF |
DB | B7 | 7A | AF | AE | 5B | F5 | CF | E6 | 1B | 8E | 39 | 9B | C4 | A7 | 3E |
65 | FA | EB | E9 | 5C | 26 | 89 | D2 | F1 | 6C | D8 | 93 | B2 | 58 | 68 | 7B |
8F | 8B | BA | AB | A9 | EF | F7 | 01 | 57 | ED | FE | FB | 2C | AC | D6 | BB |
EA | A6 | 50 | 0D | B9 | FC | 13 | FF | FD | BF | 86 | DE | 6A | 15 | 03 | 4D |
E4 | 4C | 34 | 09 | 11 | 3A | 9A | EE | F3 | 10 | 81 | 77 | 16 | C6 | 6F | 62 |
- ➢
A complete example of the generation of S-Box2 employing the 2D Duffing map is shown below:
Initialization phase:
Run the 2D Duffing map using a = 2.75, b = 0.15, X0 = 0.7, and Y0 = 0.93
When i = 1, X1 = 0.93 and Y1 = (−0.15 × 0.93) + (2.75 × 0.93) − (0.93)3 = 1.613643
- ❖
The process of generating first sequence number from Xi: the value of X1 is 0.93, eliminate from sign, comma and takes 14 digits after comma; the result is 93. Select position randomly and takes 3 digits after the selected position mod 256, assume position 2 is selected so, 3 mod 256 = 3, convert to 8-bit binary; the result is 00000011.
- ❖
The process of generates first sequence number from Yi: the value of Y1 is 1.613643, eliminate from sign, comma and take 14 digits after comma; the result is 613643. Select position randomly take 3 digits after the selected position mod 256, assume position 2 is selected so, 136 mod 256 = 136, convert to 8-bit binary; the result is 10001000.
- ❖
The rest of the results are obtained in the same way, repeats the process for all X
i and Y
i values, as shown in
Table A8,
Table A9 and
Table A10.
Table A8.
Generates Xi and Yi using the 2D duffing map.
Table A8.
Generates Xi and Yi using the 2D duffing map.
Number of i | Xi | Yi |
---|
1 | 0.93 | 1.613643 |
2 | 1.613643 | 0.0062024103465603275 |
3 | 0.0062024103465603275 | 0.016126028294987611 |
4 | 0.016126028294987611 | 0.041923480012845224 |
5 | 0.041923480012845224 | 0.10892736423984879 |
6 | 0.10892736423984879 | 0.28191870525515228 |
… | … | … |
Table A9.
Eliminate from sign, comma and takes 14 digits after comma for Xi and Yi.
Table A9.
Eliminate from sign, comma and takes 14 digits after comma for Xi and Yi.
Number of i | Eliminate from the Sign, Comma and Takes 14 Digits after Comma | Eliminate from the Sign, Comma and Takes 14 Digits after Comma |
---|
1 | 93 | 613643 |
2 | 613643 | 00620241034656 |
3 | 00620241034656 | 01612602829498 |
4 | 01612602829498 | 04192348001284 |
5 | 04192348001284 | 10892736423984 |
6 | 10892736423984 | 28191870525515 |
… | … | … |
Table A10.
Generates sequence numbers based on Xi and Yi values.
Table A10.
Generates sequence numbers based on Xi and Yi values.
Number of i | takes Digits in Positions (2, 3 and 4) Mod 256 | Sequence Numbers 3 | Takes Digits in Positions (2, 3 and 4) Mod 256 | Sequence Numbers 4 |
---|
1 | 3 mod 256 = 3 | 00000011 | 136 mod 256 = 136 | 10001000 |
2 | 136 mod 256 = 136 | 10001000 | 062 mod 256 = 62 | 00111110 |
3 | 062 mod 256 = 62 | 00111110 | 161 mod 256 = 161 | 10100001 |
4 | 161 mod 256 = 161 | 10100001 | 419 mod 256 = 163 | 10100011 |
5 | 419 mod 256 = 163 | 10100011 | 089 mod 256 = 89 | 01011001 |
6 | 089 mod 256 = 89 | 01011001 | 819 mod 256 = 51 | 00110011 |
… | … | … | … | … |
- ❖
Assuming both the sender and recipient agree to randomly choose rounds and position values.
Table A11 illustrates the process of generating shift values (buffer 3 and buffer 4).
Table A11.
Generates shift values (buffer 3 and buffer 4) using the 2D Duffing map.
Table A11.
Generates shift values (buffer 3 and buffer 4) using the 2D Duffing map.
