Quantitative Evaluation of Very Low Levels of HIV-1 Reverse Transcriptase by a Novel Highly Sensitive RT-qPCR Assay
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells
2.2. Generation of the RNA Template by In Vitro Transcription
2.3. Overview and Methodology of the RT-qPCR Assay
2.3.1. First Step, Reverse Transcription of gD-RNA-synt
2.3.2. Second Step, SYBR Green qPCR
2.4. Statistical Analysis
3. Results
3.1. Synthesis of a US6-Based RNA Template by In Vitro Transcription and Its Validation
3.2. Optimization of the RT Reaction Conditions to Improve the Sensitivity of Detection of the HIV-1 RT Assay
4. Discussions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Baltimore, D. RNA-dependent DNA polymerase in virions of RNA tumour viruses. Nature 1970, 226, 1209–1211. [Google Scholar] [CrossRef]
- Temin, H.M.; Mizutani, S. RNA-dependent DNA polymerase in virions of Rous sarcoma virus. Nature 1970, 226, 1211–1213. [Google Scholar] [CrossRef] [PubMed]
- Hoffman, A.D.; Banapour, B.; Levy, J.A. Characterization of the AIDS-associated retrovirus reverse transcriptase and optimal conditions for its detection in virions. Virology 1985, 147, 326–335. [Google Scholar] [CrossRef]
- Kuchta, R.D. Isotopic assays of viral polymerases and related proteins. Methods Enzym. 1996, 275, 241–257. [Google Scholar] [CrossRef]
- Brorson, K.; Xu, Y.; Swann, P.G.; Hamilton, E.; Mustafa, M.; de Wit, C.; Norling, L.A.; Stein, K.E. Evaluation of a quantitative product-enhanced reverse transcriptase assay to monitor retrovirus in mAb cell-culture. Biol. J. Int. Assoc. Biol. Stand. 2002, 30, 15–26. [Google Scholar] [CrossRef]
- Heneine, W.; Yamamoto, S.; Switzer, W.M.; Spira, T.J.; Folks, T.M. Detection of reverse transcriptase by a highly sensitive assay in sera from persons infected with human immunodeficiency virus type 1. J. Infect. Dis. 1995, 171, 1210–1216. [Google Scholar] [CrossRef]
- Lovatt, A.; Black, J.; Galbraith, D.; Doherty, I.; Moran, M.W.; Shepherd, A.J.; Griffen, A.; Bailey, A.; Wilson, N.; Smith, K.T. High throughput detection of retrovirus-associated reverse transcriptase using an improved fluorescent product enhanced reverse transcriptase assay and its comparison to conventional detection methods. J. Virol. Methods 1999, 82, 185–200. [Google Scholar] [CrossRef]
- Pyra, H.; Boni, J.; Schupbach, J. Ultrasensitive retrovirus detection by a reverse transcriptase assay based on product enhancement. Proc. Natl. Acad. Sci. USA 1994, 91, 1544–1548. [Google Scholar] [CrossRef] [Green Version]
- Sears, J.F.; Khan, A.S. Single-tube fluorescent product-enhanced reverse transcriptase assay with Ampliwax (STF-PERT) for retrovirus quantitation. J. Virol. Methods 2003, 108, 139–142. [Google Scholar] [CrossRef]
- Vermeire, J.; Naessens, E.; Vanderstraeten, H.; Landi, A.; Iannucci, V.; Van Nuffel, A.; Taghon, T.; Pizzato, M.; Verhasselt, B. Quantification of reverse transcriptase activity by real-time PCR as a fast and accurate method for titration of HIV, lenti- and retroviral vectors. PLoS ONE 2012, 7, e50859. [Google Scholar] [CrossRef]
