Next Article in Journal
The Joint Link of the rs1051730 and rs1902341 Polymorphisms and Cigarette Smoking to Peripheral Artery Disease and Atherosclerotic Lesions of Different Arterial Beds
Next Article in Special Issue
Molecular Identification of Bacteria Isolated from Marketed Sparus aurata and Penaeus indicus Sea Products: Antibiotic Resistance Profiling and Evaluation of Biofilm Formation
Previous Article in Journal
Rapid Onsite Visual Detection of Orf Virus Using a Recombinase-Aided Amplification Assay
Previous Article in Special Issue
Therapeutic Strategies against Biofilm Infections
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Life
Volume 13
Issue 2
10.3390/life13020495
life-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biofilm Formation Capacity and Presence of Virulence Determinants among Enterococcus Species from Milk and Raw Milk Cheeses

by
Joanna Gajewska
1,*,
Wioleta Chajęcka-Wierzchowska
1,
Zuzanna Byczkowska-Rostkowska
1 and
Morteza Saki
2
1
Department of Industrial and Food Microbiology, Faculty of Food Science, University of Warmia and Mazury in Olsztyn, Plac Cieszyński 1, 10-726 Olsztyn, Poland
2
Department of Microbiology, Faculty of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
*
Author to whom correspondence should be addressed.
Life 2023, 13(2), 495; https://doi.org/10.3390/life13020495
Submission received: 28 December 2022 / Revised: 3 February 2023 / Accepted: 8 February 2023 / Published: 10 February 2023
(This article belongs to the Special Issue Antibiotic Resistance in Biofilm)
Versions Notes

Abstract

:
Bacterial biofilm is one of the major hazards facing the food industry. Biofilm-forming ability is one of the most important virulence properties of enterococci. The genus Enterococcus includes pathogenic, spoilage, and pro-technological bacteria. The presence of enterococci in milk and dairy products is usually associated with inadequate hygiene practices. The study examined the isolates’ capacity for biofilm formation and identification of the genetic determinants of its formation among 85 Enterococcus strains isolated from raw milk (n = 49) and soft-ripened cheeses made from unpasteurized milk (n = 36). E. faecalis and E. faecium were the dominant species. The obtained results showed that 41.4% isolates from milk and 50.0% isolates from cheeses were able to form biofilm. All of the isolates analyzed had at least one of the studied genes. As regards the isolates from raw milk, the most prevalent gene was the gelE (85.6%), followed by the asa1 (66.7%). None of the isolates from cheeses showed the presence of cylA and sprE. The most prevalent gene among the strains from this source was the epbC (94.4%), followed by the gelE (88.9%). In isolates from both sources, the presence of proteins from the Fsr group was noted the least frequently. Nevertheless, results showed that were no significant differences between the biofilm-producing Enterococcus spp. and non-biofilm-producing isolates in term of occurrences of tested virulence genes. The ability to produce a biofilm by enterococci isolated from raw milk or ready-to-eat products emphasizes the need for continuous monitoring of the mechanisms of microbial adhesion.

1. Introduction

Bacteria of the genus Enterococcus are a microorganism group widespread in the natural environment. Their common occurrence in water or soil results in the contamination of raw materials and products of both animal and plant origin. The causes of contamination of plant raw materials with these microorganisms include improper natural fertilization or the use of fecally contaminated water to irrigate crops. However, the contamination of raw materials of animal origin is caused by animal breeding and slaughtering under inappropriate conditions with disregard for the basic rules of hygiene [1,2]. Due to their high resistance to temperature, enterococci are regarded as an indicator of the hygiene of the food production process. Nevertheless, pursuant to Commission Regulation (EC) No. 2073/2005 of 15 November 2005 on microbiological criteria for foodstuffs, the determination of the presence of these microorganisms in food is not required in European Union countries [3]. Due to the high survival rate of the Enterococcus spp. cells, the food production process does not condition the elimination of all microbial cells from the raw material. As a result, these bacteria become part of the residual microflora of the finished products [4]. This concerns even highly processed products whose production involves many stages [5].
The biofilm-forming ability is among the most important virulence properties of the Enterococcus [6,7]. Biofilm is a population of cells attached to various biotic and abiotic surfaces and is encapsulated in a hydrated matrix of exopolymeric substances, proteins, polysaccharides, and nucleic acids. The biofilm structure provides an optimal environment for bacterial growth and facilitates the transfer of mobile genetic elements between different bacterial species [8]. Many proteins are involved in biofilm formation by the Enterococcus. The literature data indicate that the specific Enterococcal Surface protein Esp is crucial for the biofilm formation by these strains. Esp is associated with the bacterial cell wall, as it is involved in cell adhesion to the surface. Enterococcus faecalis strains with mutations in the esp gene lose their ability to produce a biofilm under in vitro conditions [9]. However, other studies suggest that the presence of esp is not necessary for the biofilm formation in E. faecium and E. faecalis strains [10,11]. Another protein reported to be involved in the biofilm formation is gelatinase (GelE), which can hydrolyze gelatin, collagen, and hemoglobin [6,12]. However, despite these reports, the authors demonstrated no association between biofilm formation and the presence of the gelE [13]. A study by Chuang-Smith and colleagues [14] showed that the presence of an aggregating substance (Agg) among the E. faecalis species promoted biofilm formation. In addition, the following are involved in the biofilm formation: E. faecalis endocarditis-associated antigen A (EfaA), adhesion of collagen of E. faecalis (Ace), biofilm on plastic operon (Bop), and serine protease (SprE) [15]. Additionally, in their work, Nallapareddy et al. [15] also demonstrated that the epbA, ebpB, and ebpC (endocarditis and biofilm-associated pili genetic) form the ebpABC operon, and the srt (pilus-associated sortase) were genes that substantially affected the biofilm formation in E. faecalis strains.
An important role in biofilm formation is played by the phenomenon of quorum sensing, which is regulated by the fsr (fecal streptococci regulator) operon containing three genes: fsrA, fsrB, and fsrC [16]. It is worth noting that besides quorum sensing, bacteria of the genus Enterococcus spp. can communicate with each other using peptide pheromones encoded by the cpd, cob, and ccf.
Biofilm formation by microorganisms found in the food production chain is among the major hazards facing the food industry. The presence of biofilms on work surfaces may result in the contamination of food products with both spoilage and pathogenic microorganisms [17]. Many Enterococcus strains can form biofilms on food contact surfaces, which improve bacteria’s resistance to environmental stress [18]. It is worth noting that the modernity of the equipment used in the dairy industry and, consequently, the long-lasting production cycles and the associated extensive surfaces of materials in direct contact with foods, provide favorable conditions for the unhindered formation and development of a bacterial biofilm.
In view of the above, the study aimed to assess the biofilm-producing ability of the Enterococcus spp. strains isolated from raw milk and cheeses made from unpasteurized milk, and to identify the genetic factors responsible for biofilm formation.

