Death-Associated Protein-1 Plays a Role in the Reproductive Development of Nilaparvata lugens and the Transovarial Transmission of Its Yeast-Like Symbiont
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing
2.2. Cloning NlDAP-1 cDNA
2.3. Sequence Comparison and Phylogenetic Analysis
2.4. Real-Time Quantitative PCR Analysis
2.5. Immunofluorescence
2.6. RNA Interference
2.7. Dissection Observations and Fertility Analysis
2.8. Statistics on the Number of Yeast-Like Symbiont in Oocytes
2.9. Data Analysis
3. Results
3.1. Identification and Phylogenetic Analysis of NlDAP-1
3.2. Developmental and Tissue-Specific Expression of NlDAP-1
3.3. Immunofluorescence Analysis of NlDAP-1 Expression
3.4. Effects of RNA Interference
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Xue, J.; Zhou, X.; Zhang, C.X.; Yu, L.L.; Fan, H.W.; Wang, Z.; Xu, H.J.; Xi, Y.; Zhu, Z.R.; Zhou, W.W.; et al. Genomes of the rice pest brown planthopper and its endosymbionts reveal complex complementary contributions for host adaptation. Genome Biol. 2014, 15, 521. [Google Scholar] [CrossRef] [PubMed]
- Fujita, D.; Kohli, A.; Horgan, F.G. Rice resistance to planthoppers and leafhoppers. Crit. Rev. Plant Sci. 2013, 32, 162–191. [Google Scholar] [CrossRef]
- Zhang, X.L.; Liao, X.; Mao, K.K. Insecticide resistance monitoring and correlation analysis of insecticides in field populations of the brown planthopper Nilaparvata lugens (Stål) in China 2012–2014. Pestic. Biochem. Physiol. 2016, 132, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Whitfield, A.E.; Rotenberg, D. Disruption of insect transmission of plant viruses. Curr. Opin. Insect Sci. 2015, 8, 79–87. [Google Scholar] [CrossRef] [PubMed]
- Cheng, J.; Zhu, Z. Analysis on the key factors causing the outbreaks of brown planthopper in Yangtze Area, China in 2005. Plant Prot. 2006, 32, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Wen, Y.C.; Liu, Z.W.; Bao, H.B.; Han, Z.J. Imidacloprid resistance and its mechanisms in field populations of brown planthopper, Nilaparvata lugens Stål in China. Pestic. Biochem. Physiol. 2009, 94, 36–42. [Google Scholar] [CrossRef]
- Zhuo, J.C.; Chen, L.; Shi, J.K.; Xu, N.; Xue, W.H.; Zhang, M.Q.; Ren, Z.W.; Zhang, H.H.; Zhang, C.X. Tra-2 mediates cross-talk between sex determination and wing polyphenism in female Nilaparvata lugens. Genetics 2017, 207, 1067–1078. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.J.; Liu, C.W.; Huang, X.H.; Zhou, X.; Zhuo, J.C.; Zhang, C.X.; Bao, Y.Y. Screening and functional analyses of Nilaparvata lugens salivary proteome. J. Proteome Res. 2016, 15, 1883–1896. [Google Scholar] [CrossRef]
- Yuan, B.Y.; Xi, Z.C. Recent advances in molecular biology research of a rice pest, the brown planthopper. J. Integr. Agric. 2017, 18, 716–728. [Google Scholar] [CrossRef]
