Ancestral Haplotype Retention and Population Expansion Determine the Complicated Population Genetic Structure of the Hilly Lineage of Neolucanus swinhoei Complex (Coleoptera, Lucanidae) on the Subtropical Taiwan Island
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. DNA Extraction, Amplification, and Sequencing
2.3. Phylogenetic Analyses
2.4. Genetic Structure and Haplotype Network Analyses
2.5. Demographic History
3. Results
3.1. Sequence Composition of COI and 16S rRNA Genes
3.2. Phylogenetic Analyses
3.3. Divergence Time Calibration
3.4. Haplotype Network and Possible Ancestral Haplotypes
3.5. Nucleotide Diversity Indices
3.6. Population Demography
4. Discussion
4.1. Implication of Genetic Variations on the Hilly Lineage of NSC
4.2. Ancestral Haplotype Determination
4.3. Evolutionary History of Widespread N. swinhoei
4.4. Historical Dispersal of the Widespread N. swinhoei
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Avise, J.C. Phylogeography: The History and Formation of Species; Harvard University Press: Cambridge, MA, USA, 2000. [Google Scholar]
- Hewitt, G. The genetic legacy of the Quaternary ice ages. Nature 2000, 405, 907–913. [Google Scholar] [CrossRef] [PubMed]
- Hewitt, G.M. Genetic consequences of climatic oscillations in the Quaternary. Philos. Trans. R. Soc. Lond. B. 2004, 359, 183–195. [Google Scholar] [CrossRef] [Green Version]
- Knowles, L.L. Tests of Pleistocene speciation in montane grasshoppers (genus Melanoplus) from the sky islands of western North America. Evolution 2000, 54, 1337–1348. [Google Scholar] [CrossRef]
- Hoorn, C.; Wesselingh, F.P.; Ter Steege, H.; Bermudez, M.A.; Mora, A.; Sevink, J.; Sanmartín, I.; Sanchez-Meseguer, A.; Anderson, C.L.; Figueiredo, J.P. Amazonia through time: Andean uplift, climate change, landscape evolution, and biodiversity. Science 2010, 330, 927–931. [Google Scholar] [CrossRef] [Green Version]
- Rull, V. Speciation timing and neotropical biodiversity: The Tertiary–Quaternary debate in the light of molecular phylogenetic evidence. Mol. Ecol. 2008, 17, 2722–2729. [Google Scholar] [CrossRef] [PubMed]
- Rull, V. Neotropical biodiversity: Timing and potential drivers. Trends Ecol. Evol. 2011, 26, 508–513. [Google Scholar] [CrossRef]
- Abe-Ouchi, A.; Saito, F.; Kawamura, K.; Raymo, M.E.; Okuno, J.i.; Takahashi, K.; Blatter, H. Insolation-driven 100,000-year glacial cycles and hysteresis of ice-sheet volume. Nature 2013, 500, 190–193. [Google Scholar] [CrossRef]
- Kubota, K.; Nagahata, Y.; Ikeda, H.; Kubota, N.; Otobe, H.; Umetsu, K. Diversification process of stag beetles belonging to the genus Platycerus Geoffroy (Coleoptera: Lucanidae) in Japan based on nuclear and mitochondrial genes. Entomol. Sci. 2011, 14, 411–427. [Google Scholar] [CrossRef]
- Qiu, Y.X.; Fu, C.X.; Comes, H.P. Plant molecular phylogeography in China and adjacent regions: Tracing the genetic imprints of Quaternary climate and environmental change in the world’s most diverse temperate flora. Mol. Phylogenet. Evol. 2011, 59, 225–244. [Google Scholar] [CrossRef]