2. Materials and Methods

2.1. Sample Collection and Identification of Enterococci Strains

The material for the study comprised 85 isolates identified to genus Enterococcus, belonging to the Department of Industrial and Food Microbiology collection. They were isolated from raw milk and raw milk cheeses using standard protocols. Strain identification was performed using a matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) instrument (Biomerieux) according to manufacturing instructions, as described previously [19,20].

2.2. Congo Red Agar (CRA) Assay

The investigation of slime production by the Congo red agar assay was determined using a method described by Freeman et al. [21]. Fresh, 24 h colonies were streaked into CRA plates. The plates were incubated for 24 h at 37 °C. On the basis of colony color, the strains were classified as follows black—as slime producers, Bordeaux, or red—as non-slime-producing strains.

2.3. Biofilm Production by Microtiter Plate Assay (MTP)

The ability to form biofilm was tested on 96-well, flat-bottomed, sterile polystyrene plates (Promed®) according to Stepanović et al. [22], as described previously [19,23]. Absorbance at 570 nm wavelength was measured with spectrophotometric microplate reader Varioscan LUX (Thermo Scientific, Waltham, MA, USA). Wells containing broth only were used as negative control. Optical densities (ODs) for each test strain were determined from the arithmetic mean of 3 replicates. The value obtained was compared with the cut-off value (ODc). ODc is defined as three standard deviations above the mean OD of the negative control. Based on the results, the isolates were classified as: non-biofilm producers (OD ≤ ODc); weak biofilm producers (ODc < OD ≤ 2 × ODc); moderate biofilm producers (2 × ODc < OD ≤ 4 × ODc); and strong biofilm producers (4 × ODc < OD).

2.4. Detection of Biofilm-Associated Genes and Virulence Factors

The biofilm-associated genes and virulence factors were amplified by polymerase chain reaction (PCR) using published specific primers and conditions [16,24,25,26,27,28] (Table 1). Amplified products were resolved by 1.5% agarose gel electrophoresis in 1× TBE (Tris-borate-EDTA) buffer stained by 0.5μg/mL of ethidium bromide (0.5 mg/mL; Sigma-Aldrich) and visualized using the system for the documentation and analysis of fluorescently stained gels G-BOX F3 (Syngene. Cambridge, UK).

2.5. Statistical Analysis

All statistical analyses were performed using GraphPad Prism software version 8.0 (GRAPH PAD software Inc., San Diego, CA, USA). Results were considered statistically significant with p < 0.05.

3. Results

3.1. Identification of Enterococci Strains

Using the MALDI-TOF MS technique, 85 isolates from raw milk and raw milk cheeses were classified as E. faecalis (71; 83.5%), E. faecium (10; 11.8%) E. gallinarum (3; 3.5%), and E. casseliflavus (1; 1.2%) Among the strains isolated from both sources, the E. faecalis species was dominant (Table 2).

3.2. Biofilm and Slime-Forming Ability

A strong biofilm was formed by 36 (73.5%) milk isolates. None of the strains formed a weak biofilm, while one isolate (2%), belonging to the species E. faecalis, formed a moderate biofilm. No ability to form a biofilm was exhibited by 24.5% of raw milk isolates (Table 3). In half of the Enterococcus spp. isolated from raw milk cheeses (n = 18; 50.0%), no biofilm-producing ability was observed, while 17 isolates (47.2%) produced a strong biofilm. None of the cheese isolates produced a moderate biofilm (Table 3). It is noteworthy that the majority of strains belonging to the species E. faecium (n = 4; 80.0%) from cheeses produced a strong biofilm, while the E. faecium from raw milk failed to exhibit this ability. It is noteworthy that the species E. casseliflavus and E. gallinarum were able to form biofilm. Nevertheless, no statistically significant differences were found between the enterococci species and the ability to produce biofilm (p = 0.913202) and ability for slime production (p = 0.68592).
The slime-forming ability, determined by the CRA method, was detected among 21/42.9% and 20/55.6% strains isolated from raw milk and raw milk cheeses, respectively (Table 3). As for the strains E. faecalis and E. galinarum, a different tendency to produce a slime on the CRA was shown. As compared to the isolates from raw milk, this ability was exhibited by 55.2% and 100.0% of the isolates, respectively. The statistical analysis showed no correlation between the biofilm production ability of the MTP method and slime production (p = 0.616472).

3.3. Presence of Biofilm-Associated and Virulence Genes

The results obtained from molecular analysis of different biofilm-associated and virulence determinants are presented in Table 4. The most prevalent gene among all tested enterococci strains was the gelatinase-encoding gelE (81.7%, n = 74/85). The esp protein, considered by many researchers to be responsible for the biofilm formation, was found in approximately one third (32.9%, n = 28/85) of all the studied enterococcal isolates. The least prevalent proteins among all the isolates were sprE, cylA, and fsrA, with frequencies of 1.2% (n =1/85), 2.4% (n = 2/85), and 7.1% (n = 6/85), respectively.
Among strains from raw milk, the gelE was demonstrated in 85.7% of the E. faecalis and 80% of E. faecium isolates, as well as in E. casseliflavus and E. gallinarum isolates isolated from raw milk. Another highly prevalent gene found among the isolates from raw milk was the asa1, demonstrated in 66.7% of E. faecalis strains and in 50% of other species. Among strains from this source, the least frequent genes were cylA, fsrB, and sprE, with frequencies of 4.1%, 6.1%, and 2.4%, respectively.
Among enterococcal strains from cheeses, our results showed that the most prevalent gene was the epbC, which was detected in 94.4% of all isolates. In detail, 96.6% of E. faecalis, 80.0% of E. faecium, and 100% of E. gallinarum isolates. The second most prevalent protein among the isolates from this source was the gelE (88.9%) of all isolates. Those with the lowest frequency among isolates from this source were the fsrA and fsrB operon genes responsible for the quorum sensing in bacteria of this genera. The presence of cylA and sprE was not demonstrated in any of the studied isolates from cheese samples.
It is worth noting that for this source of isolation, the statistical analysis showed an association exclusively between the presence of the esp and the biofilm-producing ability (p < 0.05).
Moreover, having considered the source of isolation (raw milk vs cheeses from unpasteurized milk) of all strains from the genus Enterococcus spp., an association between the source of isolation and the presence of studied genes ebpC, pil, srt, and sprE was revealed at the significance level α = 0.05. Additionally, the results showed that there are no significant differences between the biofilm-producing Enterococcus spp. and non-biofilm-producing isolates in term of occurrences of virulence genes (Table 5). In addition, correlation analysis for all pairs (between virulence genes and biofilm formation) among all tested enterococci has been shown in Figure S1.
Biofilm producers were recognized as strong, intermediate, and weak biofilm-producing strains.