- Xu, H.J.; Chen, T.; Ma, X.F.; Xue, J.; Pan, P.L.; Zhang, X.C.; Cheng, J.A.; Zhang, C.X. Genome-wide screening for components of small interfering RNA (siRNA) and micro-RNA (miRNA) pathways in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae). Insect Mol. Biol. 2013, 22, 635–647. [Google Scholar] [CrossRef]
- Levy, S.N.; Kimchi, A. Death associated proteins (DAPs): From gene identifcation to the analysis of their apoptotic and tumor suppressive functions. Oncogene 1998, 17, 3331–3340. [Google Scholar] [CrossRef]
- Boyi, G.; Xu, P.; Tamas, N.; Ana, A.; Hua, G.; Lin, G.J. Role of FIP200 in cardiac and liver development and its regulation of TNFalpha and TSC-mTOR signaling pathways. J. Cell Biol. 2006, 175, 121–133. [Google Scholar] [CrossRef]
- De, P.; Miskimins, K.; Dey, N.; Leyland-Jones, B. Promise of rapalogues versus mTOR kinase inhibitors in subset specific breast cancer: Old targets new hope. Cancer Treat. Rev. 2013, 39, 403–412. [Google Scholar] [CrossRef] [PubMed]
- Santos, M.; Maia, L.; Silva, C.; Peterle, G.; Mercante, A.; Nunes, F.; Carvalho, M.; Tajara, E.; Louro, I.; Silva-Conforti, A. DAP1 high expression increases risk of lymph node metastases in squamous cell carcinoma of the oral cavity. Genet. Mol. Res. 2015, 14, 10515–10523. [Google Scholar] [CrossRef] [PubMed]
- Wazir, U.; Jiang, W.G.; Sharma, A.K.; Mokbe, I.K. Effects of the knockdown of death-associated protein 3 expression on cell adhesion, growth and migration in breast cancer cells. Anticancer. Res. 2012, 32, 671–674. [Google Scholar] [CrossRef]
- Wazir, U.; Sanders, A.J.; Wazir, A.; Baig, R.M.; Jiang, W.G.; Ster, I.C.; Sharma, A.K.; Mokbel, K. Effect of the knockdown of death-associated protein 1 expression on cell adhesion, growth and migration in breast cancer cells. Oncol. Rep. 2015, 33, 1450–1458. [Google Scholar] [CrossRef] [PubMed]
- Li, H.M.; Fujikura, D.; Harada, T.; Uehara, J.; Kawai, T.; Akira, S.; Reed, J.C.; Iwai, A.; Miyazaki, T. IPS-1 is crucial for DAP3-mediated anoikis induction by caspase-8 activation. Cell Death Differ. 2009, 16, 1615–1621. [Google Scholar] [CrossRef]
- O’Brien, C.A.; Kreso, A.; Ryan, P.; Hermans, K.G.; Gibson, L.; Wang, Y.; Tsatsanis, A.; Gallinger, S.; Dick, J.E. ID1 and ID3 regulate the self-renewal capacity of human colon cancer-initiating cells through p21. Cancer Cell 2012, 21, 777–792. [Google Scholar] [CrossRef]
- Murata, Y.; Wakoh, T.; Uekawa, N.; Sugimoto, M.; Asai, A.; Miyazaki, T.; Maruyama, M. Death-associated protein 3 regulates cellular senescence through oxidative stress response. FEBS Lett. 2006, 580, 6093–6099. [Google Scholar] [CrossRef]
- Wazir, U.; Orakzai, M.M.; Khanzada, Z.S.; Jiang, W.G.; Sharma, A.K.; Kasem, A.; Mokbel, K. The role of death-associated protein 3 in apoptosis, anoikis and human cancer. Cancer Cell Int. 2015, 15, 39. [Google Scholar] [CrossRef]
- Kinnosuke, Y.; Hiroyasu, T.; Kohei, O.; Sayaka, N.; Joel, M.; Masatoshi, N. DAP1, a negative regulator of autophagy, controls SubAB-mediated apoptosis and autophagy. Infect. Immun. 2014, 82, 4899–4908. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Wu, J.M.; Zheng, R.E.; Zhang, R.J.; Ji, J.L.; Yu, X.P.; Xu, Y.P. A clip domain serine protease involved in egg production in Nilaparvata lugens: Expression patterns and RNA interference. Insects 2019, 10, 378. [Google Scholar] [CrossRef]
