Optimized In Vitro CRISPR/Cas9 Gene Editing Tool in the West Nile Virus Mosquito Vector, Culex quinquefasciatus
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture Maintenance
2.2. Generation of Culex-Optimized CRISPR/Cas9 Plasmids
2.3. sgRNA Design
2.4. Cloning of dcr-2 and piwi4 sgRNA Containing Plasmids
2.5. Delivery of CRISPR/Cas9 Plasmid
2.6. Delivery of Synthetic sgRNA
2.7. T7 Endonuclease I (T7E1) Assay
3. Results
3.1. Superior dcr-2 Editing in Hsu Cells Using a Culex-Optimized Plasmid
3.2. Transfection of Culex-Optimized CRISPR/Cas9 Construct and a Synthetic sgRNA Mediates Efficient Editing of dcr-2 Gene in Hsu Cells
3.3. Editing of piwi4 Using the Culex-optimized CRISPR/Cas9 Construct in Hsu Cells
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Huang, Y.S.; Higgs, S.; Vanlandingham, D.L. Emergence and re-emergence of mosquito-borne arboviruses. Curr. Opin. Virol. 2019, 34, 104–109. [Google Scholar] [CrossRef] [PubMed]
- Kraemer, M.U.; Sinka, M.E.; Duda, K.A.; Mylne, A.Q.; Shearer, F.M.; Barker, C.M.; Moore, C.G.; Carvalho, R.G.; Coelho, G.E.; Van Bortel, W.; et al. The global distribution of the arbovirus vectors Aedes aegypti and Ae. albopictus. Elife 2015, 4, e08347. [Google Scholar] [CrossRef]
- Bhatt, S.; Gething, P.W.; Brady, O.J.; Messina, J.P.; Farlow, A.W.; Moyes, C.L.; Drake, J.M.; Brownstein, J.S.; Hoen, A.G.; Sankoh, O.; et al. The global distribution and burden of dengue. Nature 2013, 496, 504–507. [Google Scholar] [CrossRef] [PubMed]
- Petersen, L.R. Epidemiology of West Nile Virus in the United States: Implications for Arbovirology and Public Health. J. Med. Entomol. 2019, 56, 1456–1462. [Google Scholar] [CrossRef]
- Bakonyi, T.; Haussig, J.M. West Nile virus keeps on moving up in Europe. Eurosurveillance 2020, 25, 2001938. [Google Scholar] [CrossRef] [PubMed]
- Nash, D.; Mostashari, F.; Fine, A.; Miller, J.; O’Leary, D.; Murray, K.; Huang, A.; Rosenberg, A.; Greenberg, A.; Sherman, M.; et al. The outbreak of West Nile virus infection in the New York City area in 1999. New Engl. J. Med. 2001, 344, 1807–1814. [Google Scholar] [CrossRef]
- Colborn, J.M.; Smith, K.A.; Townsend, J.; Damian, D.; Nasci, R.S.; Mutebi, J.P. West Nile virus outbreak in Phoenix, Arizona--2010: Entomological observations and epidemiological correlations. J. Am. Mosq. Control. Assoc. 2013, 29, 123–132. [Google Scholar] [CrossRef]
- Andreadis, T.G. The contribution of Culex pipiens complex mosquitoes to transmission and persistence of West Nile virus in North America. J. Am. Mosq. Control. Assoc. 2012, 28, 137–151. [Google Scholar] [CrossRef]
- Brugman, V.A.; Hernandez-Triana, L.M.; Medlock, J.M.; Fooks, A.R.; Carpenter, S.; Johnson, N. The Role of Culex pipiens L. (Diptera: Culicidae) in Virus Transmission in Europe. Int. J. Environ. Res. Public Health 2018, 15, 389. [Google Scholar] [CrossRef]