- Marozsan, A.J.; Fraundorf, E.; Abraha, A.; Baird, H.; Moore, D.; Troyer, R.; Nankja, I.; Arts, E.J. Relationships between infectious titer, capsid protein levels, and reverse transcriptase activities of diverse human immunodeficiency virus type 1 isolates. J. Virol. 2004, 78, 11130–11141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frezza, C.; Balestrieri, E.; Marino-Merlo, F.; Mastino, A.; Macchi, B. A novel, cell-free PCR-based assay for evaluating the inhibitory activity of antiretroviral compounds against HIV reverse transcriptase. J. Med. Virol. 2014, 86, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, D.; Garcia, A.D.; Harrigan, P.R.; Johnston, I.C.; Nakasone, T.; Garcia-Lerma, J.G.; Heneine, W. Measuring enzymatic HIV-1 susceptibility to two reverse transcriptase inhibitors as a rapid and simple approach to HIV-1 drug-resistance testing. PLoS ONE 2011, 6, e22019. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, C.; Wu, Y.; Sun, Y.; Hong, C.; Xiang, K.; Guo, Y.; Bartlam, M.; Lou, Z. A novel non-radioactive assay for HIV-RT (RdDp) based on pyrosequencing for high-throughput drug screening. Protein Cell 2010, 1, 284–290. [Google Scholar] [CrossRef] [Green Version]
- Iqbal, H.S.; Balakrishnan, P.; Cecelia, A.J.; Solomon, S.; Kumarasamy, N.; Madhavan, V.; Murugavel, K.G.; Ganesh, A.K.; Solomon, S.S.; Mayer, K.H.; et al. Use of an HIV-1 reverse-transcriptase enzyme-activity assay to measure HIV-1 viral load as a potential alternative to nucleic acid-based assay for monitoring antiretroviral therapy in resource-limited settings. J. Med. Microbiol. 2007, 56, 1611–1614. [Google Scholar] [CrossRef]
- Kokkayil, P.; Kurapati, S.; Negi, N.; Vajpayee, M. Comparative evaluation of a reverse transcriptase based assay for HIV-1 viral load quantitation in resource limited settings. J. Virol. Methods 2014, 203, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, K.; Saito, T.; Kondo, M.; Osanai, M.; Watanabe, S.; Kano, T.; Kano, K.; Imai, M. Poly A-linked non-isotopic microtiter plate reverse transcriptase assay for sensitive detection of clinical human immunodeficiency virus isolates. J. Virol. Methods 1995, 55, 347–356. [Google Scholar] [CrossRef]
- Ma, Y.K.; Khan, A.S. Evaluation of different RT enzyme standards for quantitation of retroviruses using the single-tube fluorescent product-enhanced reverse transcriptase assay. J. Virol. Methods 2009, 157, 133–140. [Google Scholar] [CrossRef]
- Deeks, S.G.; Lewin, S.R.; Havlir, D.V. The end of AIDS: HIV infection as a chronic disease. Lancet 2013, 382, 1525–1533. [Google Scholar] [CrossRef] [Green Version]
- Finzi, D.; Hermankova, M.; Pierson, T.; Carruth, L.M.; Buck, C.; Chaisson, R.E.; Quinn, T.C.; Chadwick, K.; Margolick, J.; Brookmeyer, R.; et al. Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy. Science 1997, 278, 1295–1300. [Google Scholar] [CrossRef] [PubMed]
- Siliciano, J.D.; Kajdas, J.; Finzi, D.; Quinn, T.C.; Chadwick, K.; Margolick, J.B.; Kovacs, C.; Gange, S.J.; Siliciano, R.F. Long-term follow-up studies confirm the stability of the latent reservoir for HIV-1 in resting CD4+ T cells. Nat. Med. 2003, 9, 727–728. [Google Scholar] [CrossRef]
- Siliciano, J.D.; Siliciano, R.F. AIDS/HIV. Rekindled HIV infection. Science 2014, 345, 1005–1006. [Google Scholar] [CrossRef]