4. Discussion

Enterococci represents one of the most controversial groups of bacteria. Enterococcus genus is highly prevalent in foods, especially those of animal origin. Enterococci are characterized by resistance to different conditions during food production and storage, and their high adaptability [29]. The increasing enterococcal resistance to antimicrobial agents and the ability to form a biofilm crucially increases the pathogenic potential of this genus. Moreover, biofilm formation can also act as persistent sources of contamination, leading to hygiene problems in food products [30].
For many years there has been a lack of literature data on the biofilm production capacity of Enterococcus spp. isolated from food. Most studies on enterococci have focused exclusively on clinical strains isolated from implants, catheters, or human bodily fluids [16,31]. Given the ubiquity of enterococci in the environment and their resistance to adverse environmental conditions, they have become the predominant microflora responsible for contamination of food. However, due to the increasing resistance of these strains to antimicrobial agents, combined with their remarkable ability to acquire and transfer virulence genes, many researchers have also started to consider food as a source of virulent enterococcal strains [32,33]. Despite recent findings that enterococcal pathogenesis is a strain-dependent trait and occurs more frequently in clinical enterococci than in foodborne enterococci], it is worth emphasizing that enterococcal species do not have a status generally recognized as safe (GRAS) [34].
It is alarming that in the food production environment, where bacteria have ideal conditions for their development, biofilm formation has the potential for transferring resistance factors [35]. The lack of appropriate cleaning and disinfection procedures to be applied immediately after the technological process largely contributes to bacterial growth in the form of biofilms in which, after reaching a critical thickness, bacterial cells may detach and migrate into the environment [36,37]. These bacteria can easily migrate long distances along the production line, which results in equipment failure and food spoilage and can pose a health hazard if they reach batches of food distributed among consumers. The presence of other pathogens such as Staphylococcus aureus in cheeses can increase the virulence of E. faecalis, which is a major problem [2]. Therefore, it is important to understand the mechanism responsible for enterococcal adhesion, to prevent biofilm formation on the surfaces of the food industry equipment in the future and thus the contamination of the finished products with virulent strains.
Enterococcus spp. are one of the most common lactic acid bacteria in raw milk, with E. faecium and E. faecalis being predominant [30], which can come from animals, dairy environment, and humans [4]. In the current study, the dominant species in both sources of isolation was E. faecalis followed by E. faecium, which coincides with the results of other studies [33,38,39]. However, Fuka et al. [40] isolated more E. faecalis strains from raw milk samples, with the artisan cheese samples mostly being a source of strains of the species E. faecium.
In recent years, biofilm has become a worldwide public health. According to the literature data, it is worth noting that many Enterococcus strains can build biofilms on food contact surfaces [18]. In the current study, 73.5% isolates from raw milk and 47.2% isolates from cheeses exhibited great biofilm-forming ability. Some authors concluded that the biofilm-forming ability was more prevalent among E. faecalis isolates than among other species [41,42,43]. However, this is not reflected in the results obtained in the current study.
Bacterial virulence factors may be either colonization factors, like those promoting bacterial adhesion to the host cells, or an invasive factor which promotes the invasion of epithelial cells that disrupt the immune system. Several surface proteins anchored in the cell wall are involved in enterococcal pathogenicity, including the aggregating substance, the enterococcal surface protein, and collagen-binding components [44]. Proteins such as hyaluronidase can interact with lymphocyte receptors and induce autoimmune diseases. Cytolysin, on the other hand, is an exotoxin with bifunctional bacteriocin and hemolytic activity [45,46].
According to Di Rosa et al. [47], biofilm formation can be modulated by environmental conditions, gelatinase activity, and the presence of the esp gene. However, it is worth stressing that the joint action of several parameters (time, temperature, nutrients, genetic factors) can be more critical compared to a single factor [48,49]. However, in the light of numerous literature data, gelE has been recognized as a factor unrelated to biofilm formation [13,50,51,52], which was confirmed by the results of the current study. Moreover, a statistical analysis of the obtained results demonstrated, for both isolates from raw milk and cheeses, a relationship between the biofilm formation and the presence of the esp gene. Despite this, these results are not consistent with previous reports on the biofilm formation by the isolates lacking this gene [11,53]. The lack of biofilm-forming ability among half of the enterococci isolated from cheeses may be due to the presence of sodium chloride in a cheese (up to 4%) and its high acidity [54].
A variety of virulence factors have been described in enterococci, mostly in E. faecalis and E. faecium [55]. The enterococcal virulence factors may be classified into two groups: surface proteins and secreted metabolites that damage the host’s tissues [4,52]. Among them we can distinguish, e.g., gelatinase (gelE, fsrA, fsrB, fsrC, sprE), adhesins (ace), aggregating substance (agg, asa1), cytolysin operon (cylA), endocarditis and biofilm-associated pili (ebpA, ebpB, ebpC), and sex pheromones (cpd, cob, ccf) [23,56]. In the current study, the most frequently found virulence gene was the ebpC gene that co-participates in the formation of the pili, which was followed, in terms of prevalence, by the gelE gene responsible for the production of gelatinase [57]. Gomes et al. [39] demonstrated that most genetic virulence determinants (gelE, esp, ace, efaA, cylA) occurred with a higher frequency among E. faecalis strains. Moreover, these genes were more prevalent in isolates from cheeses than those from raw milk. Nevertheless, the results of the study demonstrated no correlation between the occurrences of these genes, depending on the species of Enterococcus spp. In a study by Fuka et al. [40], the strains isolated from milk samples were more virulent than the strains derived from cheeses. However, in a study conducted by Pereira and colleagues [41], the most frequently found virulence genes included ace, agg, and gelE. Moreover, these authors demonstrated that they were much more frequently found in E. faecalis strains.
It is worth emphasizing that the occurrence or absence of a gene does not directly indicate that the encoded protein plays a role in the ability of enterococcal strains to form a biofilm. Each stress factor during food preservation and/or food processing could cause changes in the virulence of the strain. Among stress factors, chemical factors (organic acids, ethanol, and salt) or physical factors (high and low temperature, high pressure) may be mentioned [58]. The literature data indicate that the biofilm formed on equipment surfaces in the dairy industry adversely affects the safety of the finished product. Bacterial cells present in raw milk can attach to, and grow on, the surfaces of dairy equipment. The presence of milk residues in milking equipment and storage tanks contributes to the adhesion of cells and bacterial growth [59,60]. The results of this study confirmed that Enterococcus spp. can produce biofilm, which is one of the fundamental problems for the dairy industry. Of note, Enterococcus spp. genus does not have GRAS status. Therefore, in the food chain, the pathogenic potential of enterococci is of concern due to their ability to form biofilm and the occurrence of virulence genes, along with their potential to harbor and transfer virulence to other pathogens based on horizontal gene transfer.