- Mohan, A.V.; Gehring, P.S.; Scherz, M.D.; Glaw, F.; Ratsoavina, F.M.; Vences, M. Comparative phylogeography and patterns of deep genetic differentiation of two gecko species, Paroedura gracilis and Phelsuma guttata, across north-eastern Madagascar. Salamandra 2019, 55, 211–220. [Google Scholar]
- Iwasaki, T.; Aoki, K.; Seo, A.; Murakami, N. Comparative phylogeography of four component species of deciduous broad-leaved forests in Japan based on chloroplast DNA variation. J. Plant Res. 2012, 125, 207–221. [Google Scholar] [CrossRef] [PubMed]
- Teng, L.S. Geotectonic evolution of late Cenozoic arc-continent collision in Taiwan. Tectonophysics 1990, 183, 57–76. [Google Scholar] [CrossRef]
- Huang, C.Y.; Wu, W.Y.; Chang, C.P.; Tsao, S.; Yuan, P.B.; Lin, C.W.; Xiae, K.Y. Tectonic evolution of accretionary prism in the arc-continent collision terrain of Taiwan. Tectonophysics 1997, 281, 31–51. [Google Scholar] [CrossRef]
- Yu, T.L.; Lin, H.D.; Weng, C.F. A new phylogeographic pattern of endemic Bufo bankorensis in Taiwan island is attributed to the genetic variation of populations. PLoS ONE 2014, 9, e98029. [Google Scholar] [CrossRef] [Green Version]
- Tsai, C.L.; Wan, X.; Yeh, W.B. Differentiation in stag beetles, Neolucanus swinhoei complex (Coleoptera: Lucanidae): Four major lineages caused by periodical Pleistocene glaciations and separation by a mountain range. Mol. Phylogenet. Evol. 2014, 78, 245–259. [Google Scholar] [CrossRef] [PubMed]
- Shih, H.T.; Ng, P.K.; Schubart, C.D.; Chang, H.W. Phylogeny and phylogeography of the genus Geothelphusa (Crustacea: Decapoda, Brachyura, Potamidae) in southwestern Taiwan based on two mitochondrial genes. Zool. Sci. 2007, 24, 57–66. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.C.; Chen, Y.F.; Shieh, S.H.; Yang, P.S. A revision of the status of Psolodesmus mandarinus based on molecular and morphological evidence (Odonata: Calopterygidae). Odonatologica 2014, 43, 51–66. [Google Scholar]
- Lai, J.S.; Lue, K.Y. Two new Hynobius (Caudata: Hynobiidae) salamanders from Taiwan. Herpetologica 2008, 64, 63–80. [Google Scholar] [CrossRef]
- Tsai, C.L.; Yeh, W.B. Subspecific differentiation events of montane stag beetles (Coleoptera, Lucanidae) endemic to Formosa Island. PLoS ONE 2016, 11, e0156600. [Google Scholar] [CrossRef] [PubMed]
- Yeh, W.B.; Chang, Y.L.; Lin, C.H.; Wu, F.S.; Yang, J.T. Genetic differentiation of Loxoblemmus appendicularis complex (Orthoptera: Gryllidae): Speciation through vicariant and glaciation events. Ann. Entomol. Soc. Am. 2004, 97, 613–623. [Google Scholar] [CrossRef] [Green Version]
- Lin, H.D.; Chen, Y.R.; Lin, S.M. Strict consistency between genetic and topographic landscapes of the brown tree frog (Buergeria robusta) in Taiwan. Mol. Phylogenet. Evol. 2012, 62, 251–262. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.P.; Huang, C.C.; Tsai, C.L.; Lin, T.E.; Jhang, J.J.; Wu, S.H. Systematic revision of the Taiwanese genus Kurixalus members with a description of two new endemic species (Anura, Rhacophoridae). Zookeys 2016, 557, 121–153. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tseng, S.P.; Wang, C.J.; Li, S.H.; Lin, S.M. Within-island speciation with an exceptional case of distinct separation between two sibling lizard species divided by a narrow stream. Mol. Phylogenet. Evol. 2015, 90, 164–175. [Google Scholar] [CrossRef] [PubMed]