- Liang, G.; Li, X.; Gao, X.; Fu, S.; Wang, H.; Li, M.; Lu, Z.; Zhu, W.; Lu, X.; Wang, L.; et al. Arboviruses and their related infections in China: A comprehensive field and laboratory investigation over the last 3 decades. Rev. Med. Virol. 2018, 28, e1959. [Google Scholar] [CrossRef]
- Yap, G.; Mailepessov, D.; Lim, X.F.; Chan, S.; How, C.B.; Humaidi, M.; Yeo, G.; Chong, C.S.; Lam-Phua, S.G.; Lee, R.; et al. Detection of Japanese Encephalitis Virus in Culex Mosquitoes in Singapore. Am. J. Trop. Med. Hyg. 2020, 103, 1234–1240. [Google Scholar] [CrossRef] [PubMed]
- Diaz, A.; Coffey, L.L.; Burkett-Cadena, N.; Day, J.F. Reemergence of St. Louis Encephalitis Virus in the Americas. Emerg. Infect. Dis. 2018, 24, 2150. [Google Scholar] [CrossRef] [PubMed]
- Swetnam, D.M.; Stuart, J.B.; Young, K.; Maharaj, P.D.; Fang, Y.; Garcia, S.; Barker, C.M.; Smith, K.; Godsey, M.S.; Savage, H.M.; et al. Movement of St. Louis encephalitis virus in the Western United States, 2014–2018. PLoS Negl. Trop. Dis. 2020, 14, e0008343. [Google Scholar] [CrossRef] [PubMed]
- Ferguson, N.M. Challenges and opportunities in controlling mosquito-borne infections. Nature 2018, 559, 490–497. [Google Scholar] [CrossRef] [PubMed]
- Bhatt, S.; Weiss, D.J.; Cameron, E.; Bisanzio, D.; Mappin, B.; Dalrymple, U.; Battle, K.; Moyes, C.L.; Henry, A.; Eckhoff, P.A.; et al. The effect of malaria control on Plasmodium falciparum in Africa between 2000 and 2015. Nature 2015, 526, 207–211. [Google Scholar] [CrossRef]
- Killeen, G.F.; Tatarsky, A.; Diabate, A.; Chaccour, C.J.; Marshall, J.M.; Okumu, F.O.; Brunner, S.; Newby, G.; Williams, Y.A.; Malone, D.; et al. Developing an expanded vector control toolbox for malaria elimination. BMJ Glob Health 2017, 2, e000211. [Google Scholar] [CrossRef]
- Lopes, R.P.; Lima, J.B.P.; Martins, A.J. Insecticide resistance in Culex quinquefasciatus Say, 1823 in Brazil: A review. Parasites Vectors 2019, 12, 591. [Google Scholar] [CrossRef]
- Lee, W.S.; Webster, J.A.; Madzokere, E.T.; Stephenson, E.B.; Herrero, L.J. Mosquito antiviral defense mechanisms: A delicate balance between innate immunity and persistent viral infection. Parasites Vectors 2019, 12, 165. [Google Scholar] [CrossRef]
- Bonning, B.C.; Saleh, M.C. The Interplay Between Viruses and RNAi Pathways in Insects. Annu. Rev. Entomol. 2021, 66, 61–79. [Google Scholar] [CrossRef]
- Blair, C.D. Mosquito RNAi is the major innate immune pathway controlling arbovirus infection and transmission. Future Microbiol. 2011, 6, 265–277. [Google Scholar] [CrossRef] [Green Version]
- Gainetdinov, I.; Colpan, C.; Arif, A.; Cecchini, K.; Zamore, P.D. A Single Mechanism of Biogenesis, Initiated and Directed by PIWI Proteins, Explains piRNA Production in Most Animals. Mol. Cell 2018, 71, 775–790.e5. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Fejes Toth, K.; Aravin, A.A. piRNA Biogenesis in Drosophila melanogaster. Trends Genet. TIG 2017, 33, 882–894. [Google Scholar] [CrossRef] [PubMed]