Round | Value of Round in (Xi) | Selected Position | Value (Buffer 3) | Round | Value of Round in (Yi) | Selected Position | Value (Buffer 4) |
---|
12 | 18593214845466 | 4 | 9 | 3 | 01612602829498 | 4 | 1 |
20 | 87506258198913 | 3 | 5 | 15 | 09793636228533 | 7 | 3 |
55 | 09271183018619 | 10 | 1 | 46 | 44124453946982 | 9 | 9 |
77 | 50990559007907 | 9 | 0 | 90 | 42973302791717 | 10 | 9 |
109 | 31943524005919 | 2 | 1 | 100 | 26723979306017 | 12 | 0 |
121 | 52316639095945 | 8 | 9 | 146 | 08900254185067 | 2 | 8 |
152 | 50782431167485 | 11 | 7 | 186 | 60088395125526 | 11 | 5 |
160 | 0929663449005 | 9 | 4 | 200 | 30318210376056 | 9 | 3 |
200 | 57393877668195 | 3 | 3 | 254 | 19127253136421 | 7 | 5 |
225 | 59362969399894 | 2 | 9 | 265 | 36508183684438 | 1 | 3 |
280 | 23088588434095 | 1 | 2 | 300 | 11837154607203 | 2 | 1 |
296 | 01044509908869 | 7 | 0 | 358 | 15884583637967 | 6 | 5 |
311 | 47513618864565 | 6 | 6 | 362 | 63540556201264 | 12 | 2 |
320 | 28191118809258 | 7 | 1 | 398 | 4257080980998 | 9 | 8 |
370 | 00444277740266 | 9 | 7 | 400 | 57385140618546 | 1 | 5 |
385 | 24263067398517 | 12 | 5 | 450 | 26548713745428 | 8 | 3 |
429 | 73911240108350 | 1 | 7 | 475 | 94224920230115 | 1 | 9 |
508 | 61215313640466 | 9 | 6 | 529 | 6105155976966 | 5 | 1 |
563 | 18884661563008 | 5 | 4 | 546 | 11132497372232 | 10 | 7 |
570 | 02926268812163 | 9 | 8 | 566 | 06371251418742 | 9 | 4 |
577 | 13054739937274 | 10 | 3 | 629 | 55551098903416 | 13 | 1 |
602 | 85593287759666 | 13 | 6 | 659 | 38522228867594 | 3 | 5 |
619 | 15499671076079 | 3 | 4 | 700 | 32320716990016 | 9 | 9 |
630 | 55551098903416 | 8 | 8 | 748 | 59543463057901 | 7 | 6 |
688 | 60283888109877 | 11 | 9 | 845 | 94505758387023 | 8 | 8 |
700 | 1250627843833 | 9 | 4 | 866 | 02976949427003 | 12 | 0 |
722 | 19564417742130 | 7 | 1 | 900 | 99953422006350 | 1 | 9 |
800 | 15017038758020 | 9 | 7 | 932 | 41741358037506 | 9 | 0 |
809 | 21073689470264 | 8 | 9 | 965 | 96475683417404 | 6 | 6 |
900 | 36705585508974 | 12 | 9 | 979 | 77274787232493 | 9 | 2 |
944 | 13491602891716 | 6 | 6 | 988 | 61324593262502 | 8 | 3 |
956 | 60348754062882 | 8 | 4 | 999 | 99884485431275 | 3 | 8 |
The values of buffer 3 are “95101974392061757648364894179964”. Whereas buffer 4 contains the values “13990853531528539174159680906238”.
The construction phase:
- ✓
Assume user input secret key3 “Life’s a journey, enjoy!” and secret key4 “Dream Big, achieve more”.
- ✓
DNA coding of secret key3:
CAGCAAGGCCAAAACGACAGACTAACCCAATGACCCAAGCCCGGACCGCTCAAAACCCATACGGACGCGATTCCATAAACCCTAAAAACTTTGATG
- ✓
DNA coding of secret key4:
CAACACTCCCATAATGCCGTGATTCACAAAGGCCAGGAATACCCAATGCCCGAAGTCCTTAACGCTAAAACGACCCAAAGCCGGACTCCCATGAAC
- ✓
Additive operation between binary of DNA coding of secret key3 and sequence numbers3, the result is
“010001101100100110000101111001001110010010011010011110101011000010111010000010110001110110011100110110111111101011100111000110100101100111110011100000000011010101110011101111100010111001101101001000001100000101011011000100010100001000100101110001000000001100100011000101001010110110100010001110101100100111110001100010101111110000111111011100101101001010011000000010001101111110101100110000101110110110111110101100101100001011110000111000001101010110101110100111000000100011100000101010001001100100000100000101111001111010111100001000100100111100100100011001010110101011110001001010010101100011001010100010011010010010000011111110000100011111101110111110101110110101011110001010010100111001011010111100100101110011110010011111011100111101101011101010001111000010100000”
- ✓
Additive operation between binary of DNA coding of secret key4 and sequence numbers 4, the result is
“110010110111111111100010111001101001101001110110101111011011101000001011000111111001110011101110111110101110010100100111010111111111001110000010001101011000011011000010000110111000000000110011110000010101100100010001010000100010010110110001000000110010100100010100101011011010000001000000110011111110101110001000000011010011110101101110110011101001101000000110110111011011100111000110110111001011111010110100110010001111000011100000110110011011111110011100000010101110000010111011100101111111111000010011101001001011110000101111010011010001111001100101010101111110000000101101010101101100110001111000101001101000001111111000010001011111001011111010110111000110010000101111010011100101110000000101010111001110000101101100101111000111100010101110110111011001101000000100”
Eliminate duplicate values in
Table A12, and add the values to S-Box2 in the order of their appearance. Proceed similarly with
Table A13, ensuring the values are added to S-Box2 sequentially and only if they are not already present. In exceptional instances, identify any values ranging from 00 to FF that are missing and supplement them accordingly, as shown in
Table A14.