5. Conclusions

Our results showed that E. faecalis was a predominant species among Enterococcus spp. isolated from raw milk and cheese samples. The obtained results showed that 41.4% isolates from milk and 50.0% isolates from cheeses were able to form biofilm. Moreover, the results of this study showed that the presence of pathogenic factors such as the gelE, cylA, agg, ebpA, ebpB, pil among milk isolates, and asa1, ebpC, srt, fsrA, fsrB among cheeses isolates, did not seem to be necessary or sufficient for the formation of biofilm by enterococci in the analyzed conditions. Enterococci are not highly virulent. Nevertheless, the results of our study suggest that it is important to control and monitor Enterococcus isolates that harbor adhesion genes to improve food and food production safety.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/life13020495/s1, Figure S1: Correlation between all pairs of tested virulence genes, slime production and biofilm formation among all tested enterococci.

Author Contributions

Conceptualization: J.G., W.C.-W.; methodology: J.G., W.C.-W.; validation: J.G., W.C.-W., M.S.; formal analysis, J.G.; investigation: J.G., Z.B.-R., M.S.; data curation: J.G., M.S., Z.B.-R.; writing—original draft preparation, J.G.; writing—review and editing, W.C.-W., M.S.; visualization: J.G.; supervision W.C.-W. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Moreno, M.R.F.; Sarantinopoulos, P.; Tsakalidou, E.; De Vuyst, L. The role and application of enterococci in food and health. Int. J. Food Microbiol. 2006, 106, 1–24. [Google Scholar] [CrossRef] [PubMed]
  2. Giraffa, G. Enterococci from foods. FEMS Microbiol. Rev. 2002, 26, 163–171. [Google Scholar] [CrossRef] [PubMed]
  3. Rozanska, H.; Lewtak-Pilat, A.; Osek, J. Enterokoki—Bakterie o wielu obliczach. Życie Weter. 2013, 88, 562–564. [Google Scholar]
  4. de Lurdes Enes Dapkevicius, M.; Sgardioli, B.; Câmara, S.P.A.; Poeta, P.; Malcata, F.X. Current trends of enterococci in dairy products: A comprehensive review of their multiple roles. Foods 2021, 10, 821. [Google Scholar] [CrossRef]
  5. Van Den Berghe, E.; De Winter, T.; De Vuyst, L. Enterocin A production by Enterococcus faecium FAIR-E 406 is characterised by a temperature- and pH-dependent switch-off mechanism when growth is limited due to nutrient depletion. Int. J. Food Microbiol. 2006, 107, 159–170. [Google Scholar] [CrossRef]
  6. Lee, Y. Biofilm formation and antimicrobial resistance in Enterococcus. Infect. Chemother. 2017, 49, 236–237. [Google Scholar] [CrossRef]
  7. El-Zamkan, M.A.; Mohamed, H.M.A. Antimicrobial resistance, virulence genes and biofilm formation in Enterococcus species isolated from milk of sheep and goat with subclinical mastitis. PLoS ONE 2021, 16, e0259584. [Google Scholar] [CrossRef] [PubMed]
  8. Sieńko, A.; Wieczorek, P.; Majewski, P.; Ojdana, D.; Wieczorek, A.; Olszańska, D.; Tryniszewska, E. Comparison of antibiotic resistance and virulence between biofilm-producing and non-producing clinical isolates of Enterococcus faecium. Acta Biochim. Pol. 2015, 62, 859–866. [Google Scholar] [CrossRef]
  9. Prazmo, E.; Godlewska, R.; Kwasny, M.; Mielczarek, A. Udział czynników wirulencji Enterococcus faecalis w rozwoju chorób miazgi i tkanek okołowierzchołkowych. Postępy Mikrobiol. 2016, 55, 247–254. [Google Scholar]
  10. Duprè, I.; Zanetti, S.; Schito, A.M.; Fadda, G.; Sechi, L.A. Incidence of virulence determinants in clinical Enterococcus faecium and Enterococcus faecalis isolates collected in Sardinia (Italy). J. Med. Microbiol. 2003, 52, 491–498. [Google Scholar] [CrossRef]
  11. Sandoe, J.A.T.; Witherden, I.R.; Cove, J.H.; Heritage, J.; Wilcox, M.H. Correlation between enterococcal biofilm formation in vitro and medical-device-related infection potential in vivo. J. Med. Microbiol. 2003, 52, 547–550. [Google Scholar] [CrossRef]
  12. Shin, Y.P.; Kyoung, M.K.; Joon, H.L.; Sook, J.S.; In, H.L. Extracellular gelatinase of Enterococcus faecalis destroys a defense system in insect hemolymph and human serum. Infect. Immun. 2007, 75, 1861–1869. [Google Scholar]
  13. Mohamed, J.A.; Murray, B.E. Lack of correlation of gelatinase production and biofilm formation in a large collection of Enterococcus faecalis isolates. J. Clin. Microbiol. 2005, 43, 5405–5407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Chuang-Smith, O.N.; Wells, C.L.; Henry-Stanley, M.J.; Dunny, G.M. Acceleration of Enterococcus faecalis biofilm formation by aggregation substance expression in an Ex Vivo model of cardiac valve colonization. PLoS ONE 2010, 5, e15798. [Google Scholar] [CrossRef] [PubMed]
