Modeling Mucopolysaccharidosis Type II in the Fruit Fly by Using the RNA Interference Approach
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fly Stocks and Husbandry
2.2. Real-Time qPCR
2.3. IDS Activity Assay
2.4. GAG Assay
2.5. Lethality Assays
2.6. Crawling Assay
2.7. Climbing Assay
2.8. Statistics
3. Results
3.1. Basic Characterization of the Models
3.2. Molecular Analysis of Pathology Markers
3.3. Locomotion Behavioral Studies
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Khan, S.A.; Peracha, H.; Ballhausen, D.; Wiesbauer, A.; Rohrbach, M.; Gautschi, M.; Mason, R.W.; Giugliani, R.; Suzuki, Y.; Orii, K.E.; et al. Epidemiology of mucopolysaccharidoses. Mol. Genet. Metab. 2017, 121, 227–240. [Google Scholar] [CrossRef] [PubMed]
- D’Avanzo, F.; Rigon, L.; Zanetti, A.; Tomanin, R. Mucopolysaccharidosis Type II: One Hundred Years of Research, Diagnosis, and Treatment. Int. J. Mol. Sci. 2020, 21, 1258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Whiteman, D.A.; Kimura, A. Development of idursulfase therapy for mucopolysaccharidosis type II (Hunter syndrome): The past, the present and the future. Drug Des. Dev. Ther. 2017, 11, 2467–2480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salvalaio, M.; D’Avanzo, F.; Rigon, L.; Zanetti, A.; D’Angelo, M.; Valle, G.; Scarpa, M.; Tomanin, R. Brain RNA-Seq Profiling of the Mucopolysaccharidosis Type II Mouse Model. Int. J. Mol. Sci. 2017, 18, 1072. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zalfa, C.; Verpelli, C.; D’Avanzo, F.; Tomanin, R.; Vicidomini, C.; Cajola, L.; Manara, R.; Sala, C.; Scarpa, M.; Vescovi, A.L.; et al. Glial degeneration with oxidative damage drives neuronal demise in MPSII disease. Cell Death Dis. 2016, 7, e2331. [Google Scholar] [CrossRef]
- Fusar Poli, E.; Zalfa, C.; D’Avanzo, F.; Tomanin, R.; Carlessi, L.; Bossi, M.; Nodari, L.R.; Binda, E.; Marmiroli, P.; Scarpa, M.; et al. Murine neural stem cells model Hunter disease in vitro: Glial cell-mediated neurodegeneration as a possible mechanism involved. Cell Death Dis. 2013, 4, e906. [Google Scholar] [CrossRef] [Green Version]
- Garcia, A.R.; Pan, J.; Lamsa, J.C.; Muenzer, J. The characterization of a murine model of mucopolysaccharidosis II (Hunter syndrome). J. Inherit. Metab. Dis. 2007, 30, 924–934. [Google Scholar] [CrossRef] [PubMed]
- Cardone, M.; Polito, V.A.; Pepe, S.; Mann, L.; D’Azzo, A.; Auricchio, A.; Ballabio, A.; Cosma, M.P. Correction of Hunter syndrome in the MPSII mouse model by AAV2/8-mediated gene delivery. Hum. Mol. Genet. 2006, 15, 1225–1236. [Google Scholar] [CrossRef] [PubMed]
- Moro, E.; Tomanin, R.; Friso, A.; Modena, N.; Tiso, N.; Scarpa, M.; Argenton, F. A novel functional role of iduronate-2-sulfatase in zebrafish early development. Matrix Biol. 2010, 29, 43–50. [Google Scholar] [CrossRef]
- Costa, R.; Urbani, A.; Salvalaio, M.; Bellesso, S.; Cieri, D.; Zancan, I.; Filocamo, M.; Bonaldo, P.; Szabò, I.; Tomanin, R.; et al. Perturbations in cell signaling elicit early cardiac defects in mucopolysaccharidosis type II. Hum. Mol. Genet. 2017, 26, 1643–1655. [Google Scholar] [CrossRef] [Green Version]
- Bellesso, S.; Salvalaio, M.; Lualdi, S.; Tognon, E.; Costa, R.; Braghetta, P.; Giraudo, C.; Stramare, R.; Rigon, L.; Filocamo, M.; et al. FGF signaling deregulation is associated with early developmental skeletal defects in animal models for mucopolysaccharidosis type II (MPSII). Hum. Mol. Genet. 2018, 27, 2262–2275. [Google Scholar] [CrossRef] [PubMed]
- Webber, D.L.; Choo, A.; Hewson, L.J.; Trim, P.J.; Snel, M.F.; Hopwood, J.J.; Richards, R.I.; Hemsley, K.M.; O’Keefe, L.V. Neuronal-specific impairment of heparan sulfate degradation in Drosophila reveals pathogenic mechanisms for Mucopolysaccharidosis type IIIA. Exp. Neurol. 2018, 303, 38–47. [Google Scholar] [CrossRef] [PubMed]
- Bar, S.; Prasad, M.; Datta, R. Neuromuscular degeneration and locomotor deficit in a Drosophila model of mucopolysaccharidosis VII is attenuated by treatment with resveratrol. Dis. Models Mech. 2018, 11, dmm036954. [Google Scholar] [CrossRef] [Green Version]
