Juvenile Hormone Synthesis Pathway Gene SfIPPI Regulates Sogatella furcifera Reproduction
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing and Collection
2.2. Sample Preparation
2.3. Total RNA Extraction and cDNA Synthesis
2.4. SfIPPI Cloning
2.5. Sequencing Analysis
2.6. SfIPPI Expression Different Developmental Stages and Tissues
2.7. Double-Stranded RNA Synthesis
2.8. RNAi Experiment
2.9. Bioassay
2.10. Statistical Analysis
3. Results
3.1. Sequence Identification and Characteristics of SfIPPI
3.2. Sequence Comparisons and Phylogenetic Analysis
3.3. SfIPPI Expression in Different Developmental Stages and Tissues
3.4. Effect of Silencing of SfIPPI on Reproduction of S. furcifera Female Adults
3.5. Effect SfIPPI Silencing on Other Genes in the JH Signal Transduction Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ouyang, Y.C.; Li, S. Modification and application of a high performance liquid chromatography method to separate juvenile hormones and their metabolites. Acta Entomol. Sin. 2003, 3, 282–287. [Google Scholar]
- Wigglesworth, V.B. Assays on Rhodnius for juvenile hormone activity. J. Insect Physiol. 1973, 19, 205–211. [Google Scholar] [CrossRef]
- Konopova, B.; Jindra, M. Juvenile hormone resistance gene Methoprene-tolerant controls entry into metamorphosis in the beetle Tribolium castaneum. Proc. Natl. Acad. Sci. USA 2007, 104, 10488–10493. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, Q.; Li, B.; Tian, Z.; De, L.A.; Wang, J.L.; Wang, X.P.; Liu, W. Key role of juvenile hormone in controlling reproductive diapause in females of the Asian lady beetle Harmonia axyridis. Pest Manag. Sci. 2022, 78, 193–204. [Google Scholar] [CrossRef]
- Gilbert, L.I.; Granger, N.A.; Roe, R.M. The juvenile hormones: Historical facts and speculations on future research directions. Insect Biochem. Mol. Biol. 2000, 30, 617–644. [Google Scholar] [CrossRef]
- Luo, W.; Liu, S.; Zhang, W.Q.; Yang, L.; Huang, J.H.; Zhou, S.T.; Feng, Q.L.; Palli, S.R.; Wang, J.; Roth, S.; et al. Juvenile hormone signaling promotes ovulation and maintains egg shape by inducing expression of extracellular matrix genes. Proc. Natl. Acad. Sci. USA 2021, 118, e2104461118. [Google Scholar] [CrossRef]
- Rantala, M.J.; Dubovskiy, I.M.; Pölkki, M.; Krama, T.; Contreras-Garduño, J.; Krams, I.A. Effect of juvenile hormone on resistance against entomopathogenic fungus Metarhizium robertsii differs between sexes. J. Fungi 2020, 6, 298. [Google Scholar] [CrossRef]
- Zhu, J.; Noriega, F.G. The Role of juvenile hormone in mosquito development and reproduction. Adv. Insect Physiol. 2016, 51, 93–113. [Google Scholar]
- Kinjoh, T.; Kaneko, Y.; Itoyama, K.; Mita, K.; Hiruma, K.; Shinoda, T. Control of juvenile hormone biosynthesis in Bombyx mori: Cloning of the enzymes in the mevalonate pathway and assessment of their developmental expression in the corpora allata. Insect Biochem. Mol. Biol. 2007, 37, 808–818. [Google Scholar] [CrossRef]
- Bellés, X.; Martín, D.; Piulachs, M.D. The mevalonate pathway and the synthesis of juvenile hormone in insects. Annu. Rev. Entomol. 2005, 50, 181–199. [Google Scholar] [CrossRef] [Green Version]