- Alteri, C.; Scutari, R.; Stingone, C.; Maffongelli, G.; Brugneti, M.; Falasca, F.; Martini, S.; Bertoli, A.; Turriziani, O.; Sarmati, L.; et al. Quantification of HIV-DNA and residual viremia in patients starting ART by droplet digital PCR: Their dynamic decay and correlations with immunological parameters and virological success. J. Clin. Virol. 2019, 117, 61–67. [Google Scholar] [CrossRef]
- Bailey, J.R.; Sedaghat, A.R.; Kieffer, T.; Brennan, T.; Lee, P.K.; Wind-Rotolo, M.; Haggerty, C.M.; Kamireddi, A.R.; Liu, Y.; Lee, J.; et al. Residual human immunodeficiency virus type 1 viremia in some patients on antiretroviral therapy is dominated by a small number of invariant clones rarely found in circulating CD4+ T cells. J. Virol. 2006, 80, 6441–6457. [Google Scholar] [CrossRef] [Green Version]
- Bui, J.K.; Sobolewski, M.D.; Keele, B.F.; Spindler, J.; Musick, A.; Wiegand, A.; Luke, B.T.; Shao, W.; Hughes, S.H.; Coffin, J.M.; et al. Proviruses with identical sequences comprise a large fraction of the replication-competent HIV reservoir. PLoS Pathog. 2017, 13, e1006283. [Google Scholar] [CrossRef]
- Carter, C.C.; Onafuwa-Nuga, A.; McNamara, L.A.; Riddell, J., IV.; Bixby, D.; Savona, M.R.; Collins, K.L. HIV-1 infects multipotent progenitor cells causing cell death and establishing latent cellular reservoirs. Nat. Med. 2010, 16, 446–451. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cole, B.; Lambrechts, L.; Gantner, P.; Noppe, Y.; Bonine, N.; Witkowski, W.; Chen, L.; Palmer, S.; Mullins, J.I.; Chomont, N.; et al. In-depth single-cell analysis of translation-competent HIV-1 reservoirs identifies cellular sources of plasma viremia. Nat. Commun. 2021, 12, 3727. [Google Scholar] [CrossRef] [PubMed]
- Ho, Y.C.; Shan, L.; Hosmane, N.N.; Wang, J.; Laskey, S.B.; Rosenbloom, D.I.; Lai, J.; Blankson, J.N.; Siliciano, J.D.; Siliciano, R.F. Replication-competent noninduced proviruses in the latent reservoir increase barrier to HIV-1 cure. Cell 2013, 155, 540–551. [Google Scholar] [CrossRef] [Green Version]
- Huang, A.S.; Ramos, V.; Oliveira, T.Y.; Gaebler, C.; Jankovic, M.; Nussenzweig, M.C.; Cohn, L.B. Integration features of intact latent HIV-1 in CD4+ T cell clones contribute to viral persistence. J. Exp. Med. 2021, 218, e20211427. [Google Scholar] [CrossRef] [PubMed]
- Lorenzo-Redondo, R.; Fryer, H.R.; Bedford, T.; Kim, E.Y.; Archer, J.; Pond, S.L.K.; Chung, Y.S.; Penugonda, S.; Chipman, J.; Fletcher, C.V.; et al. Persistent HIV-1 replication maintains the tissue reservoir during therapy. Nature 2016, 530, 51–56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Palmer, S.; Maldarelli, F.; Wiegand, A.; Bernstein, B.; Hanna, G.J.; Brun, S.C.; Kempf, D.J.; Mellors, J.W.; Coffin, J.M.; King, M.S. Low-level viremia persists for at least 7 years in patients on suppressive antiretroviral therapy. Proc. Natl. Acad. Sci. USA 2008, 105, 3879–3884. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schnittman, S.M.; Psallidopoulos, M.C.; Lane, H.C.; Thompson, L.; Baseler, M.; Massari, F.; Fox, C.H.; Salzman, N.P.; Fauci, A.S. The reservoir for HIV-1 in human peripheral blood is a T cell that maintains expression of CD4. Science 1989, 245, 305–308. [Google Scholar] [CrossRef]