- Chang, Y.J. Stage Beetles; Yuan-Liou Publisher: Taipei, Taiwan, 2006. (In Chinese) [Google Scholar]
- Zozomová-Lihová, J.; Melichárková, A.; Svitok, M.; Španiel, S. Pleistocene range disruption and postglacial expansion with secondary contacts explain the genetic and cytotype structure in the western Balkan endemic Alyssum austrodalmaticum (Brassicaceae). Plant Syst. Evol. 2020, 306, 47. [Google Scholar] [CrossRef]
- Zhu, X.J.; Jang, T.W.; Kim, J.K.; Kubota, K. Genetic divergence of Platycerus hongwonpyoi (Coleoptera: Lucanidae) in South Korea. Entomol. Sci. 2019, 22, 86–97. [Google Scholar] [CrossRef]
- Weng, Y.M.; Yang, M.M.; Yeh, W.B. A comparative phylogeographic study reveals discordant evolutionary histories of alpine ground beetles (Coleoptera, Carabidae). Ecol. Evol. 2016, 6, 2061–2073. [Google Scholar] [CrossRef] [Green Version]
- Yeh, W.B.; Yang, C.T.; Kang, S.C. Identification of two sibling species, Ephemera formosana and E. sauteri (Ephemeroptera: Ephemeridae), based on mitochondrial DNA sequence analysis. Formosan Entomol. 1997, 17, 257–268. (In Chinese) [Google Scholar] [CrossRef]
- Drummond, A.J.; Rambaut, A. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 2007, 7, 214–222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Posada, D. jModelTest: Phylogenetic model averaging. Mol. Biol. Evol. 2008, 25, 1253–1256. [Google Scholar] [CrossRef]
- Papadopoulou, A.; Anastasiou, I.; Vogler, A.P. Revisiting the insect mitochondrial molecular clock: The mid-Aegean trench calibration. Mol. Biol. Evol. 2010, 27, 1659–1672. [Google Scholar] [CrossRef] [Green Version]
- Brower, A. Rapid morphological radiation and convergence among races of the butterfly Heliconius erato inferred from patterns of mitochondrial DNA evolution. Proc. Natl. Acad. Sci. USA 1994, 91, 6491–6495. [Google Scholar] [CrossRef] [Green Version]
- Rambaut, A.; Drummond, A. Tracer v1. 5: An MCMC trace analysis tool. 2009. Available online: http://beast.bio.ed.ac.uk/Tracer (accessed on 1 October 2016).
- Excoffier, L.; Laval, G.; Schneider, S. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol. Bioinform. Online 2005, 1, 47–50. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clement, M.; Posada, D.; Crandall, K.A. TCS: A computer program to estimate gene genealogies. Mol. Ecol. 2000, 9, 1657–1659. [Google Scholar] [CrossRef] [Green Version]
- Beerli, P. Estimation of migration rates and population sizes in geographically structured populations. Nato Asi Ser. A Life Sci. 1998, 306, 39–54. [Google Scholar]
- Beerli, P.; Felsenstein, J. Maximum likelihood estimation of a migration matrix and effective population sizes in n subpopulations by using a coalescent approach. Proc. Natl. Acad. Sci. USA 2001, 98, 4563–4568. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gibbard, P.; Van Kolfschoten, T. The Pleistocene and Holocene epochs. In A Geologic Time Scale 2004; Gradstein, F.M., Ogg, J.G., Smith, A.G., Eds.; Cambridge University Press: Cambridge, MA, USA, 2004; pp. 441–452. [Google Scholar] [CrossRef]