- Goodman, W.G.; Granger, N.A. The Juvenile Hormones. In Comprehensive Molecular Insect Science; Gilbert, L.I., Iatrou, K., Gill, S.S., Eds.; Elsevier: Amsterdam, The Netherlands, 2005; pp. 55–155. [Google Scholar]
- Koyama, T.; Matsubara, M.; Ogura, K. Isoprenoid enzyme systems of silkworm. I. Partial purification of isopentenyl pyrophosphate isomerase, farnesyl pyrophosphate synthetase, and geranylgeranyl pyrophosphate synthetase. J. Biochem. 1985, 98, 449–456. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sen, S.E.; Tomasello, A.; Grasso, M.; Denton, R.; Macor, J.; Béliveau, C.; Cusson, M.; Crowell, D.N. Cloning, expression and characterization of lepidopteran isopentenyl diphosphate isomerase. Insect Biochem. Mol. Biol. 2012, 42, 739–750. [Google Scholar] [CrossRef]
- Diaz, M.E.; Mayoral, J.G.; Priestap, H.; Nouzova, M.; Rivera-Perez, C.; Noriega, F.G. Characterization of an isopentenyl diphosphate isomerase involved in the juvenile hormone pathway in Aedes aegypti. Insect Biochem. Mol. Biol. 2012, 42, 751–757. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghaffar, M.B.; Pritchard, J.; Ford-Lloyd, B. Brown planthopper (N. lugens Stål) feeding behavior on rice germplasm as an indicator of resistance. PLoS ONE 2011, 6, e22137. [Google Scholar] [CrossRef] [PubMed]
- Luo, X.N.; Zhuo, W.X. The life history of the white-backed planthopper, Sogatella furcifer (Horvath), on its weed host in Fujian Province. J. Plant Prot. 1986, 1, 9–16. [Google Scholar]
- Zhang, D.W.; Yu, Y.Y.; Pan, B.Y.; Kang, K.; Zeng, B.P.; Chen, J.; Tang, B. Regulation function of trehalose-6-phosphate synthase genes on chitin synthesis in Sogatella furcifera. Sci. Agric. Sin. 2019, 52, 3357–3366. [Google Scholar]
- Zhai, B.P. Rice planthoppers: A China problem under the international perspectives. Chin. J. Appl. Entomol. 2011, 48, 1184–1193. [Google Scholar]
- Cheng, J.A. Rice planthopper problems and relevant causes in China. Planthoppers New Threat. Sustain. Intensive Rice Prod. Syst. Asia 2009, 157, 178. [Google Scholar]
- Sheng, J.H.; Shang, J.M.; Liu, G.J. Management of the White backed planthopper Sogatella furcifera in China: A Mini review. Chin. J. Rice Sci. 2003, S1, 12–27. [Google Scholar]
- Zhou, G.H.; Wen, J.J.; Cai, D.J.; Li, P.; Xu, D.L.; Zhang, S.G. Southern rice black-streaked dwarf virus: A new proposed Fijivirus species in the family Reoviridae. Chin. Sci. Bull. 2008, 53, 3677–3685. [Google Scholar] [CrossRef]
- Ruan, Y.W.; Liu, X.X.; Gong, C.W.; Zhang, Y.M.; Shen, L.T.; Ali, H.; Huang, Y.Y.; Wang, X.G. Cloning and functional verification of CYP408A3 and CYP6CS3 related to chlorpyrifos resistance in the Sogatella furcifera (Horváth) (Hemiptera: Delphacidae). Biology 2021, 10, 795. [Google Scholar] [CrossRef] [PubMed]
- Mu, X.C.; Zhang, W.; Wang, L.X.; Zhang, S.; Zhang, K.; Gao, C.F.; Wu, S.F. Resistance monitoring and cross-resistance patterns of three rice planthoppers, Nilaparvata lugens, Sogatella furcifera and Laodelphax striatellus to dinotefuran in China. Pestic Biochem. Physiol. 2016, 134, 8–13. [Google Scholar] [CrossRef]
