Euphorbia hirta Leaf Ethanol Extract Suppresses TNF-α/IFN-γ-Induced Inflammatory Response via Down-Regulating JNK or STAT1/3 Pathways in Human Keratinocytes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Cell Culture and ELE Treatment
2.3. Real-Time Reverse Transcription Polymerase Chain Reaction (RT-PCR)
2.4. Western Blot Analysis
2.5. Cytokine Analysis
2.6. Statistical Analyses
3. Results
3.1. ELE Suppressed Production and mRNA Expression of Pro-Inflammatory Cytokines in HaCaT Keratinocytes
3.2. ELE Ameliorated mRNA Expression of Pro-Inflammatory Chemokines in HaCaT Cells
3.3. ELE Inhibited Periostin Expression and Akt Phosphorylation in HaCaT Keratinocytes
3.4. ELE Ameliorated SEK1/MKK4-JNK Phosphorylation in HaCaT Keratinocytes
3.5. ELE Inhibited JAK2-STAT1/3 Activation in HaCaT Keratinocytes
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- van Smeden, J.; Bouwstra, J.A. Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients. Curr. Probl. Dermatol. 2016, 49, 8–26. [Google Scholar] [CrossRef] [PubMed]
- Wickett, R.R.; Visscher, M.O. Structure and function of the epidermal barrier. Am. J. Infect. Control 2006, 34, S98–S110. [Google Scholar] [CrossRef]
- Enk, A.H. The skin as sensor and effector organ orchestrating cutaneous and systemic disease. J. Dermatol. Sci. 2017, 87, 213–214. [Google Scholar] [CrossRef] [PubMed]
- Kersjes, W.; Harder, T.; Gugler, R.; Klauck, W. The value of x-ray signs in the follow-up of Crohn’s disease. RoFo Fortschr. Geb. Rontgenstrahlen Nukl. 1989, 150, 543–550. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Liu, J.; Chen, C.; Huang, Z.; Zang, Y.; Chen, J.; Dong, L.; Zhang, J.; Ding, Z. 3,3′-Diindolylmethane alleviates acute atopic dermatitis by regulating T cell differentiation in a mouse model. Mol. Immunol. 2021, 130, 104–112. [Google Scholar] [CrossRef]
- Ariens, L.F.M.; van Nimwegen, K.J.M.; Shams, M.; de Bruin, D.T.; van der Schaft, J.; van Os-Medendorp, H.; De Bruin-Weller, M. Economic Burden of Adult Patients with Moderate to Severe Atopic Dermatitis Indicated for Systemic Treatment. Acta Derm. -Venereol. 2019, 99, 762–768. [Google Scholar] [CrossRef] [Green Version]
- Hanel, K.H.; Cornelissen, C.; Luscher, B.; Baron, J.M. Cytokines and the skin barrier. Int. J. Mol. Sci. 2013, 14, 6720–6745. [Google Scholar] [CrossRef] [Green Version]
- Leung, D.Y.; Bieber, T. Atopic dermatitis. Lancet 2003, 361, 151–160. [Google Scholar] [CrossRef]
- An, H.J.; Kim, J.Y.; Kim, W.H.; Gwon, M.G.; Gu, H.M.; Jeon, M.J.; Han, S.M.; Pak, S.C.; Lee, C.K.; Park, I.S.; et al. Therapeutic effects of bee venom and its major component, melittin, on atopic dermatitis in vivo and in vitro. Br. J. Pharmacol. 2018, 175, 4310–4324. [Google Scholar] [CrossRef] [Green Version]
- Ali, M.Z.; Mehmood, M.H.; Saleem, M.; Gilani, A.H. The use of Euphorbia hirta L. (Euphorbiaceae) in diarrhea and constipation involves calcium antagonism and cholinergic mechanisms. BMC Complement. Med. Ther. 2020, 20, 14. [Google Scholar] [CrossRef]