- Zhang, W.Z.; Xiong, X.M.; Zhang, X.J.; Wan, S.M.; Guan, N.N.; Nie, C.H.; Zhao, B.W.; Hsiao, C.D.; Wang, W.M.; Gao, Z.X. Mitochondrial genome variation after hybridization and differences in the first and second generation hybrids of bream fishes. PLoS ONE 2016, 11, e0158915. [Google Scholar] [CrossRef]
- Wang, E.J.; Van Wijk, R.E.; Braun, M.S.; Wink, M. Gene flow and genetic drift contribute to high genetic diversity with low phylogeographical structure in European hoopoes (Upupa epops). Mol. Phylogenet. Evol. 2017, 113, 113–125. [Google Scholar] [CrossRef] [PubMed]
- Cameron, S.L. Insect mitochondrial genomics: Implications for evolution and phylogeny. Annu. Rev. Entomol. 2014, 59, 95–117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brunner, P.C.; Chatzivassiliou, E.K.; Katis, N.I.; Frey, J.E. Host-associated genetic differentiation in Thrips tabaci (Insecta; Thysanoptera), as determined from mtDNA sequence data. Heredity 2004, 93, 364–370. [Google Scholar] [CrossRef] [Green Version]
- Chinnery, P.F.; Hudson, G. Mitochondrial genetics. Br. Med. Bull. 2013, 106, 135–159. [Google Scholar] [CrossRef] [Green Version]
- Huang, J.P.; Hill, J.G.; Ortego, J.; Knowles, L.L. Paraphyletic species no more–genomic data resolve a Pleistocene radiation and validate morphological species of the Melanoplus scudderi complex (Insecta: Orthoptera). Syst. Entomol. 2020, 45, 594–605. [Google Scholar] [CrossRef]
- Cerezo, M.L.M.; Kucka, M.; Zub, K.; Chan, Y.F.; Bryk, J. Population structure of Apodemus flavicollis and comparison to Apodemus sylvaticus in northern Poland based on RAD-seq. BMC Genom. 2020, 21, 241. [Google Scholar] [CrossRef] [Green Version]
- Leite, N.A.; Alves-Pereira, A.; Corrêa, A.S.; Zucchi, M.I.; Omoto, C. Demographics and genetic variability of the new world bollworm (Helicoverpa zea) and the old world bollworm (Helicoverpa armigera) in Brazil. PLoS ONE 2014, 9, e113286. [Google Scholar] [CrossRef] [Green Version]
- Xu, Y.; Mai, J.W.; Yu, B.J.; Hu, H.X.; Yuan, L.; Jashenko, R.; Ji, R. Study on the genetic differentiation of geographic populations of Calliptamus italicus (Orthoptera: Acrididae) in sino-kazakh border areas based on mitochondrial COI and COII genes. J. Econ. Entomol. 2019, 112, 1912–1919. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.F.; Agnarsson, I. Global mtDNA genetic structure and hypothesized invasion history of a major pest of citrus, Diaphorina citri (Hemiptera: Liviidae). Ecol. Evol. 2018, 8, 257–265. [Google Scholar] [CrossRef] [Green Version]
- Belousov, A.; Belousova, M.; Chen, C.H.; Zellmer, G.F. Deposits, character and timing of recent eruptions and gravitational collapses in Tatun Volcanic Group, Northern Taiwan: Hazard-related issues. J. Volcanol. Geoth. Res. 2010, 191, 205–221. [Google Scholar] [CrossRef] [Green Version]
- Cheng, Y.P.; Hwang, S.Y.; Lin, T.P. Potential refugia in Taiwan revealed by the phylogeographical study of Castanopsis carlesii Hayata (Fagaceae). Mol. Ecol. 2005, 14, 2075–2085. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.J.; Hwang, S.Y.; Ho, K.C.; Lin, T.P. Source populations of Quercus glauca in the last glacial age in Taiwan revealed by nuclear microsatellite markers. J. Hered. 2006, 97, 261–269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, S.Y.; Hong, K.H.; Liu, S.L.; Cheng, Y.P.; Wu, W.L.; Chiang, T.Y. Genetic variation and population differentiation of Michelia formosana (Magnoliaceae) based on cpDNA variation and RAPD fingerprints: Relevance to post-Pleistocene recolonization. J. Plant Res. 2002, 115, 203–216. [Google Scholar] [CrossRef] [PubMed]