- Petit, M.; Mongelli, V.; Frangeul, L.; Blanc, H.; Jiggins, F.; Saleh, M.C. piRNA pathway is not required for antiviral defense in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 2016, 113, E4218–E4227. [Google Scholar] [CrossRef] [PubMed]
- Blair, C.D. Deducing the Role of Virus Genome-Derived PIWI-Associated RNAs in the Mosquito-Arbovirus Arms Race. Front. Genet. 2019, 10, 1114. [Google Scholar] [CrossRef]
- Schnettler, E.; Donald, C.L.; Human, S.; Watson, M.; Siu, R.W.C.; McFarlane, M.; Fazakerley, J.K.; Kohl, A.; Fragkoudis, R. Knockdown of piRNA pathway proteins results in enhanced Semliki Forest virus production in mosquito cells. J. Gen. Virol. 2013, 94, 1680–1689. [Google Scholar] [CrossRef]
- Tassetto, M.; Kunitomi, M.; Whitfield, Z.J.; Dolan, P.T.; Sanchez-Vargas, I.; Garcia-Knight, M.; Ribiero, I.; Chen, T.; Olson, K.E.; Andino, R. Control of RNA viruses in mosquito cells through the acquisition of vDNA and endogenous viral elements. Elife 2019, 8, e41244. [Google Scholar] [CrossRef]
- Varjak, M.; Maringer, K.; Watson, M.; Sreenu, V.B.; Fredericks, A.C.; Pondeville, E.; Donald, C.L.; Sterk, J.; Kean, J.; Vazeille, M.; et al. Aedes aegypti Piwi4 Is a Noncanonical PIWI Protein Involved in Antiviral Responses. mSphere 2017, 2, e00144-17. [Google Scholar] [CrossRef]
- Akbari, O.S.; Antoshechkin, I.; Amrhein, H.; Williams, B.; Diloreto, R.; Sandler, J.; Hay, B.A. The developmental transcriptome of the mosquito Aedes aegypti, an invasive species and major arbovirus vector. G3 (Bethesda) 2013, 3, 1493–1509. [Google Scholar] [CrossRef]
- Campbell, C.L.; Black, W.C.t.; Hess, A.M.; Foy, B.D. Comparative genomics of small RNA regulatory pathway components in vector mosquitoes. BMC Genom. 2008, 9, 425. [Google Scholar] [CrossRef]
- Lewis, S.H.; Salmela, H.; Obbard, D.J. Duplication and Diversification of Dipteran Argonaute Genes, and the Evolutionary Divergence of Piwi and Aubergine. Genome Biol. Evol. 2016, 8, 507–518. [Google Scholar] [CrossRef]
- Ross, R.J.; Weiner, M.M.; Lin, H. PIWI proteins and PIWI-interacting RNAs in the soma. Nature 2014, 505, 353–359. [Google Scholar] [CrossRef] [PubMed]
- Doudna, J.A.; Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 2014, 346, 1258096. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Rehman, S.; Tang, X.; Gu, K.; Fan, Q.; Chen, D.; Ma, W. Methodologies for Improving HDR Efficiency. Front. Genet. 2018, 9, 691. [Google Scholar] [CrossRef] [PubMed]