- Simonetti, F.R.; Zhang, H.; Soroosh, G.P.; Duan, J.; Rhodehouse, K.; Hill, A.L.; Beg, S.A.; McCormick, K.; Raymond, H.E.; Nobles, C.L.; et al. Antigen-driven clonal selection shapes the persistence of HIV-1-infected CD4+ T cells in vivo. J. Clin. Investig. 2021, 131, e145254. [Google Scholar] [CrossRef]
- Bachmann, N.; von Siebenthal, C.; Vongrad, V.; Turk, T.; Neumann, K.; Beerenwinkel, N.; Bogojeska, J.; Fellay, J.; Roth, V.; Kok, Y.L.; et al. Determinants of HIV-1 reservoir size and long-term dynamics during suppressive ART. Nat. Commun. 2019, 10, 3193. [Google Scholar] [CrossRef] [Green Version]
- Suzuki, K.; Levert, A.; Yeung, J.; Starr, M.; Cameron, J.; Williams, R.; Rismanto, N.; Stark, T.; Druery, D.; Prasad, S.; et al. HIV-1 viral blips are associated with repeated and increasingly high levels of cell-associated HIV-1 RNA transcriptional activity. AIDS 2021, 35, 2095–2103. [Google Scholar] [CrossRef]
- Avettand-Fenoel, V.; Boufassa, F.; Galimand, J.; Meyer, L.; Rouzioux, C.; Group, A.S.C.S. HIV-1 DNA for the measurement of the HIV reservoir is predictive of disease progression in seroconverters whatever the mode of result expression is. J. Clin. Virol. 2008, 42, 399–404. [Google Scholar] [CrossRef] [PubMed]
- Bruner, K.M.; Murray, A.J.; Pollack, R.A.; Soliman, M.G.; Laskey, S.B.; Capoferri, A.A.; Lai, J.; Strain, M.C.; Lada, S.M.; Hoh, R.; et al. Defective proviruses rapidly accumulate during acute HIV-1 infection. Nat. Med. 2016, 22, 1043–1049. [Google Scholar] [CrossRef] [Green Version]
- Gaebler, C.; Falcinelli, S.D.; Stoffel, E.; Read, J.; Murtagh, R.; Oliveira, T.Y.; Ramos, V.; Lorenzi, J.C.C.; Kirchherr, J.; James, K.S.; et al. Sequence Evaluation and Comparative Analysis of Novel Assays for Intact Proviral HIV-1 DNA. J. Virol. 2021, 95, e01986-20. [Google Scholar] [CrossRef]
- Gaebler, C.; Lorenzi, J.C.C.; Oliveira, T.Y.; Nogueira, L.; Ramos, V.; Lu, C.L.; Pai, J.A.; Mendoza, P.; Jankovic, M.; Caskey, M.; et al. Combination of quadruplex qPCR and next-generation sequencing for qualitative and quantitative analysis of the HIV-1 latent reservoir. J. Exp. Med. 2019, 216, 2253–2264. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jacobs, J.L.; Tosiano, M.A.; Koontz, D.L.; Staines, B.; Worlock, A.; Harrington, K.; Bakkour, S.; Stone, M.; Shutt, K.; Busch, M.P.; et al. Automated Multireplicate Quantification of Persistent HIV-1 Viremia in Individuals on Antiretroviral Therapy. J. Clin. Microbiol. 2020, 58, e01442-20. [Google Scholar] [CrossRef] [PubMed]
- Levy, C.N.; Hughes, S.M.; Roychoudhury, P.; Reeves, D.B.; Amstuz, C.; Zhu, H.; Huang, M.L.; Wei, Y.; Bull, M.E.; Cassidy, N.A.J.; et al. A highly multiplexed droplet digital PCR assay to measure the intact HIV-1 proviral reservoir. Cell Rep. Med. 2021, 2, 100243. [Google Scholar] [CrossRef]
- Poon, A.F.Y.; Prodger, J.L.; Lynch, B.A.; Lai, J.; Reynolds, S.J.; Kasule, J.; Capoferri, A.A.; Lamers, S.L.; Rodriguez, C.W.; Bruno, D.; et al. Quantitation of the latent HIV-1 reservoir from the sequence diversity in viral outgrowth assays. Retrovirology 2018, 15, 47. [Google Scholar] [CrossRef]
- Malatinkova, E.; Thomas, J.; De Spiegelaere, W.; Rutsaert, S.; Geretti, A.M.; Pollakis, G.; Paxton, W.A.; Vandekerckhove, L.; Ruggiero, A. Measuring Proviral HIV-1 DNA: Hurdles and Improvements to an Assay Monitoring Integration Events Utilising Human Alu Repeat Sequences. Life 2021, 11, 1410. [Google Scholar] [CrossRef] [PubMed]
- Macchi, B.; Frezza, C.; Marino-Merlo, F.; Minutolo, A.; Stefanizzi, V.; Balestrieri, E.; Cerva, C.; Sarmati, L.; Andreoni, M.; Grelli, S.; et al. Appraisal of a Simple and Effective RT-qPCR Assay for Evaluating the Reverse Transcriptase Activity in Blood Samples from HIV-1 Patients. Pathogens 2020, 9, 1047. [Google Scholar] [CrossRef]
- Macchi, B.; Balestrieri, E.; Frezza, C.; Grelli, S.; Valletta, E.; Marcais, A.; Marino-Merlo, F.; Turpin, J.; Bangham, C.R.; Hermine, O.; et al. Quantification of HTLV-1 reverse transcriptase activity in ATL patients treated with zidovudine and interferon-alpha. Blood Adv. 2017, 1, 748–752. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marino-Merlo, F.; Frezza, C.; Papaianni, E.; Valletta, E.; Mastino, A.; Macchi, B. Development and evaluation of a simple and effective RT-qPCR inhibitory assay for detection of the efficacy of compounds towards HIV reverse transcriptase. Appl. Microbiol. Biotechnol. 2017, 101, 8249–8258. [Google Scholar] [CrossRef]
- Medici, M.A.; Sciortino, M.T.; Perri, D.; Amici, C.; Avitabile, E.; Ciotti, M.; Balestrieri, E.; De Smaele, E.; Franzoso, G.; Mastino, A. Protection by herpes simplex virus glycoprotein D against Fas-mediated apoptosis: Role of nuclear factor kappaB. J. Biol. Chem. 2003, 278, 36059–36067. [Google Scholar] [CrossRef] [Green Version]
- Sciortino, M.T.; Medici, M.A.; Marino-Merlo, F.; Zaccaria, D.; Giuffre-Cuculletto, M.; Venuti, A.; Grelli, S.; Mastino, A. Involvement of HVEM receptor in activation of nuclear factor kappaB by herpes simplex virus 1 glycoprotein D. Cell Microbiol. 2008, 10, 2297–2311. [Google Scholar] [CrossRef] [PubMed]
- Rutledge, R.G.; Cote, C. Mathematics of quantitative kinetic PCR and the application of standard curves. Nucleic Acids Res. 2003, 31, e93. [Google Scholar] [CrossRef]
Primer Identification | 5′ > 3′ Sequence | Amplicon Size (bp) |
---|---|---|
T7pw | GAAATTAATACGACTCACTATAGGGAGA | 568 |
gDc9Rev | CCCAGGTTATCCTCGCTGAC | |
gDc9Fw | CTTTCGCGGCAAAGACCTTC | 403 |
gDc9Rev | CCCAGGTTATCCTCGCTGAC |
Identification Number | Dilution | Starting Quantity per Reaction (Copies cDNA) |
---|---|---|
1 | Undiluted | 105 1 |
2 | 1:10 | 104 |
3 | 1:100 | 103 |
4 | 1:1000 | 102 |
5 | 1:10,000 | 101 |
6 | 1:100,000 | 100 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marino-Merlo, F.; Stefanizzi, V.; Ragno, A.; Piredda, L.; Grelli, S.; Macchi, B.; Mastino, A. Quantitative Evaluation of Very Low Levels of HIV-1 Reverse Transcriptase by a Novel Highly Sensitive RT-qPCR Assay. Life 2022, 12, 1130. https://doi.org/10.3390/life12081130
Marino-Merlo F, Stefanizzi V, Ragno A, Piredda L, Grelli S, Macchi B, Mastino A. Quantitative Evaluation of Very Low Levels of HIV-1 Reverse Transcriptase by a Novel Highly Sensitive RT-qPCR Assay. Life. 2022; 12(8):1130. https://doi.org/10.3390/life12081130
Chicago/Turabian StyleMarino-Merlo, Francesca, Valeria Stefanizzi, Agnese Ragno, Lucia Piredda, Sandro Grelli, Beatrice Macchi, and Antonio Mastino. 2022. "Quantitative Evaluation of Very Low Levels of HIV-1 Reverse Transcriptase by a Novel Highly Sensitive RT-qPCR Assay" Life 12, no. 8: 1130. https://doi.org/10.3390/life12081130