- Chan, C.L. Purple Crow Butterfly; Morningstar Publisher: Taichung City, Taiwan, 2018. [Google Scholar]
- Chao, R.F.; Hsu, C.J.; Chen, T.Y.; Yang, P.S. Overwintering ecology of danaine butterflies in the Dawu area, Taitung County, southeastern Taiwan. Formosan Entomol. 2007, 27, 17–30. (In Chinese) [Google Scholar] [CrossRef]
- Shih, H.T.; Hung, H.C.; Schubart, C.D.; Chen, C.A.; Chang, H.W. Intraspecific genetic diversity of the endemic freshwater crab Candidiopotamon rathbunae (Decapoda, Brachyura, Potamidae) reflects five million years of the geological history of Taiwan. J. Biogeogr. 2006, 33, 980–989. [Google Scholar] [CrossRef]
- Wu, I.H.; Yang, P.S.; Liu, C.Y.; Yeh, W.B. Genetic differentiation of Troides aeacus formosanus (Lepidoptera: Papilionidae), based on cytochrome oxidase I sequences and amplified fragment length polymorphism. Ann. Entomol. Soc. Am. 2010, 103, 1018–1024. [Google Scholar] [CrossRef] [Green Version]
- Huang, J.P.; Lin, C.P. Lineage-specific late Pleistocene expansion of an endemic subtropical gossamer-wing damselfly, Euphaea formosa, in Taiwan. BMC Evol. Biol. 2011, 11, 94. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Pop | Collection Locality | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
A | 1 | Beitou | 2 | Neihu | 3 | Shihding | 4 | Shulin | 5 | Yingge | 6 | Toucheng |
B | 7 | Luofu | 8 | Dashanbei | 9 | Daosia | 10 | Yulao | 11 | Lalashan | 12 | Sihleng |
13 | Mingchih | 14 | Taigang | 15 | Jianshih | 16 | Bailan | 17 | Cingcyuan | 18 | Mingfongshan | |
19 | Sianshan | 20 | Luchang | 21 | Guanwu | 22 | Syuejian | 23 | Sanyi | 24 | Tiangou | |
25 | Anma Mountain | |||||||||||
C | 26 | Puli | 27 | Sun Moon Lake | 28 | Jhulin Village | 29 | Dalunshan | 30 | Shanlinsi | 31 | Jhangshuhu |
32 | Alishan | |||||||||||
D | 33 | Shihshan | 34 | Tengjhih | 35 | Shanping | 36 | Wutai | 37 | Wanan | ||
E | 38 | Dahanshan | ||||||||||
F | 39 | Leshuei | 40 | Taipingshan | ||||||||
G | 41 | Sinbaiyang | 42 | Tongmen | ||||||||
H | 43 | Rueisuei | 44 | Chihkeshan | 45 | Lioushihdanshan | ||||||
I | 46 | Yanping | 47 | Lijia | 48 | Jhihben | 49 | Jinjhenshan |
Gene | Primer | Sequence 5’→ 3’ | Size (bp) | References |
---|---|---|---|---|
COI | CI-46Coleoptera (+) | AACCATAAAGATATTGGAAC | 686 | Tsai et al. [16] |
CI-Neo-F (+) | AACATTATACTTCCTRCTAGGTA | 669 | ||
CI-731Coleoptera (−) | CCAAAAAATCAAAATAAATGTTG | |||
16S rRNA | 16SR21 (+) | GCCTGTTTATCAAAAACAT | 550 | Yeh et al. [29] |
16S22 (−) | CCGGTCTGAACTCAGATCA |
Pop | N | S | π | Hn | h | TD | Fs | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
COI | 16S | COI | 16S | COI | 16S | COI | 16S | COI | 16S | COI | 16S | ||
A | 19 | 13 | 9 | 0.0023 | 0.0022 | 10 | 9 | 0.7368 | 0.7778 | −2.13875 | −1.74253 | −6.19070 | −5.81418 |
B | 62 | 20 | 11 | 0.0014 | 0.0030 | 21 | 17 | 0.6779 | 0.8509 | −2.42149 | −0.76986 | −26.82927 | −10.85315 |