Table A12.
Shift above result from additive operation depending on buffer 3.
Table A12.
Shift above result from additive operation depending on buffer 3.
8-Bit Binary | Value of Shift (Buffer 3) | 8-Bits after Shifted | Convert To HEX Format |
---|
01000110 | 9 mod 8 = 1 | 00100011 | 23 |
10001101 | 5 | 01101100 | 6C |
00011011 | 1 | 10001101 | 8D |
00110110 | 0 | 00110110 | 36 |
01101100 | 1 | 00110110 | 36 |
11011001 | 9 mod 8 = 1 | 11101100 | EC |
10110010 | 7 | 01100101 | 65 |
… | … | … | … |
Table A13.
Shift above result from additive operation depending on buffer 4.
Table A13.
Shift above result from additive operation depending on buffer 4.
8-Bit Binary | Value of Shift (Buffer 4) | 8-Bits after Shifted | Convert to HEX Format |
---|
11001011 | 1 | 11100101 | E5 |
10010110 | 3 | 11010010 | D2 |
00101101 | 9 mod 8 = 1 | 10010110 | 96 |
01011011 | 9 mod 8 = 1 | 10101101 | AD |
10110111 | 0 | 10110111 | B7 |
01101111 | 8 mod 8 = 0 | 01101111 | 6F |
11011111 | 5 | 11111110 | FE |
… | … | … | … |
Table A14.
S-Box 2.
23 | 6C | 8D | 36 | EC | 65 | 46 | 39 | C9 | 89 | 4C | 62 | 18 | C2 | 16 | 0B |
2C | 71 | 2F | CB | F2 | 97 | 72 | 9C | 4E | 27 | E4 | 49 | 24 | A4 | D4 | 53 |
1A | 5A | D3 | 9E | A7 | 3D | E9 | F4 | D7 | AE | D5 | 75 | 59 | CA | 58 | 61 |
85 | 8B | B8 | 5D | A3 | 74 | D0 | 50 | A0 | 05 | C6 | B1 | 8F | 3A | 67 | 3B |
CE | 76 | 93 | B9 | CD | E6 | D8 | D6 | ED | BD | B7 | DF | BF | FD | 5F | FA |
BA | 2E | 73 | 9B | CF | 38 | 0D | 43 | B4 | A5 | D2 | AC | 9D | B3 | 1F | F8 |
9F | 7E | F3 | E0 | C1 | 06 | 01 | 00 | 60 | 9A | A6 | EA | 57 | AB | 3F | BB |
3E | F1 | E2 | 17 | 5C | DC | 37 | B6 | AD | 69 | 52 | 21 | 09 | 10 | 0A | 0C |
41 | 54 | 95 | 6D | DA | 88 | 22 | A2 | 15 | 14 | 04 | 11 | 13 | E5 | 20 | 08 |
02 | 81 | 32 | 19 | 91 | 98 | 31 | A8 | 82 | 94 | 29 | 56 | B2 | 5B | 6B | 86 |
D1 | 51 | 44 | 1D | F5 | 4F | C7 | E3 | 8C | 03 | C4 | 26 | C5 | 45 | AF | FE |
E7 | 78 | E1 | C3 | 1E | 7F | FB | 77 | BC | 96 | 4B | 25 | A9 | 30 | C0 | 40 |
80 | C8 | 6E | 7B | BE | D9 | CC | 66 | 6F | DB | DE | 7D | 2D | 79 | 87 | F0 |
0E | 70 | 83 | 07 | A1 | 68 | 6A | 2B | 1C | 47 | 8A | 33 | 42 | 28 | F9 | FC |
EB | 3C | 12 | 84 | 92 | 4A | 64 | 2A | 4D | 48 | 90 | EF | EE | DD | F7 | 7A |
5E | F6 | B5 | E8 | 0F | FF | 34 | 63 | B0 | 1B | 35 | 7C | 55 | AA | 8E | 99 |