  15. Nallapareddy, S.R.; Murray, B.E. Ligand-signaled upregulation of Enterococcus faecalis ace transcription, a mechanism for modulating host-E. faecalis interaction. Infect. Immun. 2006, 74, 4982–4989. [Google Scholar] [CrossRef] [PubMed]
  16. Hashem, Y.A.; Amin, H.M.; Essam, T.M.; Yassin, A.S.; Aziz, R.K. Biofilm formation in enterococci: Genotype-phenotype correlations and inhibition by vancomycin. Sci. Rep. 2017, 7, 5733. [Google Scholar] [CrossRef] [PubMed]
  17. Van Houdt, R.; Michiels, C.W. Biofilm formation and the food industry, a focus on the bacterial outer surface. J. Appl. Microbiol. 2010, 109, 1117–1131. [Google Scholar] [CrossRef] [PubMed]
  18. Zhan, X.; Tan, Y.; Lv, Y.; Fang, J.; Zhou, Y.; Gao, X.; Zhu, H.; Shi, C. The Antimicrobial and Antibiofilm Activity of Oregano Essential Oil against Enterococcus faecalis and Its Application in Chicken Breast. Foods 2022, 11, 2296. [Google Scholar] [CrossRef]
  19. Gajewska, J.; Chajęcka-Wierzchowska, W. Biofilm formation ability and presence of adhesion genes among coagulase-negative and coagulase-positive staphylococci isolates from raw cow’s milk. Pathogens 2020, 9, 654. [Google Scholar] [CrossRef]
  20. Chajęcka-Wierzchowska, W.; Gajewska, J.; Wiśniewski, P.; Zadernowska, A. Enterotoxigenic potential of coagulase-negative staphylococci from ready-to-eat food. Pathogens 2020, 9, 734. [Google Scholar] [CrossRef]
  21. Freeman, D.J.; Falkiner, F.R.; Patrick, S. New method for detecting slime production by coagulase negative staphylococci. J. Clin. Pathol. 1989, 42, 872–874. [Google Scholar] [CrossRef]
  22. Stepanović, S.; Vuković, D.; Hola, V.; Bonaventura, G.D.; Djukić, S.; Ćircović, I.; Ruzicka, F. Quantification of biofilm in microtiter plates. Apmis 2007, 115, 891–899. [Google Scholar] [CrossRef]
  23. Chajecka-Wierzchowska, W.; Zadernowska, A.; Łaniewska-Trokenheim, Ł. Virulence factors, antimicrobial resistance and biofilm formation in Enterococcus spp. isolated from retail shrimps. LWT-Food Sci. Technol. 2016, 69, 117–122. [Google Scholar] [CrossRef]
  24. Semedo, T.; Santos, M.A.; Martins, P.; Silva Lopes, M.F.; Figueiredo Marques, J.J.; Tenreiro, R.; Barreto Crespo, M.T. Comparative study using type strains and clinical and food isolates to examine hemolytic activity and occurrence of the cyl operon in enterococci. J. Clin. Microbiol. 2003, 41, 2569–2576. [Google Scholar] [CrossRef]
  25. Lopes, M.d.F.S.; Simões, A.P.; Tenreiro, R.; Marques, J.J.F.; Crespo, M.T.B. Activity and expression of a virulence factor, gelatinase, in dairy enterococci. Int. J. Food Microbiol. 2006, 112, 208–214. [Google Scholar] [CrossRef] [PubMed]
  26. Willems, R.J.; Homan, W.; Top, J.; van Santen-verheuvel, M.; Tribe, D.; Manzioros, X.; Gaillard, C.; Vandenbroucke-grauls, C.M.; Mascini, E.M.; van Kregten, E.; et al. Variant esp gene as a marker of a distinct genetic lineage of vancomycinresistant Enterococcus faecium spreading in hospitals. Lancet 2001, 357, 853–855. [Google Scholar] [CrossRef]
  27. Vankerckhoven, V.; Van Autgaerden, T.; Vael, C.; Lammens, C.; Chapelle, S.; Rossi, R.; Jabes, D.; Goossens, H. Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl Genes in Enterococci and Survey for Virulence Determinants among European Hospital Isolates of Enterococcus faecium. J. Clin. Microbiol. 2004, 42, 4473–4479. [Google Scholar] [CrossRef] [PubMed]
  28. Coque, T.M.; Patterson, J.E.; Steckelberg, J.M.; Murray, B.E. Incidence of hemolysin, gelatinase, and aggregation substance among enterococci isolated from patients with endocarditis and other infections and from feces of hospitalized and community-based persons. J. Infect. Dis. 1995, 171, 1223–1229. [Google Scholar] [CrossRef] [PubMed]
  29. Ramos, S.; Silva, V.; de Lurdes Enes Dapkevicius, M.; Igrejas, G.; Poeta, P. Enterococci, from harmless bacteria to a pathogen. Microorganisms 2020, 8, 1118. [Google Scholar] [CrossRef] [PubMed]
  30. Lauková, A.; Focková, V.; Pogány Simonová, M. Enterococcal species associated with slovak raw goat milk, their safety and susceptibility to lantibiotics and durancin ed26e/7. Processes 2021, 9, 681. [Google Scholar] [CrossRef]
  31. Kafil, H.S.; Mobarez, A.M. Assessment of biofilm formation by enterococci isolates from urinary tract infections with different virulence profiles. J. King Saud Univ.-Sci. 2015, 27, 312–317. [Google Scholar] [CrossRef]