- Scherer, C.; Knowles, J.; Sreenu, V.B.; Fredericks, A.C.; Fuss, J.; Maringer, K.; Fernandez-Sesma, A.; Merits, A.; Varjak, M.; Kohl, A.; et al. An Aedes aegypti-Derived Ago2 Knockout Cell Line to Investigate Arbovirus Infections. Viruses 2021, 13, 1066. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.; Jin, B.; Li, X.; Zhao, Y.; Gu, J.; Biedler, J.K.; Tu, Z.J.; Chen, X.G. Nix is a male-determining factor in the Asian tiger mosquito Aedes albopictus. Insect Biochem. Mol. Biol. 2020, 118, 103311. [Google Scholar] [CrossRef]
- Bassett, A.R.; Tibbit, C.; Ponting, C.P.; Liu, J.L. Mutagenesis and homologous recombination in Drosophila cell lines using CRISPR/Cas9. Biol Open 2014, 3, 42–49. [Google Scholar] [CrossRef]
- Anderson, M.A.E.; Purcell, J.; Verkuijl, S.A.N.; Norman, V.C.; Leftwich, P.T.; Harvey-Samuel, T.; Alphey, L.S. Expanding the CRISPR Toolbox in Culicine Mosquitoes: In Vitro Validation of Pol III Promoters. ACS Synth. Biol. 2020, 9, 678–681. [Google Scholar] [CrossRef]
- Rozen-Gagnon, K.; Yi, S.; Jacobson, E.; Novack, S.; Rice, C.M. A selectable, plasmid-based system to generate CRISPR/Cas9 gene edited and knock-in mosquito cell lines. Sci. Rep. 2021, 11, 736. [Google Scholar] [CrossRef]
- Viswanatha, R.; Mameli, E.; Rodiger, J.; Merckaert, P.; Feitosa-Suntheimer, F.; Colpitts, T.M.; Mohr, S.E.; Hu, Y.; Perrimon, N. Bioinformatic and cell-based tools for pooled CRISPR knockout screening in mosquitos. Nat. Commun. 2021, 12, 6825. [Google Scholar] [CrossRef]
- Feng, X.; Lopez Del Amo, V.; Mameli, E.; Lee, M.; Bishop, A.L.; Perrimon, N.; Gantz, V.M. Optimized CRISPR tools and site-directed transgenesis towards gene drive development in Culex quinquefasciatus mosquitoes. Nat. Commun. 2021, 12, 2960. [Google Scholar] [CrossRef]
- Hsu, S.H.; Mao, W.H.; Cross, J.H. Establishment of a line of cells derived from ovarian tissue of Culex quinquefasciatus Say. J. Med. Entomol. 1970, 7, 703–707. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez, M.; Martin-Ruiz, I.; Jimenez, S.; Pirone, L.; Barrio, R.; Sutherland, J.D. Generation of stable Drosophila cell lines using multicistronic vectors. Sci. Rep. 2011, 1, 75. [Google Scholar] [CrossRef] [PubMed]
- Cong, L.; Ran, F.A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P.D.; Wu, X.; Jiang, W.; Marraffini, L.A.; et al. Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339, 819–823. [Google Scholar] [CrossRef] [PubMed]
- McCarty, N.S.; Graham, A.E.; Studena, L.; Ledesma-Amaro, R. Multiplexed CRISPR technologies for gene editing and transcriptional regulation. Nat. Commun. 2020, 11, 1281. [Google Scholar] [CrossRef]
- Leoni, C.; Bianchi, N.; Vincenzetti, L.; Monticelli, S. An optimized workflow for CRISPR-Cas9 deletion of surface and intracellular factors in primary human T lymphocytes. PLoS ONE 2021, 16, e0247232. [Google Scholar] [CrossRef]
- Mashal, R.D.; Koontz, J.; Sklar, J. Detection of mutations by cleavage of DNA heteroduplexes with bacteriophage resolvases. Nat. Genet 1995, 9, 177–183. [Google Scholar] [CrossRef]