- Zhang, X.L.; Liao, X.; Mao, K.K.; Li, J.H.; Wan, H. Insecticide resistance monitoring in field populations of the white-back planthopper, Sogatella furcifera (Hemiptera: Delphacidae) in riceproduction areas of Hubei Province, central China. Acta Entomol. Sin. 2016, 59, 1213–1221. [Google Scholar]
- Pradeep, A.R.; Nair, V.S.K. Acquiring vitellogenic competence in the rice pest Nilaparvata lugens Stal: Effects of a juvenile hormone analogue, hydroprene. Int. J. Ind. Ergonom. 2005, 10, 137–141. [Google Scholar]
- Lu, K.; Chen, X.; Liu, W.T.; Zhang, X.Y.; Chen, M.X.; Zhou, Q. Nutritional signaling regulates vitellogenin synthesis and egg development through juvenile hormone in Nilaparvata lugens (Stål). Int. J. Mol. Sci. 2016, 17, 269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kang, K.; Cai, Y.J.; Zhang, D.W.; Gong, J.; Zhang, W.Q. Effects of nutrition on the growth and reproductive signaling pathways in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae). Acta Entomol. Sin. 2021, 64, 1377–1387. [Google Scholar]
- Lu, K.; Zhou, J.; Chen, X.; Li, W.R.; Li, Y.; Cheng, Y.B.; Yan, J.; You, K.K.; Yuan, Z.N.; Zhou, Q. Deficiency of brummer impaires lipid mobilization and JH-mediated vitellogenesis in the brown planthopper, Nilaparvata lugens. Front. Physiol. 2018, 9, 1535. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Tang, N.; Gao, X.L.; Chang, Z.X.; Zhang, L.Q.; Zhou, G.H.; Guo, D.Y.; Zeng, Z.; Li, W.J.; Akinyemi, I.A.; et al. Genome sequence of a rice pest, the white-backed planthopper (Sogatella furcifera). GigaScience 2017, 6, giw004. [Google Scholar]
- Zhou, C.; Yang, H.; Wang, Z.; Long, G.Y.; Jin, D.C. Comparative transcriptome analysis of Sogatella furcifera (Horvath) exposed to different insecticides. Sci. Rep. 2018, 8, 8773. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Wang, Y.Y.; Yu, J.M.; Dai, L.L.; Cheng, H. Cloning and expression of two mevalonate pathway genes of Dendroctonus armandi. J. Northwest For. Univ. 2020, 35, 140–149. [Google Scholar]
- Li, Q.; Meng, Q.W.; Lü, F.G.; Guo, W.C.; Li, G.Q. Identification of ten mevalonate enzyme-encoding genes and their expression in response to juvenile hormone levels in Leptinotarsa decemlineata (Say). Gene 2016, 584, 136–147. [Google Scholar] [CrossRef]
- Yang, W.J.; Xu, K.K.; Dou, W.; Li, C.; Wang, J.J. 3-Hydroxy-3-methyl glutaryl coenzyme A reductase is required for ovarian development in the oriental fruit fly Bactrocera dorsalis (Hendel). J. Asia Pac. Entomol. 2018, 21, 1071–1078. [Google Scholar] [CrossRef]
- Yue, Y.; Yang, R.L.; Wang, W.P.; Zhou, Q.H.; Chen, E.H.; Yuan, G.R.; Wang, J.J.; Dou, W. Involvement of Met and Kr-h1 in JH-Mediated Reproduction of Female Bactrocera dorsalis (Hendel). Front. Physiol. 2018, 9, 482. [Google Scholar] [CrossRef]
- Li, Y.; Gao, H.; Zhang, Y.; Lin, X. Role of the transcription factor Taiman in moulting and ovarian development of Nilaparvata lugens. Entomol. Gen. 2021, 41, 169–177. [Google Scholar] [CrossRef]