- Shah, A.P.; Parmar, G.R.; Sailor, G.U.; Seth, A.K. Antimalarial Phytochemicals Identification from Euphorbia hirta against Plasmepsin Protease: An In Silico Approach. Folia Med. 2019, 61, 584–593. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ekpo, O.; Pretorius, E. Asthma, Euphorbia hirta and its anti-inflammatory properties: News & views. S. Afr. J. Sci. 2007, 103, 201–203. [Google Scholar]
- Kang, Y.M.; Lee, K.Y.; An, H.J. Inhibitory Effects of Helianthus tuberosus Ethanol Extract on Dermatophagoides farina body-induced Atopic Dermatitis Mouse Model and Human Keratinocytes. Nutrients 2018, 10, 1657. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bashir, M.M.; Sharma, M.R.; Werth, V.P. TNF-alpha production in the skin. Arch. Dermatol. Res. 2009, 301, 87–91. [Google Scholar] [CrossRef] [PubMed]
- Scheller, J.; Chalaris, A.; Schmidt-Arras, D.; Rose-John, S. The pro- and anti-inflammatory properties of the cytokine interleukin-6. Biochim. Biophys. Acta 2011, 1813, 878–888. [Google Scholar] [CrossRef] [Green Version]
- Romagnani, S. Cytokines and chemoattractants in allergic inflammation. Mol. Immunol. 2002, 38, 881–885. [Google Scholar] [CrossRef]
- Masuoka, M.; Shiraishi, H.; Ohta, S.; Suzuki, S.; Arima, K.; Aoki, S.; Toda, S.; Inagaki, N.; Kurihara, Y.; Hayashida, S.; et al. Periostin promotes chronic allergic inflammation in response to Th2 cytokines. J. Clin. Investig. 2012, 122, 2590–2600. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.; Wang, X.; Han, J.; Fan, Z.; Sadia, S.; Zhang, R.; Guo, Y.; Jiang, Y.; Wu, Y. AKT and its related molecular feature in aged mice skin. PLoS ONE 2017, 12, e0178969. [Google Scholar] [CrossRef] [Green Version]
- Park, C.H.; Min, S.Y.; Yu, H.W.; Kim, K.; Kim, S.; Lee, H.J.; Kim, J.H.; Park, Y.J. Effects of Apigenin on RBL-2H3, RAW264.7, and HaCaT Cells: Anti-Allergic, Anti-Inflammatory, and Skin-Protective Activities. Int. J. Mol. Sci. 2020, 21, 4620. [Google Scholar] [CrossRef]
- Kim, B.H.; Lee, J.M.; Jung, Y.G.; Kim, S.; Kim, T.Y. Phytosphingosine derivatives ameliorate skin inflammation by inhibiting NF-kappaB and JAK/STAT signaling in keratinocytes and mice. J. Investig. Dermatol. 2014, 134, 1023–1032. [Google Scholar] [CrossRef] [Green Version]
- Lee, K.S.; Chun, S.Y.; Lee, M.G.; Kim, S.; Jang, T.J.; Nam, K.S. The prevention of TNF-alpha/IFN-gamma mixture-induced inflammation in human keratinocyte and atopic dermatitis-like skin lesions in Nc/Nga mice by mineral-balanced deep sea water. Biomed. Pharmacother. 2018, 97, 1331–1340. [Google Scholar] [CrossRef] [PubMed]
- Frankel, H.C.; Qureshi, A.A. Comparative effectiveness of topical calcineurin inhibitors in adult patients with atopic dermatitis. Am. J. Clin. Dermatol. 2012, 13, 113–123. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, A.; Stahle, M.; Pivarcsi, A.; Sonkoly, E. Tofacitinib Represses the Janus Kinase-Signal Transducer and Activators of Transcription Signalling Pathway in Keratinocytes. Acta Derm. -Venereol. 2018, 98, 772–775. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morelli, M.; Scarponi, C.; Mercurio, L.; Facchiano, F.; Pallotta, S.; Madonna, S.; Girolomoni, G.; Albanesi, C. Selective Immunomodulation of Inflammatory Pathways in Keratinocytes by the Janus Kinase (JAK) Inhibitor Tofacitinib: Implications for the Employment of JAK-Targeting Drugs in Psoriasis. J. Immunol. Res. 2018, 2018, 7897263. [Google Scholar] [CrossRef]