- Nan, G.H.; Xu, Y.P.; Yu, Y.W.; Zhao, C.X.; Zhang, C.X.; Yu, X.P. Oocyte vitellogenesis triggers the entry of yeast-like symbionts into the oocyte of brown planthopper (Hemiptera: Delphacidae). Ann. Entomol. Soc. Am. 2016, 109, 753–758. [Google Scholar] [CrossRef]
- Xia, W.L.; Kang, L.H.; Liu, C.B.; Kang, C.J. Death associated protein 1 (DAP 1) positively regulates virus replication and apoptosis of hemocytes in shrimp Marsupenaeus japonicus. Fish Shellfish. Immunol. 2017, 63, 304–313. [Google Scholar] [CrossRef]
- Jia, Y.; Ye, L.; Ji, K.; Ann, M.T.; Mansel, L.D.; Ruge, F.; Ji, J.; Hargest, R.; Jiang, W. Death associated protein 1 is correlated with the clinical outcome of patients with colorectal cancer and has a role in the regulation of cell death. Oncol. Rep. 2014, 31, 175–182. [Google Scholar] [CrossRef]
- Udristioiu, A.; Nica-Badea, D. Autophagy dysfunctions associated with cancer cells and their therapeutic implications. Biomed. Pharmacother. 2019, 115, 108892. [Google Scholar] [CrossRef]
- Wei, Q.; Zhu, X.H.; Wan, P.J.; He, J.C.; Wang, W.X.; Lai, F.X.; Fu, Q. Knockdown of the chromatin remodeling ATPase gene Brahma impairs the reproductive potential of the brown planthopper, Nilaparvata lugens. Pestic. Biochem. Physiol. 2022, 184, 105106. [Google Scholar] [CrossRef]
- Zhu, J.J.; Hao, P.Y.; Lu, C.F.; Ma, Y.; Feng, Y.L.; Yu, X.P. Expression and RNA interference of Ribosomal Protein L5 gene in Nilaparvata lugens (Hemiptera: Delphacidae). J. Insect Sci. 2017, 17, 73. [Google Scholar] [CrossRef]
- Gao, H.; Jiang, X.J.; Zheng, S.W.; Li, Y.; Lin, X.D. Role of groucho and groucho1-like in regulating metamorphosis and ovary development in Nilaparvata lugens (Stål). Int. J. Mol. Sci. 2022, 23, 1197. [Google Scholar] [CrossRef]
- Stanley, D.; Haas, E.; Kim, Y. Beyond cellular immunity: On the biological significance of insect hemocytes. Cells 2023, 12, 599. [Google Scholar] [CrossRef] [PubMed]
- Arrese, E.L.; Soulages, J.L. Insect fat body: Energy, metabolism, and regulation. Annu. Rev. Entomol. 2010, 55, 207–225. [Google Scholar] [CrossRef] [PubMed]
- Nie, X.; Chen, H.; Niu, P.G.; Zhu, Y.; Zhou, J.; Jiang, L.; Li, D.; Lin, M.; Chen, Z.; Shi, D. DAP1 negatively regulates autophagy induced by cardamonin in SKOV3 cells. Cell Biol. Int. 2020, 44, 2192–2201. [Google Scholar] [CrossRef] [PubMed]
- Noda, H.; Kawahara, N. Electrophoretic karyotyoe of intracellular yeast-like symbiotes in rice planthopper and anobiid beetles. J. Invertebr. Pathol. 1995, 14, 459–463. [Google Scholar] [CrossRef] [PubMed]
- Ferrater, J.B.; Jong, P.W.; Dicke, M.; Chen, Y.H.; Horgan, F.G. Symbiont-mediated adaptation by planthoppers and leafhoppers to resistant rice varieties. Anthr. -Plant Interact. 2013, 7, 591–605. [Google Scholar] [CrossRef]