- Sentmanat, M.F.; Peters, S.T.; Florian, C.P.; Connelly, J.P.; Pruett-Miller, S.M. A Survey of Validation Strategies for CRISPR-Cas9 Editing. Sci. Rep. 2018, 8, 888. [Google Scholar] [CrossRef]
- Yu, C.; Zhang, Y.; Yao, S.; Wei, Y. A PCR based protocol for detecting indel mutations induced by TALENs and CRISPR/Cas9 in zebrafish. PLoS ONE 2014, 9, e98282. [Google Scholar] [CrossRef] [Green Version]
Gene (VectorBase ID) | sgRNA# | sgRNA Sequence-PAM (5′-3′) |
---|---|---|
dcr-2 (CPIJ010534) | sgRNA1 sgRNA2 | TACGTGCTGCGCATAGCGGCAGG CCCGACAGGCCAATCACCCGAGG |
piwi4 (CPIJ002459) | sgRNA1 sgRNA2 | GAGCACAAGAAAATCTTCGGAGG CCTCGGCTGCATGATCCAGGCGG |
Gene (VectorBase ID) | sgRNA# | Oligonucleotides (with BspQI Compatible Overhangs *) |
---|---|---|
dcr-2 (CPIJ010534) | sgRNA1 | 5′-TTCGTACGTGCTGCGCATAGCGGC-3′ 3′-AAGGCCGCTATGCGCAGCACGTAC-5′ |
sgRNA2 | 5′-TTCGCCCGACAGGCCAATCACCCG-3′ 3′-AAGCGGGTGATTGGCCTGTCGGGC-5′ | |
piwi4 (CPIJ002459) | sgRNA1 | 5′-TTCGGAGCACAAGAAAATCTTCGG-3′ 3′-AACCCGAAGATTTTCTTGTGCTCC-5′ |
sgRNA2 | 5′-TTCGCCTCGGCTGCATGATCCAGG-3′ 3′-AACCCTGGATCATGCAGCCGAGGC-5′ |
Temperature | Time/Cycling |
---|---|
98 °C | 1 min |
98–88 °C | 5 s, decrease 0.1 °C/cycle × 99 cycles |
88–78 °C | 10 s, decrease 0.1 °C/cycle × 99 cycles |
78–68 °C | 10 s, decrease 0.1 °C/cycle × 99 cycles |
68–58 °C | 10 s, decrease 0.1 °C/cycle × 99 cycles |
58–48 °C | 10 s, decrease 0.1 °C/cycle × 99 cycles |
48–38 °C | 10 s, decrease 0.1 °C/cycle × 99 cycles |
38–28 °C | 10 s, decrease 0.1 °C/cycle × 99 cycles |
28–18 °C | 10 s, decrease 0.1 °C/cycle × 99 cycles |
12 °C | Hold |
Name | Primer Sequence (5′-3′) |
---|---|
T7-Assay_Dcr2-sgRNA1_F | ATTGTGGTGGCCGTTTTGCT |
T7-Assay_Dcr2-sgRNA1_R | ATGGCGGTACTGCTTCGCAT |
T7-Assay_Dcr2-sgRNA2_F | CAAGCGCACCTTCTTCATCGTG |
T7-Assay_Dcr2-sgRNA2_R | GCTTTGATCGACGAAAACAGCG |
T7-Assay_Piwi4-sgRNA1_F | TTATAGCAGTGAGGGTCGTGAC |
T7-Assay_Piwi4-sgRNA1_R | TTGCTTGTAGTACTCCACGAA |
T7-Assay_Piwi4-sgRNA2_F | GTTCAGGCCGGTGAGCAG |
T7-Assay_Piwi4-sgRNA2_R | GTGATCGAAGAAGCGCGTGTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Torres, T.Z.B.; Prince, B.C.; Robison, A.; Rückert, C. Optimized In Vitro CRISPR/Cas9 Gene Editing Tool in the West Nile Virus Mosquito Vector, Culex quinquefasciatus. Insects 2022, 13, 856. https://doi.org/10.3390/insects13090856
Torres TZB, Prince BC, Robison A, Rückert C. Optimized In Vitro CRISPR/Cas9 Gene Editing Tool in the West Nile Virus Mosquito Vector, Culex quinquefasciatus. Insects. 2022; 13(9):856. https://doi.org/10.3390/insects13090856
Chicago/Turabian StyleTorres, Tran Zen B., Brian C. Prince, Alexis Robison, and Claudia Rückert. 2022. "Optimized In Vitro CRISPR/Cas9 Gene Editing Tool in the West Nile Virus Mosquito Vector, Culex quinquefasciatus" Insects 13, no. 9: 856. https://doi.org/10.3390/insects13090856