- Ugur, B.; Chen, K.; Bellen, H.J. Drosophila tools and assays for the study of human diseases. Dis. Models Mech. 2016, 9, 235–244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reiter, L.T.; Potocki, L.; Chien, S.; Gribskov, M.; Bier, E. A systematic analysis of human disease-associated gene sequences in Drosophila melanogaster. Genome Res. 2001, 11, 1114–1125. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bolus, H.; Crocker, K.; Boekhoff-Falk, G.; Chtarbanova, S. Modeling Neurodegenerative Disorders in Drosophila melanogaster. Int. J. Mol. Sci. 2020, 21, 3055. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, M.; Yoshida, H. Drosophila as a Model Organism. Adv. Exp. Med. Biol. 2018, 1076, 1–10. [Google Scholar] [PubMed]
- Holmes, R.S. Comparative studies of vertebrate iduronate 2-sulfatase (IDS) genes and proteins: Evolution of A mammalian X-linked gene. 3 Biotech 2017, 7, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Voznyi, Y.; Keulemans, J.; van Diggelen, O. A fluorimetric enzyme assay for the diagnosis of MPS II (Hunter disease). J. Inherit. Metab. Dis. 2001, 24, 675–680. [Google Scholar] [CrossRef]
- Björnsson, S. Simultaneous preparation and quantitation of proteoglycans by precipitation with alcian blue. Anal. Biochem. 1993, 210, 282–291. [Google Scholar] [CrossRef]
- Friso, A.; Tomanin, R.; Salvalaio, M.; Scarpa, M. Genistein reduces glycosaminoglycan levels in a mouse model of mucopolysaccharidosis type II. Br. J. Pharmacol. 2010, 159, 1082–1091. [Google Scholar] [CrossRef] [Green Version]
- Brooks, D.S.; Vishal, K.; Kawakami, J.; Bouyain, S.; Geisbrecht, E.R. Optimization of wrMTrck to monitor Drosophila larval locomotor activity. J. Insect Physiol. 2016, 93–94, 11–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Neufeld, E.F.; Muenzer, J. The mucopolysaccharidoses. In The Metabolic and Molecular Bases of Inherited Disease; Scriver, C.R., Ed.; McGraw-Hill: New York, NY, USA, 2001; pp. 3421–3452. [Google Scholar]
- Cheng, S.H.; Smith, A.E. Gene therapy progress and prospects: Gene therapy of lysosomal storage disorders. Gene Ther. 2003, 10, 1275–1281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muenzer, J. The mucopolysaccharidoses: A heterogeneous group of disorders with variable pediatric presentations. J. Pediatr. 2004, 144, S27–S34. [Google Scholar] [CrossRef] [PubMed]
- Pierzynowska, K.; Gaffke, L.; Podlacha, M.; Brokowska, J.; Węgrzyn, G. Mucopolysaccharidosis and Autophagy: Controversies on the Contribution of the Process to the Pathogenesis and Possible Therapeutic Applications. Neuromol. Med. 2020, 22, 25–30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scarpa, M. Mucopolysaccharidosis Type II. In GeneReviews®; Adam, M.P., Ardinger, H.H., Pagon, R.A., Wallace, S.E., Bean, L.J.H., Stephens, K., Amemiya, A., Eds.; University of Washington: Seattle, WA, USA, 1993. [Google Scholar]
Gene | Fwd Primer | Rev Primer |
---|---|---|
rp49 | GCTAAGCTGTCGCACAAATG | GTTCGATCCGTAACCGATGT |
Ids | GTTTACAGCCAGCAATCCCT | CGCCAGTAACTGTAGAAATCGT |
Atg8a | GCAAATATCCAGACCGTGTG | AGGAAGTAGAACTGACCGAC |
Lamp1 | CAACCATATCCGCAACCATCC | GTAAAGTTTCCCTCCCTAGCC |
Rab11 | ATGCGTTTGTCAGCCACAGTT | CCGGATGTTGTTGCTTTCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rigon, L.; Kucharowski, N.; Eckardt, F.; Bauer, R. Modeling Mucopolysaccharidosis Type II in the Fruit Fly by Using the RNA Interference Approach. Life 2020, 10, 263. https://doi.org/10.3390/life10110263
Rigon L, Kucharowski N, Eckardt F, Bauer R. Modeling Mucopolysaccharidosis Type II in the Fruit Fly by Using the RNA Interference Approach. Life. 2020; 10(11):263. https://doi.org/10.3390/life10110263
Chicago/Turabian StyleRigon, Laura, Nicole Kucharowski, Franka Eckardt, and Reinhard Bauer. 2020. "Modeling Mucopolysaccharidosis Type II in the Fruit Fly by Using the RNA Interference Approach" Life 10, no. 11: 263. https://doi.org/10.3390/life10110263