- Papier, A.; Strowd, L.C. Atopic dermatitis: A review of topical nonsteroid therapy. Drugs Context 2018, 7, 212521. [Google Scholar] [CrossRef] [Green Version]
- Yousef, H.; Alhajj, M.; Sharma, S. Anatomy, Skin (Integument), Epidermis. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2021. [Google Scholar]
- Kong, L.; Liu, J.; Wang, J.; Luo, Q.; Zhang, H.; Liu, B.; Xu, F.; Pang, Q.; Liu, Y.; Dong, J. Icariin inhibits TNF-alpha/IFN-gamma induced inflammatory response via inhibition of the substance P and p38-MAPK signaling pathway in human keratinocytes. Int. Immunopharmacol. 2015, 29, 401–407. [Google Scholar] [CrossRef]
- Park, J.W.; Lee, H.S.; Lim, Y.; Paik, J.H.; Kwon, O.K.; Kim, J.H.; Paryanto, I.; Yunianto, P.; Choi, S.; Oh, S.R.; et al. Rhododendron album Blume extract inhibits TNF-alpha/IFN-gamma-induced chemokine production via blockade of NF-kappaB and JAK/STAT activation in human epidermal keratinocytes. Int. J. Mol. Med. 2018, 41, 3642–3652. [Google Scholar] [CrossRef] [Green Version]
- Živković, I.; Minić, R. Optimization, Validation and Standardization of ELISA. In ELISA Test-Perspectives and Applications; IntechOpen: London, UK, 2020. [Google Scholar]
- Koussounadis, A.; Langdon, S.P.; Um, I.H.; Harrison, D.J.; Smith, V.A. Relationship between differentially expressed mRNA and mRNA-protein correlations in a xenograft model system. Sci. Rep. 2015, 5, 10775. [Google Scholar] [CrossRef] [Green Version]
- Saeki, H.; Tamaki, K. Thymus and activation regulated chemokine (TARC)/CCL17 and skin diseases. J. Dermatol. Sci. 2006, 43, 75–84. [Google Scholar] [CrossRef]
- Pease, J.E. Targeting chemokine receptors in allergic disease. Biochem. J. 2011, 434, 11–24. [Google Scholar] [CrossRef] [Green Version]
- Srivastava, A.; Luo, L.; Lohcharoenkal, W.; Meisgen, F.; Pasquali, L.; Pivarcsi, A.; Sonkoly, E. Cross-talk between IFN-gamma and TWEAK through miR-149 amplifies skin inflammation in psoriasis. J. Allergy Clin. Immunol. 2021, 147, 2225–2235. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Guo, J.; Nong, Y.; Mo, W.; Fang, H.; Mi, J.; Qi, Q.; Yang, M. 18beta-Glycyrrhetinic acid induces human HaCaT keratinocytes apoptosis through ROS-mediated PI3K-Akt signaling pathway and ameliorates IMQ-induced psoriasis-like skin lesions in mice. BMC Pharmacol. Toxicol. 2020, 21, 41. [Google Scholar] [CrossRef] [PubMed]