- Meer, M.; Witteveldt, J.; Stouthamer, R. Phylogeny of the arthropod endosymbiont Wolbachia based on the wsp gene. Insect Mol. Biol. 2010, 8, 399–408. [Google Scholar] [CrossRef] [PubMed]
- Douglas, A.E. Mycetocyte symbiosis in insects. Biol. Rev. 1989, 64, 409–434. [Google Scholar] [CrossRef] [PubMed]
- Wilkinson, T.L.; Ishikawa, H. On the functional significance of symbiotic microorganisms in the Homoptera: A comparative study of Acyrthosiphon pisum and Nilaparvata lugens. Physiol. Entomol. 2001, 26, 86–93. [Google Scholar] [CrossRef]
- Zhao, R.Y.; Li, D.T.; Wang, X.L.; Li, Z.; Yu, X.P.; Shentu, X.P. Synergistic and additive interactions of zhongshengmycin to the chemical insecticide pymetrozine for controlling Nilaparvata lugens (Hemiptera: Delphacidae). Front. Physiol. 2022, 13, 875610. [Google Scholar] [CrossRef]
- Zhang, R.J.; Ji, J.L.; Li, Y.B.; Yu, J.B.; Yu, X.P.; Xu, Y.P. Molecular characterization and RNA interference analysis of SLC26A10 from Nilaparvata lugens. Front. Physiol. 2022, 13, 853956. [Google Scholar] [CrossRef]
- Koren, I.; Reem, E.; Kimchi, A. DAP1, a novel substrate of mTOR, negatively regulates autophagy. Curr. Biol. 2010, 20, 1093–1098. [Google Scholar] [CrossRef] [PubMed]
- Koren, I.; Reem, E.; Kimchi, A. Autophagy gets a brake: DAP1, a novel mTOR substrate, is activated to suppress the autophagic process. Autophagy 2010, 6, 1179–1180. [Google Scholar] [CrossRef] [PubMed]
Primers | Primer Sequence (5′-3′) |
---|---|
for cloning cDNA | |
NlDAP-1-F | TCAGAGGAGATAAACATCGTGG |
NlDAP-1-R | CTGTTGATTTCACTTTTGCTGT |
for qRT-PCR | |
NlDAP-1-qF | ACCAGGAAAAGAGGAACTAAAAGC |
NlDAP-1-qR | CATGTAGCATTAAGTCCAGCAT |
Nl18S-qF | GTAACCCGCTGAACCTCC |
Nl18S-qR | GTCCGAAGACCTCACTAAATCA |
for synthesizing dsRNA | |
dsNlDAP-1-F | GGATCCTAATACGACTCACTATAGGGAACTAAAA |
GCTGGA | |
dsNlDAP-1-R | GGATCCTAATACGACTCACTATAGGCTTCTCATGG |
AAGCT | |
dsGFP-F | GGATCCTAATACGACTCACTATAGGGATACGTGCA |
GGAGAGGAC | |
dsGFP-R | GGATCCTAATACGACTCACTATAGGGCAGATTGTG |
TGGACAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, J.-B.; Lv, X.; Liu, Q.; Tu, J.-Y.; Yu, X.-P.; Xu, Y.-P. Death-Associated Protein-1 Plays a Role in the Reproductive Development of Nilaparvata lugens and the Transovarial Transmission of Its Yeast-Like Symbiont. Insects 2024, 15, 425. https://doi.org/10.3390/insects15060425
Yu J-B, Lv X, Liu Q, Tu J-Y, Yu X-P, Xu Y-P. Death-Associated Protein-1 Plays a Role in the Reproductive Development of Nilaparvata lugens and the Transovarial Transmission of Its Yeast-Like Symbiont. Insects. 2024; 15(6):425. https://doi.org/10.3390/insects15060425
Chicago/Turabian StyleYu, Jian-Bin, Xin Lv, Qian Liu, Jia-Yu Tu, Xiao-Ping Yu, and Yi-Peng Xu. 2024. "Death-Associated Protein-1 Plays a Role in the Reproductive Development of Nilaparvata lugens and the Transovarial Transmission of Its Yeast-Like Symbiont" Insects 15, no. 6: 425. https://doi.org/10.3390/insects15060425