  32. Gürler, H.; Findik, A.; GültIken, N.; Ay, S.S.; Çiftçi, A.; Koldas, E.; Arslan, S.; Findik, M. Investigation on the etiology of subclinical mastitis in jersey and hybrid jersey dairy cows. Acta Vet. 2015, 65, 358–370. [Google Scholar]
  33. Rózańska, H.; Lewtak-Piłat, A.; Kubajka, M.; Weiner, M. Occurrence of enterococci in mastitic cow’s milk and their antimicrobial resistance. J. Vet. Res. 2019, 63, 93–97. [Google Scholar] [CrossRef]
  34. Terzić-Vidojević, A.; Veljović, K.; Popović, N.; Tolinački, M.; Golić, N. Enterococci from raw-milk cheeses: Current knowledge on safety, technological, and probiotic concerns. Foods 2021, 10, 2753. [Google Scholar] [CrossRef] [PubMed]
  35. Igbinosa, E.O.; Beshiru, A. Antimicrobial resistance, virulence determinants, and biofilm formation of Enterococcus species from ready-to-eat seafood. Front. Microbiol. 2019, 10, 728. [Google Scholar] [CrossRef] [PubMed]
  36. Srey, S.; Jahid, I.K.; Ha, S. Do Biofilm formation in food industries: A food safety concern. Food Control 2013, 31, 572–585. [Google Scholar] [CrossRef]
  37. Abebe, G.M. The Role of Bacterial Biofilm in Antibiotic Resistance and Food Contamination. Int. J. Microbiol. 2020, 2020, 1705814. [Google Scholar] [CrossRef] [PubMed]
  38. Kagkli, D.M.; Vancanneyt, M.; Vandamme, P.; Hill, C.; Cogan, T.M. Contamination of milk by enterococci and coliforms from bovine faeces. J. Appl. Microbiol. 2007, 103, 1393–1405. [Google Scholar] [CrossRef] [PubMed]
  39. Gomes, B.C.; Esteves, C.T.; Palazzo, I.C.V.; Darini, A.L.C.; Felis, G.E.; Sechi, L.A.; Franco, B.D.G.M.; De Martinis, E.C.P. Prevalence and characterization of Enterococcus spp. isolated from Brazilian foods. Food Microbiol. 2008, 25, 668–675. [Google Scholar] [CrossRef] [PubMed]
  40. Fuka, M.M.; Maksimovic, A.Z.; Tanuwidjaja, I.; Hulak, N.; Schloter, M. Characterization of enterococcal community isolated from an Artisan Istrian raw milk cheese: Biotechnologicaland safety aspects. Food Technol. Biotechnol. 2017, 55, 368–380. [Google Scholar]
  41. Pereira, R.I.; Prichula, J.; Santesteva, N.A.; d’Azevedo, P.A.; Motta, A.d.S.; Frazzon, A.P.G. Virulence Profiles in Enterococcus spp. Isolated from Raw Buffalo’s Milk in South Brazil. Res. J. Microbiol. 2017, 12, 248–254. [Google Scholar]
  42. Baldassarri, L.; Cecchini, R.; Bertuccini, L.; Ammendolia, M.G.; Iosi, F.; Arciola, C.R.; Montanaro, L.; Di Rosa, R.; Gherardi, G.; Dicuonzo, G.; et al. Enterococcus spp. produces slime and survives in rat peritoneal macrophages. Med. Microbiol. Immunol. 2001, 190, 113–120. [Google Scholar] [CrossRef]
  43. Creti, R.; Imperi, M.; Bertuccini, L.; Fabretti, F.; Orefici, G.; Di Rosa, R.; Baldassarri, L. Survey for virulence determinants among Enterococcus faecalis isolated from different sources. J. Med. Microbiol. 2004, 53, 13–20. [Google Scholar] [CrossRef] [PubMed]
  44. Hendrickx, A.P.A.; Willems, R.J.L.; Bonten, M.J.M.; van Schaik, W. LPxTG surface proteins of enterococci. Trends Microbiol. 2009, 17, 423–430. [Google Scholar] [CrossRef] [PubMed]
  45. Haas, W.; Shepard, B.D.; Gilmore, M.S. Two-component regulator of Enterococcus faecalis cytolysin responds to quorum-sensing autoinduction. Nature 2002, 415, 84–87. [Google Scholar] [CrossRef]
  46. de Souza, C.P. Pathogenicity mechanisms of prokaryotic cells: An evolutionary view. Braz. J. Infect. Dis. 2003, 7, 23–31. [Google Scholar]
  47. Di Rosa, R.; Creti, R.; Venditti, M.; D’Amelio, R.; Arciola, C.; Montanaro, L.; Baldassarri, L. Relationship between biofilm formation, the enterococcal surface protein (Esp) and gelatinase in clinical isolates of Enterococcus faecalis and Enterococcus faecium. FEMS Microbiol. Lett. 2006, 256, 145–150. [Google Scholar] [CrossRef] [Green Version]
  48. Cappitelli, F.; Polo, A.; Villa, F. Biofilm Formation in Food Processing Environments is Still Poorly Understood and Controlled. Food Eng. Rev. 2014, 6, 29–42. [Google Scholar] [CrossRef]
  49. Wang, W.; Peng, R.; Liu, J.; Wang, Z.; Guo, T.; Liang, Q.; Carrier, A.J.; Wang, L.; Zhang, X. Biofilm eradication by in situ generation of reactive chlorine species on nano-CuO surfaces. J. Mater. Sci. 2020, 55, 11609–11621. [Google Scholar] [CrossRef]
  50. Anderson, A.C.; Jonas, D.; Huber, I.; Karygianni, L.; Wölber, J.; Hellwig, E.; Arweiler, N.; Vach, K.; Wittmer, A.; Al-Ahmad, A. Enterococcus faecalis from food, clinical specimens, and oral sites: Prevalence of virulence factors in association with biofilm formation. Front. Microbiol. 2016, 6, 1534. [Google Scholar] [CrossRef]