- O’Shea, J.J.; Schwartz, D.M.; Villarino, A.V.; Gadina, M.; McInnes, I.B.; Laurence, A. The JAK-STAT pathway: Impact on human disease and therapeutic intervention. Annu. Rev. Med. 2015, 66, 311–328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bao, L.; Zhang, H.; Chan, L.S. The involvement of the JAK-STAT signaling pathway in chronic inflammatory skin disease atopic dermatitis. Jak-Stat 2013, 2, e24137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deng, Z.; Liu, F.; Chen, M.; Huang, C.; Xiao, W.; Gao, S.; Jian, D.; Ouyang, Y.; Xu, S.; Li, J.; et al. Keratinocyte-Immune Cell Crosstalk in a STAT1-Mediated Pathway: Novel Insights into Rosacea Pathogenesis. Front. Immunol. 2021, 12, 674871. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Li, J.; Fu, M.; Zhao, X.; Wang, W. The JAK/STAT signaling pathway: From bench to clinic. Signal Transduct. Target. Ther. 2021, 6, 402. [Google Scholar] [CrossRef]
- Chen, X.; Lin, J.; Liang, Q.; Chen, X.; Wu, Z. Pseudoephedrine alleviates atopic dermatitis-like inflammatory responses in vivo and in vitro. Life Sci. 2020, 258, 118139. [Google Scholar] [CrossRef]
- Shao, S.; Tsoi, L.C.; Sarkar, M.K.; Xing, X.; Xue, K.; Uppala, R.; Berthier, C.C.; Zeng, C.; Patrick, M.; Billi, A.C.; et al. IFN-gamma enhances cell-mediated cytotoxicity against keratinocytes via JAK2/STAT1 in lichen planus. Sci. Transl. Med. 2019, 11, eaav7561. [Google Scholar] [CrossRef]
Gene | Primer Sequences | |
---|---|---|
TNF-α (human) | Forward (5′-3′) | CGCTCCCAAGAAGACAG |
Reverse (5′-3′) | AGAGGCTGAGGAACAAGCAC | |
IL-6 (human) | Forward (5′-3′) | CCGGGAACGAAAGAGAAGCT |
Reverse (5′-3′) | AGGCGCTTGTGGAGAAGGA | |
MDC (human) | Forward (5′-3′) | AGGACAGAGCATGGATCGCCTACAGA |
Reverse (5′-3′) | TAATGGCAGGGAGGTAGGGCTCCTGA | |
RANTES (human) | Forward (5′-3′) | CCGCGGCAGCCCTCGCTGTCATCC |
Reverse (5′-3′) | CATCTCCAAAGAGTTGATGTACTCC | |
GAPDH (human) | Forward (5′-3′) | AATTCCATGGCACCGTCAAG |
Reverse (5′-3′) | ATCGCCCCACTTGATTTTGG |
Primary Antibody | Product No. | Primary Antibody | Product No. |
---|---|---|---|
p-JNK | cst #9251 | JNK | cst #9252 |
p-SEK1/MKK4 | cst #9156 | SEK1/MKK4 | cst #9152 |
p-STAT1 (Ser727) | cst #9177 | p-STAT1 (Tyr701) | cst #9167 |
p-STAT3 (Ser727) | cst #9134 | p-STAT3 (Tyr705) | cst #9145 |
STAT1 | cst #9172 | STAT3 | sc-482 |
p-JAK2 | cst #3776 | JAK2 | sc-390539 |
p-Akt | cst #9271 | Akt | sc-8312 |
periostin | sc-398631 | β-actin | sc-47778 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gil, T.-Y.; Kang, S.-C.; Jin, B.-R.; An, H.-J. Euphorbia hirta Leaf Ethanol Extract Suppresses TNF-α/IFN-γ-Induced Inflammatory Response via Down-Regulating JNK or STAT1/3 Pathways in Human Keratinocytes. Life 2022, 12, 589. https://doi.org/10.3390/life12040589
Gil T-Y, Kang S-C, Jin B-R, An H-J. Euphorbia hirta Leaf Ethanol Extract Suppresses TNF-α/IFN-γ-Induced Inflammatory Response via Down-Regulating JNK or STAT1/3 Pathways in Human Keratinocytes. Life. 2022; 12(4):589. https://doi.org/10.3390/life12040589
Chicago/Turabian StyleGil, Tae-Young, Sung-Chul Kang, Bo-Ram Jin, and Hyo-Jin An. 2022. "Euphorbia hirta Leaf Ethanol Extract Suppresses TNF-α/IFN-γ-Induced Inflammatory Response via Down-Regulating JNK or STAT1/3 Pathways in Human Keratinocytes" Life 12, no. 4: 589. https://doi.org/10.3390/life12040589