- Lin, X.; Yao, Y.; Wang, B. Methoprene-tolerant (Met) and Krüpple-homologue 1 (Kr-h1) are required for ovariole development and egg maturation in the brown plant hopper. Sci. Rep. 2015, 5, 18064. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, J.; Xu, Y.; Lin, X. Role of Broad-Complex (Br) and Krüppel homolog 1 (Kr-h1) in the ovary development of Nilaparvata lugens. Front. Physiol. 2017, 8, 1013. [Google Scholar] [CrossRef]
- Vannini, L.; Ciolfi, S.; Dallai, R.; Frati, F.; Hoffmann, K.H.; Meyering-Vos, M. Putative-farnesoic acid O-methyltransferase (FAMeT) in medfly reproduction. Arch. Insect Biochem. Physiol. 2010, 75, 92–106. [Google Scholar] [CrossRef]
- Gijbels, M.; Lenaerts, C.; Vanden Broeck, J.V.; Marchal, E. Juvenile hormone receptor Met is essential for ovarian maturation in the desert locust, Schistocerca gregaria. Sci. Rep. 2019, 9, 10797. [Google Scholar] [CrossRef]
- Zhou, C.; Yang, X.B.; Yang, H.; Gong, M.F.; Long, G.Y.; Jin, D.C. Role of SfJHAMT and SfFAMeT in the reproductive regulation of Sogatella furcifera and its expression under insecticide stress. Pestic Biochem. Phys. 2021, 173, 104779. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Dong, Y.; Desneux, N.; Niu, C. RNAi silencing of the HaHMG-CoA reductase gene inhibits oviposition in the Helicoverpa armigera cotton bollworm. PLoS ONE 2013, 8, e67732. [Google Scholar] [CrossRef] [PubMed]
Experiment | Primer | Primer Sequence (5′ to 3′) |
---|---|---|
cDNA cloning | IPPI-i-F | ATTTGGTAGCAGAGCCATAAGA |
IPPI-i-R | CTCCTGGTTCGCTTCAATT | |
qPCR | Y-IPPI-F | GCCTGTTGCAGTCATCCGTTGT |
Y-IPPI-R | GCGGTATGCCTAGCTCGTGGTT | |
Y-Vg-F | AGTGGTGAGGTGCGTGGTCT | |
Y-Vg-R | CGTTGCTGCTGCTACCTGACA | |
Y-VgR-F | CTGCGAACACAGCCGAATGGA | |
Y-VgR-R | GGAACTGCGACTGCGTATCACA | |
Y-JHAMT-F | ACGAGAACCGTAATGGCAGTCA | |
Y-JHAMT-R | CCAGGACCACATCCAACATCCA | |
Y-FAMeT-F | CTCTTGAACTGACGACCGAGGA | |
Y-FAMeT-R | CGACCAGCCGCCTATGAAGAT | |
Y-Met-F | GCCGCCAGTTGACCGATTACA | |
Y-Met-R | ACCAGCAGAGTCGCACGAGT | |
Y-Kr-h1-F | CTCACCGCAGCACTCAACTCA | |
Y-Kr-h1-R | AGGCACAGGCGACATTAGAACA | |
Y-RPL9-F | GGGCGAGAAGTACATCCGTAGG | |
Y-RPL9-R | GCGGCTGATCGTGAGACATCTT | |
Y-TUB-F | CGCTGTTGATGGAGAGGCTGTC | |
Y-TUB-R | ACGACGGCTGTGGATACCTGTG | |
dsRNA synthesis | T7-IPPI-F | TAATACGACTCACTATAGGGTAGCAGAGCCATAAGAAGTT |
T7-IPPI-R | TAATACGACTCACTATAGGGGCAGGATTAGAATGTAGTCG | |
T7-GFP-F | TAATACGACTCACTATAGGGGCCAACACTTGTCACTACTT | |
T7-GFP-R | TAATACGACTCACTATAGGGGGAGTATTTTGTTGATAATGGTCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gong, M.-F.; Yang, X.-B.; Long, G.-Y.; Jia, Z.-Y.; Zeng, Q.-H.; Jin, D.-C.; Yang, H.; Zhou, C. Juvenile Hormone Synthesis Pathway Gene SfIPPI Regulates Sogatella furcifera Reproduction. Insects 2022, 13, 174. https://doi.org/10.3390/insects13020174
Gong M-F, Yang X-B, Long G-Y, Jia Z-Y, Zeng Q-H, Jin D-C, Yang H, Zhou C. Juvenile Hormone Synthesis Pathway Gene SfIPPI Regulates Sogatella furcifera Reproduction. Insects. 2022; 13(2):174. https://doi.org/10.3390/insects13020174
Chicago/Turabian StyleGong, Ming-Fu, Xi-Bin Yang, Gui-Yun Long, Ze-Yan Jia, Qing-Hui Zeng, Dao-Chao Jin, Hong Yang, and Cao Zhou. 2022. "Juvenile Hormone Synthesis Pathway Gene SfIPPI Regulates Sogatella furcifera Reproduction" Insects 13, no. 2: 174. https://doi.org/10.3390/insects13020174