  51. Kim, H.J.; Youn, H.Y.; Kang, H.J.; Moon, J.S.; Jang, Y.S.; Song, K.Y.; Seo, K.H. Prevalence and Virulence Characteristics of Enterococcus faecalis and Enterococcus faecium in Bovine Mastitis Milk Compared to Bovine Normal Raw Milk in South Korea. Animals 2022, 12, 1407. [Google Scholar] [CrossRef] [PubMed]
  52. Chajęcka-Wierzchowska, W.; Zadernowska, A.; Łaniewska-Trokenheim, Ł. Virulence factors of Enterococcus spp. presented in food. LWT 2017, 75, 670–676. [Google Scholar] [CrossRef]
  53. Medeiros, A.W.; Pereira, R.I.; Oliveira, D.V.; Martins, P.D.; d’Azevedo, P.A.; Van der Sand, S.; Frazzon, J.; Frazzon, A.P.G. Molecular detection of virulence factors among food and clinical Enterococcus faecalis strains in South Brazil. Braz. J. Microbiol. 2014, 45, 327–332. [Google Scholar] [CrossRef]
  54. Pillai, S.K.; Sakoulas, G.; Eliopoulos, G.M.; Moellering, R.C., Jr.; Murray, B.E.; Inouye, R.T. Effects of Glucose on fsr—Mediated Biofilm Formation in Enterococcus faecalis. J. Infect. Dis. 2004, 190, 967–970. [Google Scholar] [CrossRef]
  55. Homayouni, A.; Ansari, F.; Azizi, A.; Pourjafar, H.; Madadi, M. Cheese as a Potential Food Carrier to Deliver Probiotic Microorganisms into the Human Gut: A Review. Curr. Nutr. Food Sci. 2018, 16, 15–28. [Google Scholar] [CrossRef]
  56. Chuang, O.N.; Schlievert, P.M.; Wells, C.L.; Manias, D.A.; Tripp, T.J.; Dunny, G.M. Multiple functional domains of Enterococcus faecalis aggregation substance Asc10 contribute to endocarditis virulence. Infect. Immun. 2009, 77, 539–548. [Google Scholar] [CrossRef]
  57. Tsikrikonis, G.; Maniatis, A.N.; Labrou, M.; Ntokou, E.; Michail, G.; Daponte, A.; Stathopoulos, C.; Tsakris, A.; Pournaras, S. Differences in biofilm formation and virulence factors between clinical and fecal enterococcal isolates of human and animal origin. Microb. Pathog. 2012, 52, 336–343. [Google Scholar] [CrossRef]
  58. Begley, M.; Hill, C. Stress adaptation in foodborne pathogens. Annu. Rev. Food Sci. Technol. 2015, 6, 191–210. [Google Scholar] [CrossRef] [PubMed]
  59. Banda, R.; Nduko, J.; Matofari, J. Bacterial biofilm formation in milking equipments in Lilongwe, Malawi. J. Food Qual. Hazards Control 2020, 7, 142–148. [Google Scholar] [CrossRef]
  60. Marchand, S.; De Block, J.; De Jonghe, V.; Coorevits, A.; Heyndrickx, M.; Herman, L. Biofilm Formation in Milk Production and Processing Environments; Influence on Milk Quality and Safety. Compr. Rev. Food Sci. Food Saf. 2012, 11, 133–147. [Google Scholar] [CrossRef]
Table
Table 1. Oligonucleotides used in polymerase chain reaction.
Table 1. Oligonucleotides used in polymerase chain reaction.
GenePrimers SequencePCR Annealing Temperature (°C)Amplicon Size (bp)References
aggCACGTAATTCTTGCCCACCA55520[24]
CAAGCATTATTGGCAGCGTT
ebpACCATTTGCAGAAGCAAGAATG54613[16]
GAGTGAAAGTTCCTCCTCTAG
ebpBCATTAGCAGAGGCATCGCAA54504
CAAGTGGTGGTAAGTCATAGG
ebpCCTGCTACGAATATGGTGGTG54487
GGTGTTTGATTGTTTGCTTC
pilGAAGAAACCAAAGCACCTAC54620
CTACCTAAGAAAAGAAACGCG
srtGTATCCTTTTGTTAGCGATGC54612
TGTCCTCGAACTAATAACCGA
fsrAATGAGTGAACAAATGGCTATTTA49740[25]
CTAAGTAAGAAATAGTGCCTTGA
fsrBGGGAGCTCTGGACAAAGTATTATCTAACCG63566
TTGGTACCCACACCATCACTGACTTTTGC
sprETTGAGCTCCGTTCCTGCCGAAAGTCATTC55591
TTGGTACCGATTGGGGAACCAGATTGACC
espAGATTTCATCTTTGATTCTTGG56510[26]
AATTGATTCTTTAGCATCTGG
gelETATGACAATGCTTTTTGGGAT56213[27]
AGATGCACCCGAAATAATATA
asa1GCACGCTATTACGAACTATGA56375
TAAGAAAGAACATCACCACGA
cylAACTCGGGGATTGATAGGC56688[28]
GCTGCTAAAGCTGCGCTT
Table
Table 2. Identification of enterococci isolates.
Table 2. Identification of enterococci isolates.
Number (%) of Isolates
Isolation SourceE. feacalisE. feaciumE. gallinarumE. casseliflavusTotal
Raw milk42 (89.4%)5 (10.2%)1 (2.0%)1 (2.0%)49 (57.6%)
Raw milk cheeses29 (80.6%)5 (13.9%)2 (5.6%)0 (0.0%)36 (42.4%)
Total71 (83.5%)10 (11.8%)3 (3.5%)1 (1.2%)85 (100.0%)
Table
Table 3. Results of biofilm-producing ability among enterococci isolated from raw milk and cheese samples.
Table 3. Results of biofilm-producing ability among enterococci isolated from raw milk and cheese samples.
Milk Samples
Biofilm FormationCongo Red Agar Method
SpeciesStrongModerateWeakNo BiofilmPositiveNegative
E. faecalis (n = 42)33 (78.6%)1 (2.4%)0 (0.0%)8 (19.0%)19 (45.2%)23 (54.8%)
E. faecium (n = 5)1 (20%)0 (0.0%)0 (0.0%)4 (80%)1 (20%)4 (80%)
E. casseliflavus (n = 1)1 (100.0%)0 (0.0%)0 (0.0%)0 (0.0%)1 (100%)0 (0.0%)