C | 21 | 10 | 12 | 0.0023 | 0.0035 | 9 | 9 | 0.7952 | 0.8429 | −1.50025 | −1.42923 | −4.21905 | −3.36040 |
D | 25 | 17 | 9 | 0.0028 | 0.0030 | 14 | 10 | 0.8933 | 0.7933 | −2.05377 | −0.78729 | −10.17280 | −4.62452 |
E | 10 | 8 | 5 | 0.0029 | 0.0026 | 7 | 5 | 0.8667 | 0.8444 | −1.39868 | −0.78318 | −3.42350 | −1.39262 |
F | 10 | 4 | 4 | 0.0012 | 0.0019 | 4 | 5 | 0.5333 | 0.7556 | −1.66706 | −0.65748 | −1.34464 | −2.09575 |
G | 3 | 1 | 5 | 0.0010 | 0.0061 | 2 | 3 | 0.6667 | 1.0000 | 0.00000 | 0.00000 | 0.20067 | −0.07696 |
H | 11 | 2 | 8 | 0.0010 | 0.0046 | 3 | 10 | 0.5818 | 0.9818 | −0.12670 | −0.72380 | −0.21110 | −7.74072 |
I | 10 | 3 | 4 | 0.0009 | 0.0030 | 4 | 6 | 0.5333 | 0.8889 | −1.56222 | 0.39804 | −1.96374 | −2.36445 |
16S | A | B | C | D | E | F | G | H | I | |
---|---|---|---|---|---|---|---|---|---|---|
COI | ||||||||||
A | - | 0.2172 | 0.0805 | 0.2878 | 0.1940 | 0.2098 | 0.4767 | 0.3572 | 0.2841 | |
B | 0.0231 | - | 0.0992 | 0.0622 | −0.0019 | 0.0631 | 0.2072 | 0.1441 | 0.1217 | |
C | 0.0387 | 0.0637 | - | 0.0978 | 0.0262 | 0.0036 | 0.2743 | 0.2022 | 0.0899 | |
D | 0.0215 | 0.0319 | 0.0408 | - | 0.0222 | 0.0427 | 0.2068 | 0.1497 | 0.0736 | |
E | 0.0314 | 0.0729 | 0.0694 | 0.0200 | - | −0.0200 | 0.2312 | 0.1315 | 0.0873 | |
F | −0.0304 | −0.0180 | 0.0162 | −0.0309 | 0.0177 | - | 0.2729 | 0.1321 | 0.0454 | |
G | −0.1029 | −0.0430 | −0.0447 | −0.0914 | −0.0958 | −0.0224 | - | −0.1125 | 0.0899 | |
H | 0.0239 | 0.0192 | 0.0645 | −0.0174 | 0.0388 | 0.0010 | 0.0547 | - | 0.0537 | |
I | −0.0184 | −0.0133 | 0.0129 | −0.0040 | 0.0342 | −0.0294 | 0.0137 | 0.0543 | - |
Gene | Source of Variation | Df | Sum of Squares | Variance Components | Variation (%) |
---|---|---|---|---|---|
COI | Among populations | 8 | 6.923 | 0.01464 | 2.33 |
Within populations | 162 | 99.370 | 0.61339 | 97.67 | |
16S rRNA | Among populations | 8 | 23.398 | 0.12179 | 12.81 |
Within populations | 162 | 134.304 | 0.82904 | 87.19 |
Level | No. of Migration | Frequency (%) |
---|---|---|
I | 4 | 25 |
II | 5 | 31.2 |
III | 7 | 43.8 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsai, C.-L.; Kubota, K.; Pham, H.-T.; Yeh, W.-B. Ancestral Haplotype Retention and Population Expansion Determine the Complicated Population Genetic Structure of the Hilly Lineage of Neolucanus swinhoei Complex (Coleoptera, Lucanidae) on the Subtropical Taiwan Island. Insects 2021, 12, 227. https://doi.org/10.3390/insects12030227
Tsai C-L, Kubota K, Pham H-T, Yeh W-B. Ancestral Haplotype Retention and Population Expansion Determine the Complicated Population Genetic Structure of the Hilly Lineage of Neolucanus swinhoei Complex (Coleoptera, Lucanidae) on the Subtropical Taiwan Island. Insects. 2021; 12(3):227. https://doi.org/10.3390/insects12030227
Chicago/Turabian StyleTsai, Cheng-Lung, Kôhei Kubota, Hong-Thai Pham, and Wen-Bin Yeh. 2021. "Ancestral Haplotype Retention and Population Expansion Determine the Complicated Population Genetic Structure of the Hilly Lineage of Neolucanus swinhoei Complex (Coleoptera, Lucanidae) on the Subtropical Taiwan Island" Insects 12, no. 3: 227. https://doi.org/10.3390/insects12030227