E. gallinarum (n = 1)1 (100.0%)0 (0.0%)0 (0.0%)0 (0.0%)0 (0.0%)1 (100%)
All enterococci (n = 49)36 (73.5%)1 (2.0%)0 (0.0%)12 (24.5%)21 (42.9%)28 (57.1%)
Cheese samples
E. faecalis (n = 29)12 (41.4%)0 (0.0%)1 (3.4%)16 (55.2%)16 (55.2%)13 (44.8%)
E. faecium (n = 5)4 (80.0%)0 (0.0%)0 (0.0%)1 (20.0%)2 (40.0%)3 (60.0%)
E. gallinarum (n = 2)1 (50.0%)0 (0.0%)0 (0.0%)1 (50.0%)2 (100.0%)0 (0.0%)
All enterococci (n = 36)17 (47.2%)0 (0.0%)1 (2.8%)18 (50.0%)20 (55.6%)16 (44.4%)
Table
Table 4. The presence of biofilm-associated and virulence genes in enterococci isolated from raw milk and cheese samples.
Table 4. The presence of biofilm-associated and virulence genes in enterococci isolated from raw milk and cheese samples.
GenesMilk SamplesCheese Samples
E. faecalis (n = 42)E. faecium (n = 5)E. casseliflavus (n = 1)E. gallinarum (n = 1)Total
(n = 49)		E. faecalis (n = 29)E. faecium (n = 5)E. gallinarum (n = 2)Total
(n = 36)		Total
(n = 85)
gelE36
(85.7%)		4
(80.0%)		1
(100.0%)		1
(100.0%)		42
(85.7%)		25
(86.2%)		5
(100.0%)		2
(100.0%)		32
(88.9%)		74 (87.1%)
esp13
(31.0%)		2
(40.0%)		0
(0.0%)		0
(0.0%)		15
(30.6%)		8
(27.6%)		4
(80.0%)		1
(50.0%)		13
(36.1%)		28 (32.9%)
asa128 (66.7%)2
(40.0%)		1
(100.0%)		0
(0.0%)		31
(63.3%)		19
(65.5%)		4
(80.0%)		2
(100.0%)		25
(69.4%)		56 (65.9%)
cylA2
(4.8%)		0
(0.0%)		0
(0.0%)		0
(0.0%)		2
(4.1%)		0
(0.0%)		0
(0.0%)		0
(0.0%)		0
(0.0%)		2 (2.4%)
agg12
(28.6%)		2
(40.0%)		0
(0.0%)		0
(0.0%)		14
(28.6%)		13
(44.8%)		0
(0.0%)		1
(50.0%)		14
(38.9%)		28 (32.9%)
ebpA27
(64.3%)		5
(100.0%)		1
(100.0%)		1
(100.0%)		34
(69.4%)		18
(62.1%)		5
(100.0%)		2
(100.0%)		25
(69.4%)		59 (69.4%)
ebpB25
(59.5%)		3
(60.0%)		1
(100.0%)		1
(100.0%)		30
(61.2%)		21
(72.4%)		5
(100.0%)		1
(50.0%)		27
(75.0%)		57 (67.1%)
ebpC16
(38.1%)		1
(20.0%)		0
(0.0%)		1
(100.0%)		18
(36.7%)		28
(96.6%)		4
(80.0%)		2
(100.0%)		34
(94.4%)		52 (61.2%)
pil17
(40.5%)		1
(20.0%)		0
(0.0%)		1
(100.0%)		19
(38.8%)		26 (89.7%)3
(60.0%)		2
(100.0%)		31
(86.1%)		50 (58.8%)
srt20
(47.6%)		4
(80.0%)		0
(0.0%)		1
(100.0%)		25
(51.0%)		23
(79.3%)		4
(80.0%)		1
(50.0%)		28
(77.8%)		53 (62.4%)
fsrA0
(0.0%)		0
(0.0%)		0
(0.0%)		0
(0.0%)		0
(0.0%)		5
(17.2%)		1
(20.0%)		0
(0.0%)		6
(16.7%)		6 (7.1%)
fsrB1
(2.4%)		2
(40.0%)		0
(0.0%)		0
(0.0%)		3
(6.1%)		7
(24.1%)		1
(20.0%)		0
(0.0%)		8
(22.2%)		11 (12.9%)
sprE1
(2.4%)		0
(0.0%)		0
(0.0%)		0
(0.0%)		1
(2.0%)		6
(20.7%)		0
(0.0%)		0
(0.0%)		6
(16.7%)		7 (8.2%)
gelE: gelatinase; esp: enterococcal surface protein, asa1: aggregation substance, cylA: cytolysin operon, agg: aggregation substance; ebpA, ebpB, epbC: endocarditis and biofilm-associated pili; pil: pili; srt: pilus-associated sortase; fsrA: response regulator; fsrB: signaling peptide; sprE: serine protease.
Table
Table 5. Association between the occurrences of virulence genes and biofilm formation ability of all enterococci isolates, both from milk and cheeses.
Table 5. Association between the occurrences of virulence genes and biofilm formation ability of all enterococci isolates, both from milk and cheeses.
Virulence GenesEnterococcus Species (n = 85)
Biofilm Producers
(n = 55)		Non-Biofilm Producers
(n = 30)		p-Value
n (%)n (%)
gelE48 (87.3)26 (86.7)1.000
esp19 (34.5)9 (30.0)0.810
asa136 (65.5)21 (70.0)0.810
cylA2 (3.6)0 (0.0)0.537
agg16 (29.1)12 (40.0)0.341
ebpA36 (65.5)23 (76.7)0.332
ebpB34 (61.8)23 (76.7)0.228
ebpC30 (54.5)22 (73.3)0.107
pil29 (52.7)21 (70.0)0.167
srt31 (56.4)22 (73.3)0.162
fsrA2 (3.6)4 (13.3)0.179
fsrB7 (12.7)4 (13.3)1.000
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gajewska, J.; Chajęcka-Wierzchowska, W.; Byczkowska-Rostkowska, Z.; Saki, M. Biofilm Formation Capacity and Presence of Virulence Determinants among Enterococcus Species from Milk and Raw Milk Cheeses. Life 2023, 13, 495. https://doi.org/10.3390/life13020495

AMA Style

Gajewska J, Chajęcka-Wierzchowska W, Byczkowska-Rostkowska Z, Saki M. Biofilm Formation Capacity and Presence of Virulence Determinants among Enterococcus Species from Milk and Raw Milk Cheeses. Life. 2023; 13(2):495. https://doi.org/10.3390/life13020495

Chicago/Turabian Style

Gajewska, Joanna, Wioleta Chajęcka-Wierzchowska, Zuzanna Byczkowska-Rostkowska, and Morteza Saki. 2023. "Biofilm Formation Capacity and Presence of Virulence Determinants among Enterococcus Species from Milk and Raw Milk Cheeses" Life 13, no. 2: 495. https://doi.org/10.3390/life13020495

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop